Overview
Distribution
Azores Exclusive Economic Zone, East Atlantic, East Mediterranean, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, Greek Exclusive Economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Mediterranean Sea, South Africa (country)
-
L. B. Holthuis & E. Gottlies(1958) An annotated list of Decapod Crustacea of the Mediterranean Coast of Israel, with an appendix listing the Decapoda of the Eastern Mediterranean. Bulletin of the Research Council of Israel. Haifa, Israel. 1-126pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42367
-
Charles H.J.M. Fransen
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42308
-
Emmerson W.D. A comparison between decapod Species common to both Mediterranean and Southern African Waters.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42379
-
Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284-292
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1392
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Galil, B.; Goren, M.; Mienis, H. (2011). Checklist of marine species in Israel. Compiled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149096
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Depth range based on 1 specimen in 1 taxon.
Environmental ranges
Depth range (m): 0.5 - 0.5
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 0.5 - 0.5
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Acanthonyx lunulatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGAGCTTGAGCGGGAATGGTTGGAACATCCTTAAGATTAATTATTCGAGCTGAGCTTGGACAACCAGGCACTCTCATTGGTAATGATCAAATTTATAATGTCGCCGTAACAGCCCATGCTTTCGTCATGATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAACATAAGATTTTGACTACTCCCACCATCTTTAACCCTTTTATTAATAAGAGGTATAGTTGAAAGAGGGGTTGGAACAGGTTGAACTGTTTACCCTCCCCTTGCCGGGGCTATTGCTCATGCCGGTGCTTCTGTTGATATGGGTATTTTTTCTTTACACTTGGCAGGAGTTTCTTCCATCCTTGGAGCCGTAAATTTTATAACTACAGTAATTAACATACGATCTTTTGGAATAACAATAGACCAAATACCTCTATTTGTCTGAGCTGTCTTTATTACCGCAATCTTATTGCTTTTGTCTCTTCCGGTACTTGCTGGGGCTATTACAATGCTTCTTACTGATCGAAACTTAAATACTTCATTTTTTGATCCTAGGGGAGGTGGAGACCCCATTCTTTACCAACACTTGTTCT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Acanthonyx lunulatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
