Overview

Comprehensive Description

Description

The Dendrobates leucomelas snout-to-vent length ranges from 31 to 38 mm (Walls 1994). D. leucomelas is the largest species of its genus and females are usually bigger and thicker than males (Honolulu Zoo 2002). Adult frogs are black dorsally with three broad crossbands colored bright yellow, yellow-orange, or orange; black spots or blotches are often present in the crossbands as well as on the yellow or orange limbs. The belly is black and usually lacks color. All markings are variable, making each frog unique. Color pattern does not seem to be correlated with geography. D. leucomelas lacks an omosternum and the tarsal tubercle is absent or barely present (Walls 1994). Unique glandular adhesive pads are present on the toes and fingertips, helping D. leucomelas to climb and stay in stationary positions. D. leucomelas also lacks webbing on its feet. Although adult D. leucomelas have been illustrated extensively, no illustrations of this species' tadpoles exist (USGS 2002).

Similar Species:
Dendrobates auratus is an established exotic dendrobatid in Hawaii and most closely resembles D. leucomelas (USGS 2002). However, D. auratus does not have three distinct crossbands (McKeown 1996). Due to the absence of the omosternum, D. leucomelas is considered a close relative to D. historionicus (also lacking the omosternum). But Myers and colleagues have removed D. leucomelas from the historionicus-group due to its differences in call (Walls 1994). It has also been placed in the tinctorius-group because of its similarities to others in that group with tadpole behavior, aspects of color pattern, and its resemblance to D. auratus and D. tinctorius. It has also been successfully bred with D. tinctorius and D. truncates (Walls 1994).

  • American Museum of Natural History, Department of Herpetology (2002). Amphibian Species of the World Database. http://research.amnh.org/cgi-bin/herpetology/amphibia.
  • Barrio, C.L. and Fuentes, O. (1999). ''Sinopsis de la familia Dendrobatidae (Amphibia: Anura) de Venezuela.'' Acta Biologica Venezuelica, 19(3), 1-10.
  • CITES (2002). Cites Website. http://www.cites.org.
  • Caldwell, J. P. (1996). ''The evolution of myrmecophagy and its correlates in poison frogs (Family Dendrobatidae).'' Journal of Zoology (London), 240(1), 75-101.
  • Frank, N. and Ramus, E. (1995). A Complete Guide to Scientific and Common Names of Reptiles and Amphibians of the World. NG Publishing Inc., Pottsville, Pennsylvania.
  • Honolulu Zoo (2002). ''.'' ''http://www.honoluluzoo.org/yellow-banded_dart_frog.htm.''
  • McKeown, S. (1996). A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California.
  • Myers, C. W. and Daly, J. W. (1976). ''Preliminary evaluation of skin toxins and vocalisations in taxonomic and evolutionary studies of poison-dart frogs (Dendrobatidae).'' Bulletin of the American Museum of Natural History, 157(3), 173-262.
  • Richard Stockton College of New Jersey Biology (2002). Information on the Breeding Cycle of Poison Dart Frogs. http://www2.stockton.edu/academics/undergraduate/natural_and_math_science/labs/biology/html/poison_frogs/info_breeding.html
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • USGS (2002). ''USGS NonIndigenous Aquatic Species .'' ''http://nas.er.usgs.gov.''
  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Barrio, C. L. and Fuentes, O. (1998). ''Distribución de Dendrobates leucomelas (Anura: Dendrobatidae) en Venezuela.'' Acta Biologica Venezuelica, 18(3), 35-41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known from the Guianan Orinoco drainage of Venezuela north to the Río Orinoco (in Bolívar and Amazonas States), east into Guyana to the Essequibo River, south into extreme northern Brazil, and west into eastern Amazonian Colombia. In Venezuela it has been recorded from sea level up to 500m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Dendrobates leucomelas is found in the Guianan Orinoco drainage of Venezuela north to the Río Orinoco, east into Guyana to the Essequibo River, south into extreme northern Brazil, and west into eastern Amazonian Colombia (Amphibian Species of the World AMNH website). They are native to South America but in 1994 one specimen was collected on Honolulu, Oahu, Hawaii, possibly due to a pet release (USGS 2002). D. leucomelas prefers moist or wet, forested, lowland regions and temperatures often reaching 30° C or warmer (Silverstone 1975; Honolulu Zoo 2002). They are usually found between 50 and 800 meters above sea level in leaf litter, fallen trees, forest floors, stones and occasionally trees (Honolulu Zoo 2002; Walls 1994).

