Overview

Comprehensive Description

Morphologie : Adulte, le pagure de Prideaux ou gonfaron fait environ 5 cm avec les pattes étendues. Les couleurs dominantes de la partie visible de l’animal sont le rose et le marron clair avec des nuances mauves sur les pattes. Les quatre grandes pattes visibles (locomotrices) sont bordées de blanc sur leurs parties terminales et les yeux, assez gros, sont de couleur foncée. Les pinces sont fortement poilues et la pince droite est plus développée que la pince gauche. Ce crustacé dispose d’une paire d’antennes courtes terminées en peigne et d’une paire d’antennes longues de la même couleur que le corps de l’animal (les antennes ne sont pas striées contrairement à d’autres espèces de pagures). Le pagure de Prideaux vit en association avec l’anémone manteau Adamsia palliata qui recouvre parfois entièrement la coquille qui abrite l’abdomen du pagure. La couleur et la forme de l’anémone manteau est caractéristique et représente une clé d’identification qui permet de ne pas confondre le gonfaron avec un autre pagure. L’anémone manteau est blanche à blanc rosé et est ponctuée de gros pois mauves de forme ovale. La couronne de tentacules est petite et blanche, elle est orientée vers le bas sur un côté du pagure. Comme chez tous les bernard l’ermite, l’abdomen est mou et n’est pas protégé par une cuticule épaisse. Quatre petites pattes non visibles (les dernières) lui servent à se maintenir dans une coquille ou dans le replis du manteau de son anémone symbiotique.

Biologie : La particularité biologique de cette espèce relève de son association systématique avec l’anémone de mer Adamsia palliata. Celle-ci constitue une protection pour le crustacé en émettant des filaments urticants – les aconties – dès que le pagure est inquiété. Le gonfaron et l’anémone manteau se développent ensemble et lorsque la coquille initialement choisie par le pagure devient trop petite, le pied de l’anémone manteau se replie pour constituer l’abri de l’abdomen du crustacé. En fait l’association entre ces deux partenaires est telle que la coquille peut même aller jusqu’à disparaître, dissoute par l’anémone qui assure alors en totalité la protection de l’abdomen du crustacé. Ce pagure est détritivore et son anémone associée profite des reliefs de ses repas.

Ecologie : Le pagure de Prideaux affectionne les fonds meubles près des zones rocheuses. Il se rencontre à des profondeurs très variables : depuis quelques mètres à plus de 200 mètres. Il est plutôt actif la nuit et reste caché dans des anfractuosités rocheuses pendant la période diurne.

Distribution : Le pagure de Prideaux se rencontre dans les mers froides et tempérées d’Europe, de la Méditerranée jusque dans les fjords de Norvège.

Interaction avec les activités humaines : Elles sont très réduites. L’espèce n’est pas commercialisée, même si elle a été mentionnée dans des guides sur l’aquariophilie marine. Ce pagure est discret, mais il se rencontre parfois en plongée. Si il est manipulé, il peut avoir tendance à abandonner son anémone manteau (ou sa coquille) et se retrouve très vulnérable.

Références : THEDY Hervé, BERNIER Emmanuel, NOËL Pierre, PÉAN Michel, in : DORIS, 28/01/2012 : Pagurus prideaux Leach, 1815
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Similar to Pagurus bernhardus but smaller with a carapace length up to 14 mm long and muddy red in colour with paler spots. Adults often live in association with the cloak anemone, Adamsia carciniopados.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 220 specimens in 1 taxon.
Water temperature and chemistry ranges based on 85 samples.

Environmental ranges
  Depth range (m): 0 - 450
  Temperature range (°C): 6.506 - 17.974
  Nitrate (umol/L): 1.402 - 12.427
  Salinity (PPS): 34.402 - 37.452
  Oxygen (ml/l): 5.415 - 6.439
  Phosphate (umol/l): 0.148 - 0.838
  Silicate (umol/l): 0.987 - 5.635

Graphical representation

Depth range (m): 0 - 450

Temperature range (°C): 6.506 - 17.974

Nitrate (umol/L): 1.402 - 12.427

Salinity (PPS): 34.402 - 37.452

Oxygen (ml/l): 5.415 - 6.439

Phosphate (umol/l): 0.148 - 0.838

Silicate (umol/l): 0.987 - 5.635
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found on sand, mud or gravel, lower shore and shallow sublittoral.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
Athelges prideauxi ectoparasitises abdomen surface of Pagurus prideaux

