Overview

Brief Summary

The Western Flower Thrips (Frankliniella occidentalis) is an invasive species and the most economically important of the approximately 5500 described species of thrips. This thrips causes enormous damage by feeding on greenhouse vegetable and ornamental crops and by transmitting plant-pathogenic tospoviruses. It is native to western North America, west of the Rocky Mountains from Mexico to Alaska, but since the 1970s has established across North America and invaded most countries in the world. It is now present on every continent but Antarctica. Brunner & Frey  (2010) identified two ecotypes corresponding to different climate regimes, possibly representing two cryptic species between which reproductive isolation has evolved, as suggested by Rugman-Jones et al. (2010).

Morphological identification of thrips is difficult because of their small size and similar appearance. Zhang et al. (2012) developed a simple PCR-based test to distinguish invasive Western Flower Thrips in China (where the species was first reported in 2003 and was established as a serious pest within five years). Such molecular tests are especially useful for the identification of eggs, first-stage larvae, pre-pupae, and pupae.

Western Flower Thrips is a major worldwide pest of a great diversity of agricultural and horticultural crops. It is highly polyphagous and causes direct feeding damage to fruits, leaves, and flowers. It also acts as a major vector of tospoviruses, most notably tomato spotted wilt virus (family Bunyaviridae, genus Tospovirus,TSWV). In The Netherlands alone, estimates indicate annual losses from direct damage by Western Flower thrips of $30 million, with additional losses from TSWV adding an additional $19 million. Western Flower Thrips has become a major invasive pest of vegetable and ornamental crops grown in open fields, shadehouses, and glasshouses (greenhouses) only since the late 1970s, although  it has long been regarded as a pest in its native range. As early as 1934, Western Flower Thrips was detected outside its native range, on naturalized California lupins in wild areas of New Zealand (they are abundant on introduced tree lupin, Lupinus arboreus, in sand dunes). However, this New Zealand population caused no apparent problems on crops and has traditionally been recognized as a distinct “lupin strain" (however, the pest strain apparently reached New Zealand in the early 1990s).

These distributions were apparently stable until the early 1980s, when Western Flower Thrips began to appear throughout the United States and adjacent Canada. In 1983, they colonized Dutch glasshouses and from there quickly spread across Europe and into northern Africa. They invaded South Africa and much of Asia. Globally, Western Flower Thrips is now probably the most important insect pest of commercial glasshouses and also has established in many outdoor crops. The discovery that there are apparently two reproductively isolated cryptic species of "Western Flower Thrips", that have been inadvertently lumped under the name Frankliniella occidentalis (Rugman-Jones et al. 2010) has important implications for interpreting past studies and planning future ones.

Western Flower Thrips are highly variable in size and color. Although adult males are all pale, female color ranges from nearly white through yellowish to black. The "glasshouse strain" that has spread around the world varies from pale to intermediate, and dark forms are rare.

In its native distribution, the Western Flower Thrips has a broad ecological range, being found from sea level to subalpine altitudes and from wet to arid habitats. In California, it occurs across many vegetation types from the Pacific coast to the interior mountain ranges at elevations up to 3,000m. Although most thrips are host-plant specific, the Western Flower Thrips is highly polyphagous, having been reported to feed on more than 240 plant species in 62 different plant families; these thrips can also be important mite predators under some circumstances (Mound 2005).

Kirk and Terry (2003) attempted to reconstruct the geographic spread of Western Flower Thrips.

Morse and Hoddle reviewed the invasion biology of thrips in general (Morse and Hoddle 2006).

(Kirk and Terry 2003; Brunner and Frey 2010 and references therein; Rugman-Jones et al. 2010 and references therein)

  • Brunner, P.C. and J.E. Frey. 2010. Habitat-specific population structure in native western flower thrips Frankliniella occidentalis (Insecta, Thysanoptera). Journal of Evolutionary Biology 23:797-804.
  • Brunner, P.C. and J.E. Frey. 2004. Isolation and characterization of six polymorphic microsatellite loci in the western flower thrips Frankliniella occidentalis (Insecta, Thysanoptera). Molecular Ecology Notes 4: 599–601.
  • Morse, J.G. and M.S. Hoddle. 2006. Invasion biology of thrips. Annual Review of Entomology 51: 67-89.
  • Mound, L.A. 2005. Thysanoptera: diversity and interactions. Annual Review of Entomology 50: 247-269.
  • Reitz, S.R. 2009. Biology and ecology of the western flower thrips (Thysanoptera: Thripidae): the making of a pest. Florida Entomologist 92:7-13.
  • Rugman-Jones, P.F., M.S. Hoddle, and R. Stouthamer. 2010. Nuclear-Mitochondrial barcoding exposes the global pest western flower thrips (Thysanoptera: Thripidae) as two sympatric cryptic species in its native California. Journal of Economic Entomology 103:877-886.
  • Yang, X.-M., J.-T. Sun, X.-F. Xue, J.-B. Li, and X.-Y. Hong . 2012. Invasion Genetics of the Western Flower Thrips in China: Evidence for Genetic Bottleneck, Hybridization and Bridgehead Effect. PLoS One 7(4): e34567. doi:10.1371/journal.pone.0034567
  • Zhang, G. F., X.Q. Meng, L. Min, et al. 2012. Rapid diagnosis of the invasive species, Frankliniella occidentalis (Pergande): a species-specific COI marker. Journal of Applied Entomology 136(6): 6: 410-420.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The body varies in colour from yellow to brown, but most commonly is dark yellow with brown areas medially on each tergite. Males tend to be paler than females. Antennal segments 2, and 6 to 8 are brown, segments 3 to 5 are yellow with brown apices. The legs are mainly yellow with a hint of brown. The head is wider than long, with 3 pairs of ocellar setae present, and pair 3 arises on the anterior margins of the ocellar triangle. The antennae are 8 segmented, and segments 3 and 4 each have a forked sense cone. Antennal segment 8 is longer than segment 7. Postocular setae pair 1 is present, and pair 4 is longer than the distance between the hind ocelli. The pronotum has 5 pairs of major setae, and the anteromarginal setae are somewhat shorter than the anteroangulars. The metanotum has 2 pairs of setae along the anterior margin, and 2 campaniform sensilla are present. Females are macropterous, and the forewing has 2 complete rows of veinal setae. There is a complete posteromarginal comb on tergite 8 (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Widespread around the world (Moritz et al., 2001), but native to the New World in the west (Heming).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