  • American Museum of Natural History, Department of Herpetology (2002). Amphibian Species of the World Database. http://research.amnh.org/cgi-bin/herpetology/amphibia.
  • Barrio, C.L. and Fuentes, O. (1999). ''Sinopsis de la familia Dendrobatidae (Amphibia: Anura) de Venezuela.'' Acta Biologica Venezuelica, 19(3), 1-10.
  • CITES (2002). Cites Website. http://www.cites.org.
  • Caldwell, J. P. (1996). ''The evolution of myrmecophagy and its correlates in poison frogs (Family Dendrobatidae).'' Journal of Zoology (London), 240(1), 75-101.
  • Frank, N. and Ramus, E. (1995). A Complete Guide to Scientific and Common Names of Reptiles and Amphibians of the World. NG Publishing Inc., Pottsville, Pennsylvania.
  • Honolulu Zoo (2002). ''.'' ''http://www.honoluluzoo.org/yellow-banded_dart_frog.htm.''
  • McKeown, S. (1996). A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California.
  • Myers, C. W. and Daly, J. W. (1976). ''Preliminary evaluation of skin toxins and vocalisations in taxonomic and evolutionary studies of poison-dart frogs (Dendrobatidae).'' Bulletin of the American Museum of Natural History, 157(3), 173-262.
  • Richard Stockton College of New Jersey Biology (2002). Information on the Breeding Cycle of Poison Dart Frogs. http://www2.stockton.edu/academics/undergraduate/natural_and_math_science/labs/biology/html/poison_frogs/info_breeding.html
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • USGS (2002). ''USGS NonIndigenous Aquatic Species .'' ''http://nas.er.usgs.gov.''
  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Barrio, C. L. and Fuentes, O. (1998). ''Distribución de Dendrobates leucomelas (Anura: Dendrobatidae) en Venezuela.'' Acta Biologica Venezuelica, 18(3), 35-41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Yellow banded poison dart frogs, Dendrobates leucomelas, are found in the Neotropical region, in northern South America. The range includes Venezuela, northern Brazil, Guyana and southeastern Colombia.

Biogeographic Regions: neotropical (Native )

  • Staniszewski, M. 1995. Amphibians in Captivity. Neptune City, New Jersey, USA: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dendrotes leucomelas is one of the largest species in the genus Dendrobates, with an adult body (snout to vent) length ranging from 3.1 to 5 cm, although individuals are only rarely more than 4 cm. Average weights of 3 g are reported.

This species is defined by its distinctive yellow and black bands across the body. As an individual frog ages, the black bands often break off into spots. This bright coloration undoubtedly represents aposematic coloration, which is defined as having conspicuously bright colors that are used as a warning of danger or distastefulness to potential predators. These frogs are known to produce toxic chemicals in their skin, making htem poisonous to most would-be predators. Females of this species are often larger and more robust than the males.

Average mass: 3 g.

Range length: 31 to 50 mm.

Average length: 40 mm.

Other Physical Features: ectothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: female larger

  • Walls, J. 1994. Jewels of the Rainforest. Neptune City, N.J.: J.F.H. Publications.
  • Bartlett, R. 2003. Poison Dart Frogs. Hauppauge, New York, USA: Barron's Educational Series, Inc..
  • Doyle, D. 1999. "Doyle's Dart Den" (On-line). Accessed January 05, 2005 at http://www.doylesdartden.com/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This brightly coloured diurnal frog is found in leaf-litter, on the ground, on open rocks, near rivers and rivulets, under logs and on trunks of fallen or inclined vegetation in tropical rainforests. During the dry season, specimens congregate under rocks and fallen tree-trunks. Eggs are laid out of water, and the tadpoles are then carried to streams where they develop further. It is adaptable to some habitat disturbance.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-banded poison dart frogs prefer humid or wet habitats and can be found on forest soil in moist stones, wet tree trunks, and roots of rainforest trees. Tadpoles can be found in epiphyllic plants such as bromeliads. They are found in lowland regions with average temperatures of 26 to 30 degrees celsius or above. These frogs have been reported at elevations of 50 to 800 m above sea level.

