Overview
Distribution
New Zealand Exclusive Economic Zone
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
Trusted
Physical Description
Type Information
Paratype for Rhincalanus gigas Brady, 1883
Catalog Number: USNM 85599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Locality: Locality Unknown
Vessel: Challenger R/V
Catalog Number: USNM 85599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Locality: Locality Unknown
Vessel: Challenger R/V
- Paratype:
Trusted
Ecology
Habitat
Depth range based on 268 specimens in 1 taxon.
Water temperature and chemistry ranges based on 260 samples.
Environmental ranges
Depth range (m): 0 - 2394
Temperature range (°C): -1.862 - 2.839
Nitrate (umol/L): 23.230 - 34.262
Salinity (PPS): 33.643 - 34.748
Oxygen (ml/l): 4.146 - 8.084
Phosphate (umol/l): 1.189 - 2.347
Silicate (umol/l): 18.849 - 98.192
Graphical representation
Depth range (m): 0 - 2394
Temperature range (°C): -1.862 - 2.839
Nitrate (umol/L): 23.230 - 34.262
Salinity (PPS): 33.643 - 34.748
Oxygen (ml/l): 4.146 - 8.084
Phosphate (umol/l): 1.189 - 2.347
Silicate (umol/l): 18.849 - 98.192
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 260 samples.
Environmental ranges
Depth range (m): 0 - 2394
Temperature range (°C): -1.862 - 2.839
Nitrate (umol/L): 23.230 - 34.262
Salinity (PPS): 33.643 - 34.748
Oxygen (ml/l): 4.146 - 8.084
Phosphate (umol/l): 1.189 - 2.347
Silicate (umol/l): 18.849 - 98.192
Graphical representation
Depth range (m): 0 - 2394
Temperature range (°C): -1.862 - 2.839
Nitrate (umol/L): 23.230 - 34.262
Salinity (PPS): 33.643 - 34.748
Oxygen (ml/l): 4.146 - 8.084
Phosphate (umol/l): 1.189 - 2.347
Silicate (umol/l): 18.849 - 98.192
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Rhincalanus gigas
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTAGCTGGGGCATGATCTGGAATAGTTGGGACAGGTTTAAGTATAATTATTCGATTAGAGCTCGGCCAAGCAGGATCTTTGATCGGGGAC---GATCAAATTTACAATGTTGTAGTGACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCGATTTTAATTGGGGGCTTTGGTAATTGATTAGTTCCTCTAATATTAGGAGCAGCTGATATGGCATTCCCCCGCATAAATAATATAAGGTTTTGATTTTTAATACCTGCTCTGATTATGCTTTTAACGAGTTCTTTAGTAGAAAGAGGTGCAGGAACAGGTTGAACGGTATACCCGCCCCTCTCTAGTAACATCGCCCATGCCGGAGGATCTGTGGATTTTGCAATTTTTTCTTTGCATTTAGCCGGAGTGAGATCTATTCTTGGAGCTGTTAATTTTATTAGGACTCTGGGAAATCTTCGAGTCTTTGGGATACTTCTGGACCGGATGCCCCTTTTTGCTTGGGCTGTATTAATTACAGCAGTCCTTCTTTTACTATCTCTTCCAGTTTTAGCTGGGGCTATTACCATACTGTTAACCGACCGAAATTTAAACACTTCTTTTTATGATGTTGGTGGAGGAGGAGATCCAATTCTCTAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Rhincalanus gigas
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
