Overview

Brief Summary

Squilla empusa, common name mantis shrimp, is a marine crustacean and a member of the order Stomatopoda. These organisms come in a variety of colors and are some of the most important predators in many shallow tropical marine habitats. They spend most of their lives tucked away in burrows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Unlike most Stomatopods, which live in tropical or subtropical waters, S. empusa live at the muddy bottoms of the lower inter-tidal zone of the Chesapeake Bay, living as deep as 500 feet (Heitler, Fraser, Ferrero 2000; Meinkoth 1981). They are very resistant to high and medium salinity waters and can be found anywhere between Cape Cod to the Gulf of Mexico (CIMS 2000). They are also found along the coast of Brazil and in the Mediterranean Sea (Bauer 1999).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Virginian, southside of Cape Cod to Cape Hatteras
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As their common name suggests, the mantis shrimp looks like a cross between a preying mantis and a shrimp. Adult S. empusa can grow to a length of 8-10 inches or 30 cm. long (CIMS 2000; Meinkoth 1981). Their long flattened bodies are segmented and tend to be translucent to light (Smith, Weldon 1958; DBW 1998). Their body is divided into 2 main parts, a cephalothorax (head fused with the thorax), and an abdomen that ends with a telson (Smith and Weldon 1958). The abdomen is broad and fully developed, fanning out towards the end. It is divided into 5 clear segments that are outlined by a dark greenish bluish color or sometimes yellow (Hickman 1973). Attached to the abdomen's middle line are several pairs of pleopods or swimmerets used for swimming, which also have special filaments and gills for respiration (Hickman 1973; San Juan 1998). The last pair of appendages are the uropods found at the sides of the tail or telson. Their telson is covered by 6 sharp spikes and is highly flexible (Meinkoth 1981). It is normally used to fend of enemies and other mantis shrimp (Heitler et al. 2000).

A small shield-like carapace protects the cephalothorax (CIMS 2000; Smith and Weldon 1958). There are 8 pairs of appendages or maxillepeds attached to this section (Hickman 1973). The first pair of maxillepeds is found near the mouth and they are slender, hairy, and used for cleaning, whereas the second pair are huge lethal claws in the shape of jackknives (Hickman 1973, DBW 1998, CIMS 2000). They use these as spears to capture other animals. The third, fourth and fifth set of maxillepeds are small legs that end in a flat oval shape called chelone. The chelone is used to bring food into the mouth. The last three pairs long and slender and are used as walking legs (Hickman 1973).

Two pairs of flagellated antennae that look like wings adorn their head (Hickman 1973). They also have a pair of enamel colored eyes mounted on short mobile stalks (Cronin et al. 1994). Their mouths have mandibles to chew on their food. Their most distinctive characteristics and studied are their highly evolved eyes and claws.

Claws:

Stomatopods have powerful claws that serve as lethal weapons and according to the shape of these claws they are divided into 2 main groups, smashers and spearers (DBW 1998, San Juan 1998). Smashers have heavy calcified claw used to club prey and crack open hard surface like the shells of mollusks and crabs (San Juan 1998). S. empusa is a spearer, using their claws to spear or slice through fish in a quick slashing motion. The sharp claw is assisted by 6 spines found at the last joint (Hickman 1973). Their strike is one of the fastest movements known in the animal kingdom, reaching a velocity of 10 meters per second (CIMS 2000). It takes them less then 8 milliseconds to strike, which is about 50 times faster than the blink of an eye (Squatriglia 2001; San Juan 1998, DBW 1998). These claws are strong enough to dig through sand, rocks and even lacerate a hand, which is why they are also known as "thumb splitters", "finger poppers", "killer shrimp" and "thumb busters" (San Juan 1998, DBW 1998, CIMS 2000).

Eyes:

Another of S.empusa 's unique features are their compound eyes. They are different from those of most stomatopods, which have one of the most evolved forms of vision in the animal kingdom (Cronin et al. 1994). Stomatopods can see polarized light and even parts of the UV spectrum. They have 16 different types of photoreceptors, 12 of which are devoted to color (the human eye has 3) and 4 for UV light, allowing them to perceive a total of 100,000 different colors (Cronin et al. 1994; Squiriglia 2001; San Juan 1998). Like all stomatopods, S.empusa has a trinocular vision (3 overlapping fields of vision) which gives them the accuracy needed to catch their prey with such speed (Cronin et al. 1994).

However, S.empusa does not have color vision and can only see polarized light. Compared to most Stomatopods, their eyes are more "primitive" because they lack most of the modifications and receptors that make Stomatopod vision so unique. For example, gonadactyl and lysiosquilloid mantis shrimp have 6 parallel rows of ommatidia found at the midband region of the eyes, while S. empusa has only 2 parallel rows. Also, gonadactyl and lysiosquilloid mantis shrimp have various color filters inside the photosensitive region of the photoreceptor cell which refine the spectral quality of the light and accentuate it, thus creating even more colors S.empusa lacks all these filters and photoreceptors because it does not have a color vision. They only have one type of rhodopsin or color pigment, while other stomatopods have 10 (humans have 4). Their rhodopsin only absorbs light from the deep ultraviolet spectrum, a large spectrum that compensates for the lack of color (Cronin et al. 1994).

The loss of color vision is an adaptation to the environment in which they live (Cronin et al. 1994). Most stomatopods live in tropical or subtropical shallow waters, where light can easily penetrate the crystaline waters. The S.empusa lives at the bottom of murky waters where comparatively less light hits the bottom. Therefore, they have no complex light filtering systems like other stomatopods in order to allow the maximum amount of light reach their photoreceptors (Cronin et al. 1994). Instead, they have anatomical features that suggest their ability to sense polarized light (Cronin et al. 1994). Their vision is also assisted by the scanning motion of their mounted eyes. The movement of their eyes are unrelated, therefore while one eye is up the other could be down and moving at a different speed, giving it an alien-like appearance (Cronin et al. 1994; San Juan 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

They form their burrows in the inter-tidal zones, favoring deep muddy soil (CIMS 2000). Their burrows have many openings which are usually between 2 and 3 feet apart (San Juan 1998).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 718 specimens in 1 taxon.
Water temperature and chemistry ranges based on 199 samples.