Range elevation: 50 to 800 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Largely insectivorous, the diet of these frogs consists of ants, termites, tiny beetles, crickets, and other small insects and spiders. They spend most of their time in the wild foraging for food, presumably because their prey are so small. In captivity, they are fed crickets and fruit flies (often, "pinhead" crickets and wingless fruit flies). When raised in captivity, D. leucomelas lose their skin toxins, which indicates that they may synthesize the toxins from some component of their diet. One major source of food in the wild that may provide chemicals to synthesize the toxins are formacine ants.

Young are sometimes canabalistic, although this behavior is apparently limited to times when unwary adults place new tadpoles into an already occupied pool. Although some Dendrobates species feed their young with unfertilized eggs, this behavior has not been observed in D. leucomelas.

Animal Foods: amphibians; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

These animals, along with all other animals, play an important role in maintaining the balance of nature. They are predators of ants, termites, tiny beetles, crickets, and other small insects and spiders. They are prey to snakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Many potential predators are undoubtedly repelled by the toxic skin secretions of this frog, but some snakes may be able to eat them. The tadpoles are also prey to damselfly nymphs.

Known Predators:

  • snakes
  • damselflies

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Males use vocalizations such as chirps, buzzes, trills and hums to attract females. Direct behavioral actions facilitate courtship and stimulate oviposition. Call sound like pleasant "birdlike" trills, lasting for 10 to 15 seconds.

In addition to vocalizations, males use visual cues as well to show off their brightly colored bodies. Tactile communication is important in breeding, as females and males touch one another in courtship.

Tadpoles use vibrations through water to signal their presence in a water pool to adult frogs. Should a male deposit a second tadpole into a pool, the first tadpole is likely to eat it.

These frogs depend upon vision to locate prey. In general frogs are not known to have a strong sense of smell, so it is unlikely that they use chemical communication.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Male poison dart frogs find the best site for the female to deposit a few large eggs, usually on the underside of a leaf that is near water. The eggs are then fertilized, protected and maintained by the male. It is the male's duty to keep the eggs moist so they can grow. There are conflicting reports of the paternal care of these frogs, with some accounts indicating that the male of this species transports the fertilized eggs in his mouth to water (Honolulu Zoo, 2003) and others indicating that the male transports tadpoles to water after the eggs have hatched (Lehmann, 2003). The reason for this discrepency is not apparent, although it may be reasonably concluded that transport of the young is accomplished by their father. Eggs hatch into tadpoles about 10 to 14 days after fertilization.

After 70 to 90 days, the tadpoles have fully metamorphed into froglets. They are mature between 12 and 18 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest living Dendrobates in captivity survived for 20.5 years. However, the expected lifespan of a poison dart frog in captivity is 10 to 15 years. In the wild, individuals probably live from 5 to 7 years.

Range lifespan

Status: captivity:
20.5 (high) years.

Typical lifespan

Status: wild:
5 to 7 years.

Typical lifespan

Status: captivity:
10 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During mating season, males use vocalizations described as chirps, buzzes, trills, and hums to get the attemtion of females. They also show off their brightly colored bodies. Calling is most intense for an hour or two after sunrise and before sunset.

After a female chooses a male, she follows him to his chosen breeding ground and strokes his back and snout. Sometimes both the male and female slowly circle one another and stamp their feet. Females compete for males.

The male frog leads the female to an appropriate spot to deposit her eggs. The eggs are usually laid on leaves, in areas of high humidity. Then the male frog tends to the eggs and newly hatched tadpoles.

In some species in the genus Dendrobates, newly hatched tadpoles cling the male's back. Sitting upon their father, the tadpoles ride through the forest understory. The male climbs high up into the forest canopy, where he deposits the tadpoles into one of a variety of water-holding plants, particularly bromeliads. Although most sources indicate that this is also true for D. leucomelas, at least one indicates that the male transports the eggs to a water source prior to hatching (Honolulu Zoo, 2003).

Bromeliads are ideal for tadpole growth because they have numerous cup-like leaves filled with water. One tadpole is placed in each pocket of water. The parent distributes the tadpoles among many plants, presumably so that predators will not be able to locate all of the tadpoles. The primary predators on the tadpoles are giant damselfly nymphs, which have hatched from eggs also laid in the bromelid plants.

Another danger for the tadpoles is other dart frogs, including conspecifics. If an adult frog approaches a plant that is already occupied, the tadpole will produce a warning signal by aiming its head at the center of the plant, holding itself rigid, and rapidly vibrating its tail. If an tadpole-carrying parent ignores this signal and accidentally deposits another tadpole in the same bromelid sanctuary, the original tadpole will eat it.

