Overview

Comprehensive Description

General Description

The body varies in colour from yellow to brown, but most commonly is dark yellow with brown areas medially on each tergite. Males tend to be paler than females. Antennal segments 2, and 6 to 8 are brown, segments 3 to 5 are yellow with brown apices. The legs are mainly yellow with a hint of brown. The head is wider than long, with 3 pairs of ocellar setae present, and pair 3 arises on the anterior margins of the ocellar triangle. The antennae are 8 segmented, and segments 3 and 4 each have a forked sense cone. Antennal segment 8 is longer than segment 7. Postocular setae pair 1 is present, and pair 4 is longer than the distance between the hind ocelli. The pronotum has 5 pairs of major setae, and the anteromarginal setae are somewhat shorter than the anteroangulars. The metanotum has 2 pairs of setae along the anterior margin, and 2 campaniform sensilla are present. Females are macropterous, and the forewing has 2 complete rows of veinal setae. There is a complete posteromarginal comb on tergite 8 (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Widespread around the world (Moritz et al., 2001), but native to the New World in the west (Heming).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

A broad range of plants, in flowers and on leaves, also in greenhouses (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on host plants, and is also a predator on spider mites (Chiasson, 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Magnoliopsida

Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Saintpaulia ionantha
Other: major host/prey

Foodplant / feeds on
Frankliniella occidentalis feeds on petal of Dendranthema

Virus / infection vector
Tomato Spotted Wilt virus is spread by larva of Frankliniella occidentalis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Late spring and early summer (Bryan and Smith, 1956).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

This species can be found on a wide variety of plants including: beans, apple, Salix sp. Rosa acicularis, Shepherdia canadensis, Alnus sp., Linnaea borealis, Hordeum jubatum, Melilotus, (Chiasson, 1986), in green houses and malls (Heming). F. occidentalis causes serious damage to flowers and fruits though feeding (Stannard, 1968), but is also a predator of spider mites (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Frankliniella occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 167 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTAATAACATAAGATTTTGACTTCTTCCACCCTCTTTAACATTGTTAATTATAGGT---TTATCAAAAGATGGTGCAGGAACAGGATGAACAGTTTACCCACCTTTGTCA---ACTTTTTATCACTCTGGACCATCAGTAGATTTAACTATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTCTAGGAGCTTTAAATTTTATTACAACGATTTTAAATTTAAAGATCAAAAAATTAACAACGGAAAAGATAACTTTATTTGTTTGATCAGTTATTTTAACAGCTATTTTATTATTATTGTCGTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAACTTAAATACATCCTTCTTTGATCCGAGAGGAGGTGGGGACCCAGTTTTATACCAGCACTTGTTTTGATTTTTTGGGCACCCAGAAGTTTATATTTTAATCTTGCCTGGTTTTGGTTTAATCTCCCATATTATTACACAAGAAAGGAATAAAAAAAGAACATTTGGATTAATAGGAATAATTTACGCTATAATGGCTATTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Frankliniella occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 100
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

A vector of Tomato spotted wilt virus (Mound and Marullo, 1986), a major pest (Moritz et al., 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western flower thrips

The western flower thrips [Frankliniella occidentalis (Pergande)] is an important pest insect in agriculture. This species of thrips is native to the Southwestern United States[1] but has spread to other continents, including Europe, Australia (where it was identified in May 1993[1]), and South America via transport of infested plant material.[2] It has been documented to feed on over 500 different species of host plants, including a large number of fruit, vegetable, and ornamental crops. The adult male is about 1 mm long; the female is slightly larger, about 1.4 mm in length. Most western flower thrips are female and reproduce by arrhenotokous parthenogenesis; i.e. females can produce males from unfertilized eggs, but females arise only from fertilized eggs.[1] Males are rare, and are always pale yellow, while females vary in color, often by season, from red to yellow to dark brown.[1] Each adult is elongated and thin, with two pairs of long wings. The eggs are oval or kidney-shaped, white, and about 0.2 mm long. The nymph is yellowish in color with red eyes.

The lifecycle of the western flower thrips varies in length due to temperature, with the adult living from two to five or more weeks, and the nymph stage lasting from five to 20 days. Each female may lay 40 to over 100 eggs in the tissues of the plant, often in the flower, but also in the fruit or foliage. The newly hatched nymph feeds on the plant for two of its instars, then falls off the plant to complete its other two instar stages. The insect damages the plant in several ways. The major damage is caused by the adult ovipositing in the plant tissue. The plant is also injured by feeding, which leaves holes and areas of silvery discoloration when the plant reacts to the insect's saliva. Nymphs feed heavily on new fruit just beginning to develop from the flower. The western flower thrips is also the major vector of tomato spotted wilt virus, a serious plant disease.

Western flower thrips are a year-round pest, but is less destructive during wet weather. Damage can be reduced by growing barriers of nonhost plants around crops and by eliminating reservoir plants, plants to which the thrips are especially attracted, such as jimson weed. The thrips' natural enemies include pirate bugs of genus Orius. Other agents show promise as biological pest control, including the fungus Metarhizium anisopliae.[3]

Flower-feeding thrips are routinely attracted to bright floral colors, especially white, blue, and yellow, and will land and attempt to feed. Some flower thrips will "bite" humans wearing clothing with such bright colors, though no species feed on blood; such biting does not result in any known disease transmission, but skin irritations are known to occur.[4]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!