Environmental ranges
  Depth range (m): 0 - 247
  Temperature range (°C): 11.435 - 27.026
  Nitrate (umol/L): 0.202 - 12.069
  Salinity (PPS): 34.083 - 36.529
  Oxygen (ml/l): 3.257 - 5.374
  Phosphate (umol/l): 0.019 - 0.898
  Silicate (umol/l): 0.756 - 7.040

Graphical representation

Depth range (m): 0 - 247

Temperature range (°C): 11.435 - 27.026

Nitrate (umol/L): 0.202 - 12.069

Salinity (PPS): 34.083 - 36.529

Oxygen (ml/l): 3.257 - 5.374

Phosphate (umol/l): 0.019 - 0.898

Silicate (umol/l): 0.756 - 7.040
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The S.empusa is a nocturnal carnivore that feeds mainly on soft bodied animals like fish, shrimps, krill, marine worms, snails and other mantis shrimp (CIMS 2000). Sometimes they'll eat crabs and hermits (Squatriglia 2001). Their special adaptation to catch food are their claws, which they use to spear through their prey in a swift slicing movement (CIMS 2000, San Juan 1998). After immobilizing their prey they drag them into their burrows to eat (DBW 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Very little is known about their reproductive cycle because they are nocturnal and anti-social animals (CIMS 200). They have separate sexes and reproduce through sexual insemination. In males, the testes form a pair of delicate tubules that attach to sperm ducts that open at the penis, which is a modified long, slender, structure found at the base of the last pair of legs (Hickman 1973). The female ovaries form a broad mid band in the animals thoracic/abdomen region and the oviducts open at the middle of the 6th maximelleped (Hickman 1973). The eggs are developed and carried by the anterior legs, making it look as if the mother was eating her babies (Hickman 1973).

The larvae differ from the parents and they must go through several stages of metamorphosis before reaching an adult state (Smith, Weldon 1958). However, the metamorphic stages are not well known because they are hard to identify, "they seem to mature by developing their thoracic limbs, degenerating them, and then reforming them again" (Smith, Weldon 1958).

The mating behavior of these creatures is unknown. Research into this area is was resently made by graduate student Jennifer Wortham from the University of Lafayette, because Stomatopod mating behavior varies considerably with each species, ranging from monogamous relationships to "promiscuous systems" (Bauer 1999; San Juan 1998). Wortham's research deals mainly with mating strategies of successful males and the importance of their burrows as sexual resource (Bauer 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squilla empusa

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCM0380-06|DQ191684|Squilla empusa| CGACGATGATTATTTTCTACAAATCATAAAGATATTGGAACTCTATATTTCATTCTAGGGGCTTGATCAGGAATGGTAGGAACGGCCCTT---AGTTTGATTATTCGGGCTGAACTAGGACAACCAGGTAGATTAATTGGAGAT---GACCAAATCTATAATGTTATTGTTACAGCACACGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGAAACTGATTAGTTCCTTTAATA---CTAGGGGCCCCAGATATAGCATTCCCACGTATAAACAACATAAGATTTTGATTACTACCACCAGCGCTTACATTACTATTATCTAGGGGGTTAGTAGAAAGAGGAGTTGGCACAGGATGAACAGTCTACCCTCCTTTATCAGCAGGTATCGCTCATGCCGGGGCTTCAGTAGATATGGGT---ATTTTCTCACTACATTTAGCCGGGGCTTCTTCAATTCTAGGAGCAGTAAATTTTATTACTACTGTTATTAATATACGATCAAACGGAATAACTATAGACCGTATACCACTATTTGTCTGAGCTGTCTTCATTACAGCAATTTTATTATTGTTGTCCCTACCTGTTTTAGCAGGA---GCTATTACAATATTGTTAACAGATCGTAATTTAAACACCTCTTTCTTTGACCCAGCAGGAGGAGGAGACCCTGTTTTATATCAACATTTATTCTGATTCTTCGGGCACCCCGAAGTTTACATTTTAATTTTACCTGCTTTTGGGTTAATCTCTCACATTGTTAGACAAGAGTCAGGGAAAAAA---GAAACTTTCGGAACATTAGGAATAATCTATGCTATATTAGCAATTGGGGTATTAGGCTTTGTGGTATGGGCCCACCATATGTTCACAGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squilla empusa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 8
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Mantis shrimp are very common

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Aquariums, consider all Stomatopods, including S.empusa as pests. Their "huge hunger and lousy disposition" make them a threat to the aquatic display for they will eat costly fish and snails. A recent case of this frustrating problem was reported by the Monterey Bay Aquarium where two S.empusa where brought in with a load of coral from Florida. These hardy animals are sometimes brought inside rocks and corals and are extremely hard to catch. As Squatriglia (2001) reports, aquarists have spent, "the better part of the year playing hide-and-seek with these two mantis shrimp." (Squatriglia 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

S. empusa has some importance for the fishing industry because it is edible and said to be very tasty, especially in the Mediterranean area where it is used for food (Bauer 1999).

They also serve as a pollution indicator. Their population changes in relation to changes in sediment concentrations of heavy metals and petroleum (DBW 1998). They are also susceptible to agrochemical runoff contamination (Heitler et al. 2000). They are studied by researchers interested in understanding the visual system (Cronin et al. 19

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!