Mating System: polygynandrous (promiscuous)

Breeding occurs during a limited season each year, from February to March. Female D. leucomelas lay multiple clutches of 2 to 12 eggs, and may lay as many as 1000 eggs during the breeding season.

Eggs are fertilized externally, then cared for by the male of the species. Young metamorphose by 70 to 90 days of age. The young froglets are sexually mature by two years of age.

Breeding interval: Once yearly during the rainy season

Breeding season: Breeding is reported to occur between February and March.

Range number of offspring: 100 to 1000.

Range time to hatching: 10 to 14 days.

Range time to independence: 70 to 90 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

The degree and pattern of parental care varies between species of poison dart frogs. In D. leucomelas, the male does all of the parenting. The male tends to the eggs and the hatched tadpoles, and transfers them to the water-filled cavities high in the forest canopy. The female provides the eggs with nutrients to support the tadpole before it hatches, but the male continues to wet and protect the young until they are independent.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-weaning/fledging (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrobates leucomelas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCCTATACTTAGTCTTTGGGGCATGAGCCGGAATAGTCGGCACAGCCCTCAGTCTCTTAATCCGAGCAGAACTGAGCCAACCTGGGGCCCTCCTAGGCGAC---GACCAAATCTACAACGTAATTGTCACCGCTCATGCTTTTGTAATAATCTTTTTTATAGTTATACCAATCCTGATTGGGGGGTTCGGGAACTGACTTGTCCCCCTAATAATTGGAGCCCCGGACATGGCCTTTCCTCGTATAAACAACATAAGCTTCTGATTACTCCCTCCCTCTTTTCTTCTACTTTTGGCTTCAGCTGGGGTAGAAGCCGGAGCCGGAACAGGTTGAACTGTCTATCCCCCCCTTGCAGGAAACTTAGCTCATGCTGGCCCATCTGTTGACTTAACCATTTTCTCCCTTCACCTGGCCGGAGTCTCATCTATCTTGGGGGCAATCAATTTTATTACTACCACCCTTAACATAAAACCCCCATCCTTAACACAATATCAAACCCCCCTATTCGTCTGATCTGTTCTAATTACAGCCGTATTACTTCTCCTCTCTCTACCAGTTCTGGCTGCAGGCATCACTATACTTCTTACCGATCGAAACTTAAACACTACCTTCTTCGACCCCGCTGGAGGAGGCGACCCAGTTCTTTATCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrobates leucomelas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Enrique La Marca, Claudia Azevedo-Ramos

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These frogs are not thought to be an especial conservation concern. They are listed on CITES appendix II, probably because of exploitation and destruction of their habitat for lumber.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Dendrobates leucomelas is an insectivore (mostly ants) and is diurnal (USGS 2002; Caldwell 1996; Silverstone 1975). D. leucomelas is toxic in its natural environment and derives its skin toxins from the ants in its diet (Caldwell 1996). It is the only poison frog known to estivate during the dry season (Walls 1994). Males will chirp, buzz, trill, and hum to get females attention while also showing off their brightly colored bodies for an hour or two after sunrise and before sunset (Honolulu Zoo 2002; Walls 1994). Once a female chooses a male she will follow him to his area and stroke his back and snout. Sometimes both the male and female will slowly circle one another and stamp their feet (Walls 1994). The D. leucomelas females compete for males, and the terrestrial eggs are guarded by the male parent in a moist, sheltered area (USGS 2002).

Females lay 100 to 1000 eggs per year and produce 2 to 12 eggs per clutch (Honolulu Zoo 2002). The male rotates the eggs every so often so that they receive enough oxygen. Unlike most historionicus-group dendrobatids, the D. leucomelas tadpoles do not rely on eggs for nutrition; but they will accept almost anything for food (Walls 1994). Once they hatch, the tadpoles are carried on the father's back to small pools of water where they continue to develop (USGS 2002; Richard Stockton College 2002). Metamorphosis takes 70 to 90 days; froglets resemble miniature adults but have duller colored bands. In captivity the froglets must eat regularly (fruit flies, pinhead crickets, and other small insects); going without food for 48 hours can lead to death. Some people have observed that they have a "sweet tooth" for small caterpillars (Walls 1994).