A broad range of plants, in flowers and on leaves, also in greenhouses (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on host plants, and is also a predator on spider mites (Chiasson, 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Magnoliopsida

Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Saintpaulia ionantha
Other: major host/prey

Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Dendranthema

Virus / infection vector
Tomato Spotted Wilt virus is spread by larva of Frankliniella occidentalis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Late spring and early summer (Bryan and Smith, 1956).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

This species can be found on a wide variety of plants including: beans, apple, Salix sp. Rosa acicularis, Shepherdia canadensis, Alnus sp., Linnaea borealis, Hordeum jubatum, Melilotus, (Chiasson, 1986), in green houses and malls (Heming). F. occidentalis causes serious damage to flowers and fruits though feeding (Stannard, 1968), but is also a predator of spider mites (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Frankliniella occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 167 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTAATAACATAAGATTTTGACTTCTTCCACCCTCTTTAACATTGTTAATTATAGGT---TTATCAAAAGATGGTGCAGGAACAGGATGAACAGTTTACCCACCTTTGTCA---ACTTTTTATCACTCTGGACCATCAGTAGATTTAACTATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTCTAGGAGCTTTAAATTTTATTACAACGATTTTAAATTTAAAGATCAAAAAATTAACAACGGAAAAGATAACTTTATTTGTTTGATCAGTTATTTTAACAGCTATTTTATTATTATTGTCGTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAACTTAAATACATCCTTCTTTGATCCGAGAGGAGGTGGGGACCCAGTTTTATACCAGCACTTGTTTTGATTTTTTGGGCACCCAGAAGTTTATATTTTAATCTTGCCTGGTTTTGGTTTAATCTCCCATATTATTACACAAGAAAGGAATAAAAAAAGAACATTTGGATTAATAGGAATAATTTACGCTATAATGGCTATTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Frankliniella occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 100
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

A vector of Tomato spotted wilt virus (Mound and Marullo, 1986), a major pest (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western flower thrips

The western flower thrips [Frankliniella occidentalis (Pergande)] is an important pest insect in agriculture. This species of thrips is native to the Southwestern United States[1] but has spread to other continents, including Europe, Australia (where it was identified in May 1993[1]), and South America via transport of infested plant material.[2] It has been documented to feed on over 500 different species of host plants, including a large number of fruit, vegetable, and ornamental crops. The adult male is about 1 mm long; the female is slightly larger, about 1.4 mm in length. Most western flower thrips are female and reproduce by arrhenotokous parthenogenesis; i.e. females can produce males from unfertilized eggs, but females arise only from fertilized eggs.[1] Males are rare, and are always pale yellow, while females vary in color, often by season, from red to yellow to dark brown.[1] Each adult is elongated and thin, with two pairs of long wings. The eggs are oval or kidney-shaped, white, and about 0.2 mm long. The nymph is yellowish in color with red eyes.

The lifecycle of the western flower thrips varies in length due to temperature, with the adult living from two to five or more weeks, and the nymph stage lasting from five to 20 days. Each female may lay 40 to over 100 eggs in the tissues of the plant, often in the flower, but also in the fruit or foliage. The newly hatched nymph feeds on the plant for two of its instars, then falls off the plant to complete its other two instar stages. The insect damages the plant in several ways. The major damage is caused by the adult ovipositing in the plant tissue. The plant is also injured by feeding, which leaves holes and areas of silvery discoloration when the plant reacts to the insect's saliva. Nymphs feed heavily on new fruit just beginning to develop from the flower. The western flower thrips is also the major vector of tomato spotted wilt virus, a serious plant disease.

Western flower thrips are a year-round pest, but is less destructive during wet weather. Damage can be reduced by growing barriers of nonhost plants around crops and by eliminating reservoir plants, plants to which the thrips are especially attracted, such as jimson weed. The thrips' natural enemies include pirate bugs of genus Orius. Other agents show promise as biological pest control, including the fungus Metarhizium anisopliae.[3]

Flower-feeding thrips are routinely attracted to bright floral colors, especially white, blue, and yellow, and will land and attempt to feed. Some flower thrips will "bite" humans wearing clothing with such bright colors, though no species feed on blood; such biting does not result in any known disease transmission, but skin irritations are known to occur.[4]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!