Physical Description

Type Information

Paratype for Rhincalanus gigas Brady, 1883
Catalog Number: USNM 85599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Year Collected: 1874
Locality: between Kerguelen and Heard Islands, Indian Ocean
Vessel: Challenger R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 268 specimens in 1 taxon.
Water temperature and chemistry ranges based on 260 samples.

Environmental ranges
  Depth range (m): 0 - 2394
  Temperature range (°C): -1.862 - 2.839
  Nitrate (umol/L): 23.230 - 34.262
  Salinity (PPS): 33.643 - 34.748
  Oxygen (ml/l): 4.146 - 8.084
  Phosphate (umol/l): 1.189 - 2.347
  Silicate (umol/l): 18.849 - 98.192

Graphical representation

Depth range (m): 0 - 2394

Temperature range (°C): -1.862 - 2.839

Nitrate (umol/L): 23.230 - 34.262

Salinity (PPS): 33.643 - 34.748

Oxygen (ml/l): 4.146 - 8.084

Phosphate (umol/l): 1.189 - 2.347

Silicate (umol/l): 18.849 - 98.192
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhincalanus gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAGCTGGGGCATGATCTGGAATAGTTGGGACAGGTTTAAGTATAATTATTCGATTAGAGCTCGGCCAAGCAGGATCTTTGATCGGGGAC---GATCAAATTTACAATGTTGTAGTGACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCGATTTTAATTGGGGGCTTTGGTAATTGATTAGTTCCTCTAATATTAGGAGCAGCTGATATGGCATTCCCCCGCATAAATAATATAAGGTTTTGATTTTTAATACCTGCTCTGATTATGCTTTTAACGAGTTCTTTAGTAGAAAGAGGTGCAGGAACAGGTTGAACGGTATACCCGCCCCTCTCTAGTAACATCGCCCATGCCGGAGGATCTGTGGATTTTGCAATTTTTTCTTTGCATTTAGCCGGAGTGAGATCTATTCTTGGAGCTGTTAATTTTATTAGGACTCTGGGAAATCTTCGAGTCTTTGGGATACTTCTGGACCGGATGCCCCTTTTTGCTTGGGCTGTATTAATTACAGCAGTCCTTCTTTTACTATCTCTTCCAGTTTTAGCTGGGGCTATTACCATACTGTTAACCGACCGAAATTTAAACACTTCTTTTTATGATGTTGGTGGAGGAGGAGATCCAATTCTCTAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhincalanus gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!