  • American Museum of Natural History, Department of Herpetology (2002). Amphibian Species of the World Database. http://research.amnh.org/cgi-bin/herpetology/amphibia.
  • Barrio, C.L. and Fuentes, O. (1999). ''Sinopsis de la familia Dendrobatidae (Amphibia: Anura) de Venezuela.'' Acta Biologica Venezuelica, 19(3), 1-10.
  • CITES (2002). Cites Website. http://www.cites.org.
  • Caldwell, J. P. (1996). ''The evolution of myrmecophagy and its correlates in poison frogs (Family Dendrobatidae).'' Journal of Zoology (London), 240(1), 75-101.
  • Frank, N. and Ramus, E. (1995). A Complete Guide to Scientific and Common Names of Reptiles and Amphibians of the World. NG Publishing Inc., Pottsville, Pennsylvania.
  • Honolulu Zoo (2002). ''.'' ''http://www.honoluluzoo.org/yellow-banded_dart_frog.htm.''
  • McKeown, S. (1996). A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California.
  • Myers, C. W. and Daly, J. W. (1976). ''Preliminary evaluation of skin toxins and vocalisations in taxonomic and evolutionary studies of poison-dart frogs (Dendrobatidae).'' Bulletin of the American Museum of Natural History, 157(3), 173-262.
  • Richard Stockton College of New Jersey Biology (2002). Information on the Breeding Cycle of Poison Dart Frogs. http://www2.stockton.edu/academics/undergraduate/natural_and_math_science/labs/biology/html/poison_frogs/info_breeding.html
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • USGS (2002). ''USGS NonIndigenous Aquatic Species .'' ''http://nas.er.usgs.gov.''
  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Barrio, C. L. and Fuentes, O. (1998). ''Distribución de Dendrobates leucomelas (Anura: Dendrobatidae) en Venezuela.'' Acta Biologica Venezuelica, 18(3), 35-41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Agriculture, logging and fire are threats to the species' habitat. It is also in the international pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Since D. leucomelas is easily bred in captivity, the selling price on the international market has decreased (Barrio & Fuentes 1999). D. leucomelas is abundant in all places sampled by Barrio and Fuentes in the late 1990's. However, there has not been thorough monitoring to determine the current status of these frogs (Barrio & Fuentes 1998). Dendrobatids are exploited for the pet trade and it is believed that they are overharvested in some areas. They could face declines unless strict trade regulations are set. (CITES 2002). Their habitat is also being destroyed by timber industries and agriculture.

  • American Museum of Natural History, Department of Herpetology (2002). Amphibian Species of the World Database. http://research.amnh.org/cgi-bin/herpetology/amphibia.
  • Barrio, C.L. and Fuentes, O. (1999). ''Sinopsis de la familia Dendrobatidae (Amphibia: Anura) de Venezuela.'' Acta Biologica Venezuelica, 19(3), 1-10.
  • CITES (2002). Cites Website. http://www.cites.org.
  • Caldwell, J. P. (1996). ''The evolution of myrmecophagy and its correlates in poison frogs (Family Dendrobatidae).'' Journal of Zoology (London), 240(1), 75-101.
  • Frank, N. and Ramus, E. (1995). A Complete Guide to Scientific and Common Names of Reptiles and Amphibians of the World. NG Publishing Inc., Pottsville, Pennsylvania.
  • Honolulu Zoo (2002). ''.'' ''http://www.honoluluzoo.org/yellow-banded_dart_frog.htm.''
  • McKeown, S. (1996). A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California.
  • Myers, C. W. and Daly, J. W. (1976). ''Preliminary evaluation of skin toxins and vocalisations in taxonomic and evolutionary studies of poison-dart frogs (Dendrobatidae).'' Bulletin of the American Museum of Natural History, 157(3), 173-262.
  • Richard Stockton College of New Jersey Biology (2002). Information on the Breeding Cycle of Poison Dart Frogs. http://www2.stockton.edu/academics/undergraduate/natural_and_math_science/labs/biology/html/poison_frogs/info_breeding.html
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • USGS (2002). ''USGS NonIndigenous Aquatic Species .'' ''http://nas.er.usgs.gov.''
  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Barrio, C. L. and Fuentes, O. (1998). ''Distribución de Dendrobates leucomelas (Anura: Dendrobatidae) en Venezuela.'' Acta Biologica Venezuelica, 18(3), 35-41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Some populations live within protected areas south of the Orinoco river in Venezuela. It is considered in the Venezuelan Red Data Book as Lower Risk, Least Concern. It is listed under Appendix II of CITES (listed 22-10-1987), and in the European Community, it is listed under regulation 338/97, Annex B, listed on 01-06-1997 (Walls 1994; Cites web-site). It breeds easily in captivity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These frogs have no adverse economic impact to humans. The skin toxins of this frog are very intense, and are are capable of killing, injuring, or impairing humans if the frogs are carelessly handled; however they are of no danger to people who leave the frogs alone.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Dendrobates leucomelas helps keep its prey populations in balance, and consumes many insects that humans would consider pests. Along with other poison dart frogs in the family Dendrobatidae, this frog is used in medical research because its complex skin toxins are a possible source of medicines for human diseases. Also, certain Dendrobatid frogs were of importance to the Colombian Choco Indians who used the poisons from the frog's skin to tip their hunting darts.

