Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Andrena rugosa in Illinois

Andrena rugosa Robertson: Andrenidae (Andreninae), Hymenoptera
(observations are from Robertson, Krombein et al., Schemske et al., and Graenicher)

Aceraceae: Acer saccharum [oozing sap] (Rb); Anacardiaceae: Rhus aromatica [pist sn fq] (Rb); Apiaceae: Erigenia bulbosa sn fq icp (Rb), Heracleum maximum (Rb), Pastinaca sativa (Kr), Sanicula marilandica sn cp (Rb), Zizia aurea (Kr); Asteraceae: Taraxacum officinale (Kr); Brassicaceae: Barbarea vulgaris (Kr), Dentaria laciniata sn (Rb, Shm); Caprifoliaceae: Symphoricarpos occidentalis sn (Gr), Viburnum dentatum sn cp fq (Rb), Viburnum prunifolium sn (Rb); Cornaceae: Cornus florida sn (Rb), Cornus racemosa sn cp (Rb); Fabaceae: Melilotus officinalis (Kr); Grossulariaceae: Ribes missouriense sn (Rb); Hydrophyllaceae: Ellisia nyctelea (Kr); Portulacaceae: Claytonia virginica sn (Rb, Shm); Ranunculaceae: Enemion biternatum cp/exp fq (Rb, Shm), Hepatica acutiloba cp/exp fq (Rb); Rosaceae: Amelanchier arborea sn (Rb), Amelanchier laevis (Kr), Crataegus mollis sn fq (Rb), Malus pumila (Kr), Physocarpus opulifolius (Kr), Prunus americana (Kr), Prunus serotina sn (Rb), Prunus virginiana (Kr), Rubus occidentalis (Kr); Rutaceae: Ptelea trifoliata sn (Rb), Zanthoxylum americanum [stam sn fq] [pist sn fq] (Rb); Salicaceae: Salix amygdaloides [pist sn] (Rb), Salix discolor [unsp sn] (Gr), Salix nigra [stam sn cp] (Rb), Salix rigida [stam sn fq] [pist sn fq] (Rb); Smilacaceae: Smilax herbacea sn cp (Gr), Smilax tamnoides hispida sn (Gr); Thymelaeaceae: Dirca palustris sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena rugosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGGAATAATAGGAGCCTCATTAAGATTCATTATCCGAATAGAATTAAGAAATCCAGGTAGATGAATCAATAATGATCAAATTTATAATTCAATCGTAACCTCTCACGCTTTCATTATAATTTTTTTCATAGTAATACCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATGGCTTTCCCGCGAATAAACAATATAAGTTTCTGGCTACTCCCCCCATCAATTTTAATTATTTTATTTAGAATAATTTTAAATTCAGGGTCAGGTACAGGATGAACAGTATACCCCCCTTTATCGTCATACACCTACCATCCATCCTCATCAGTCGATTTAACAATTTTTTCATTACATATTGCAGGAGTGTCCTCAATTATAGGAGCAATTAATTTTATTGTAACAATCCTTAGTATAAAAAATATTTCATTAAACTATGATCAACTCCCACTATTCCCATGATCAGTATTTATTACCACAATTCTATTATTAATTTCTCTACCAGTTTTAGCTGGAGCCATCACAATATTACTATCAGACCGTAATTTAAACTCATCATTCTTCGACCCAATAGGAGGAGGGGACCCAATTTTATACCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrena rugosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!