Animal / parasite / endoparasite
adult of Peltogaster curvatus endoparasitises body of Pagurus prideaux

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pagurus prideaux

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pagurus prideauxi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATATTTTATTTTTGGAGCTTGGGCTGGAATAGTAGGAACTTCTCTTAGGTTAATTATTCGAGCTGAACTAGGTCAACCAGGAAGTTTAATTGGAGATGATCAAATTTATAACGTAGTTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATGTTAGGAGCTCCTGATATGGCATTTCCACGTATAAACAACATAAGATTTTGATTACTACCTCCCTCATTAACTCTACTTCTCACTAGAGGTATAGTAGAAAGGGGAGTGGGAACTGGATGAACAGTTTATCCACCTTTATCAGCTGCAATTGCTCACGCGGGTGCATCTGTTGATTTGGGTATTTTCTCTCTTCATTTAGCTGGTGTTTCTTCAATTTTAGGAGCAGTAAACTTTATAACAACAGTTATTAATATACGTCCCCAAGGTATGACAATAGACCGAATACCATTATTTGTATGGGCAGTTTTTATTACAGCCATCTTATTATTACTATCTCTTCCTGTATTAGCGGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATCCAGCTGGGGGTGGAGATCCTGTTTTATACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pagurus prideauxi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pagurus prideaux

Pagurus prideaux is a species of hermit crab in the family Paguridae. It is found in shallow waters off the northwest coast of Europe and usually lives symbiotically with the sea anemone Adamsia palliata.[2][1]

Contents

Description

Like other hermit crabs, P. prideaux has an asymmetric, unarmoured abdomen and protects this by concealing it within the empty shell of a gastropod of appropriate size and shape, and carrying it around by clasping onto an internal part of the columella of the sea snail shell. The carapace of the crab is brownish-red with paler patches and rather wider than it is long. It has several tufts of short bristles and can reach a length of 14 mm (0.6 in). The right cheliped can block the entrance to the shell. It is armed with a pincer and is larger than the left one.[3]

Distribution and habitat

P. prideaux is found on sand, gravel and mud between the tide marks and in the shallow sublittoral. It particularly favours muddy areas with shell fragments and gravel.[2] It occurs in the Mediterranean Sea, the North Sea and the northeast Atlantic Ocean from Cape Verde north to Norway.[1]

Ecology

P. prideaux is nearly always found in association with the sea anemone, Adamsia palliata (the "cloak anemone").[2] The anemone grows on the underside of the shell inhabited by the hermit crab. Its base enlarges and two flaps wrap around the shell until eventually they meet at the top. Its base secretes a chitinous membrane that extends the gastropod shell, enlarging its capacity, and allowing the hermit crab to occupy it for a longer period. The relationship between the two is symbiotic. The crab is less likely to be attacked by predators because of the anemone's nematocysts and the anemone in turn benefits from the food fragments thrown up by the crab's activities.[2]

Another animal with which P. prideaux has a symbiotic relationship is the polychaete worm Iphitime paguri. Adult worms and the larval stages are frequently found in the apex of the gastropod shell. Intermediate sized worms are found in the gill chambers and in a groove under the carapace.[4]

References

  1. ^ a b c d Michael Türkay (2011). "Pagurus prideaux Leach, 1815". In Patsy McLaughlin. World Paguroidea database. World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=107239. Retrieved September 8, 2011.
  2. ^ a b c d Philip Henry Gosse (1860). "The Cloak Anemone Adamsia palliata". Actinologia Britannica: A history of the British sea-anemones and corals. London: Van Voorst. pp. 125–133. http://www.archive.org/details/actinologiabrita00gossuoft.
  3. ^ "Hermit crab – Pagurus prideaux". Marine Life Information Network. Marine Biological Association of the United Kingdom. http://www.marlin.ac.uk/speciesinformation.php?speciesID=4015. Retrieved September 8, 2011.
  4. ^ Tore Høisæter & Tor J. Samuelsen (2006). "Taxonomic and biological notes on a species of Iphitime (Polychaeta, Eunicida) associated with Pagurus prideaux from western Norway". Marine Biology Research 2 (5): 333–354. doi:10.1080/17451000600867277.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!