Some amphibian hobbyists keep and breed these and other poison dart frogs, which may have an economic benefit if such trade can be shown to be sustainable and does not reduce natural frog populations.

Positive Impacts: pet trade ; source of medicine or drug ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

Humans keep D. leucomelas for pets and are popular species in the pet trade (USGS 2002). Some compounds of their skin have pharmacological properties, and have proved to be valuable in biomedical research (Honolulu Zoo 2002).

  • American Museum of Natural History, Department of Herpetology (2002). Amphibian Species of the World Database. http://research.amnh.org/cgi-bin/herpetology/amphibia.
  • Barrio, C.L. and Fuentes, O. (1999). ''Sinopsis de la familia Dendrobatidae (Amphibia: Anura) de Venezuela.'' Acta Biologica Venezuelica, 19(3), 1-10.
  • CITES (2002). Cites Website. http://www.cites.org.
  • Caldwell, J. P. (1996). ''The evolution of myrmecophagy and its correlates in poison frogs (Family Dendrobatidae).'' Journal of Zoology (London), 240(1), 75-101.
  • Frank, N. and Ramus, E. (1995). A Complete Guide to Scientific and Common Names of Reptiles and Amphibians of the World. NG Publishing Inc., Pottsville, Pennsylvania.
  • Honolulu Zoo (2002). ''.'' ''http://www.honoluluzoo.org/yellow-banded_dart_frog.htm.''
  • McKeown, S. (1996). A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California.
  • Myers, C. W. and Daly, J. W. (1976). ''Preliminary evaluation of skin toxins and vocalisations in taxonomic and evolutionary studies of poison-dart frogs (Dendrobatidae).'' Bulletin of the American Museum of Natural History, 157(3), 173-262.
  • Richard Stockton College of New Jersey Biology (2002). Information on the Breeding Cycle of Poison Dart Frogs. http://www2.stockton.edu/academics/undergraduate/natural_and_math_science/labs/biology/html/poison_frogs/info_breeding.html
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • USGS (2002). ''USGS NonIndigenous Aquatic Species .'' ''http://nas.er.usgs.gov.''
  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Barrio, C. L. and Fuentes, O. (1998). ''Distribución de Dendrobates leucomelas (Anura: Dendrobatidae) en Venezuela.'' Acta Biologica Venezuelica, 18(3), 35-41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-banded poison dart frog

The yellow-banded poison dart frog (Dendrobates leucomelas), also known as yellow-headed poison dart frog or bumblebee poison frog, is a poison dart frog from the Dendrobates genus of the Dendrobatidae family.

Distribution and habitat[edit]

D. leucomelas is found in the northern part of continent of South America, most notably in Venezuela. It is also found in parts of Guyana, Brazil, and the extreme easternmost part of Colombia.[2] This amphibian is normally found in very humid conditions in tropical rain forests, close to fresh water. It is often found on flat rocks, trees, plants (notably bromeliads), and the leaf litter of the forest floor. During the dry season, specimens are known to congregate in damper places, such as under rocks or fallen tree trunks.[1]

The D. leucomelas' natural habitat is tropical, and not subject to great seasonal temperature variations. Typically, temperature variances are related to elevation and time of day, and range from the low 20s to the low 30s °C. In captivity, care must be taken not to overheat the frogs, as they can be sensitive to higher temperatures.

Although preferring high humidity levels, this species can handle lower humidity levels much better than other species in the genus. Specimens can also be found in the seasonally drier forest islands in its natural range, and at elevations ranging from sea level to 800 metres AMSL.[3]

Morphology[edit]

Adult D. leucomelas next to scale object (UK 2p) coin

D. leucomelas is one of the largest species in the genus Dendrobates, with a snout-to-vent length between 3.1 and 5 cm (1.2 and 2.0 in). Average adult size, however, rarely exceeds 4 cm (1.6 in).[2] Their average weight is reported as being around 3 g (0.11 oz). Females tend to be slightly larger than the males, but otherwise, little in their appearance can be used to determine the sex of the species.

Like most poison dart frogs, the yellow-banded poison dart frog has evolved aposematic colouration as a warning to potential predators that it will make an unpalatable or toxic meal.

Predominantly, these frogs have a bright yellow colouration with varying numbers of broad black stripes and/or spots that extend over the whole body. Some morphs are orange in colour, and variations exist within the species (naturally occurring and not morphs solely within the exotic pet community) that dictate the extent of these markings ranging from fine spots to thick, unbroken banding.[4]

They have glandular, adhesive pads on their toes (which aid in climbing and positioning) and, in common with other species in their order, they have a short, protrudable, unnotched, sticky tongue, which extends to catch prey.[5]

Behaviour[edit]

D. leucomelas frogs are diurnal by nature, and are known to be fiercely territorial. They live in small groups in the wild, and will attack neighbouring groups with surprising ferocity for creatures of their size. They will also warn off rivals by emitting loud calls; D. leucomelas is known to have one of the loudest calls among poison dart frogs; theirs can be heard from some distance and is described as an innocent-sounding, bird-like trill. D. leucomalas, as with all frogs, can also call to attract members of the opposite sex. Uniquely, it is also the only poison dart frog to estivate during dry spells.[2]

Reproduction[edit]

Yellow-banded poison dart frogs reproduce sexually. The mother lays her fertilized eggs (zygotes) in a body of water. When they hatch, they are called tadpoles.

Toxicity[edit]

Like all Dendrobatidae, D. leucomelas frogs secrete toxins from their skin, which they gain from eating certain unspecified arthropod prey. It is uncertain precisely which arthropods lend their toxicity to which genus of Dendrobatidae, but one such arthropod is thought to have been identified as a possible source of the toxin for Dendrobatidae Phyllobates terribilis (aka the golden poison frog), and it is a local variant of the Melyrid beetle.[6]

Dendrobatidae toxins vary from species to species, but some are extremely potent neurotoxins. The alkaloid toxins, secreted from the frogs' skin, interfere with nerve impulses, which can lead to heart failure or fibrillation.

Further information: Poison dart frog toxicity

Husbandry and conservation status[edit]

Three Dendrobates leucomelas frogs in a tropical rainforest vivarium

This species' relative ability to withstand broad variations in humidity and temperature, combined with its comparatively bold nature, make it a popular choice for those enthusiasts and amateur herpetologists involved in the exotic pet community. It is widely seen as being an ideal starter species for amateur hepetologists wishing to keep poison dart frogs for the first time.

The species' robustness, relatively common numbers in the wild, and widespread natural distribution has helped maintain this frog's status of "Least Concern" on the International Union for Conservation of Nature's conservation red list, despite some overharvesting of wild specimens for the exotic pet trade.[2][1] The species' ability to be easily bred in captivity has led to a fall in prices within the exotic pet trade, which is an alleviative factor to the problem of overharvesting.

Once in captivity and removed from their natural sources of food, Dendrobatidae lose much of their toxicity. Dendrobates leucomelas, however, is not one of the three main Dendrobatidae species used for poison darts by native South American tribal hunters, so toxicity levels are somewhat lower in wild-caught specimens than in the Phyllobates genus.

References[edit]

  1. ^ a b c "IUCN Red List". IUCN. 2004. Retrieved 2009-07-16. 
  2. ^ a b c d "Dendrobates leucomelas .". AmphibiaWeb. Retrieved 2009-07-16. 
  3. ^ "University of Michigan Museum of Zoology.". ADW. Retrieved 2009-07-16. 
  4. ^ "DendroBoard.". Dendrobates leucomelas. 29 December 2006. Retrieved 2009-07-16. 
  5. ^ "Yellow-banded Dart Frog.". Honolulu zoo. Retrieved 2009-07-16. 
  6. ^ "Melyrid beetles (Choresine): A putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds". PNAS. September 2004. Retrieved 2009-07-16. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!