Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Sacculina carcini is a parasite related to goose barnacles and common barnacles. The animal looks like an irregularly shaped knob under the shield covering a crab's belly. In the Netherlands, Sacculina carcini is mostly found in shore crabs and flying crabs. With its diffuse branching structure, the parasite spreads through the body of the crab. Infected crabs do not die but can no longer reproduce of shed their shell. The crab eventually weakens and dies, as Sacculina carcini sucks up all the food from the host's vascular structure.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Sacculina carcini is a parasitic species, so its geographic range follows its host. Carcinus maenas, the green crab, is a major host. The green crab is considered a highly invasive species, so it is not clear where S. carcini's actual range is. Carcinus maenas has a native range of the upper European/North African coast, though it has since spread to most of the major coasts, including the United States' New England coast area, the western U.S. coast, some areas at the southern coast of South America, the southern coast of Africa, and the southeast coast of Australia. In addition, S. carcini is being introduced in areas to control C. maenas, so it is possible that the parasite extends to some of the crab's invasive range.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Introduced ); australian (Introduced ); atlantic ocean (Native ); pacific ocean (Introduced )

  • Høeg, J., N. Murphy, C. Wittwer. 2000. Developing the options for managing marine pests: specificity trials on the parasitic castrator, Sacculina carcini, against the European crab, Carcinus maenas, and related species. Journal of Experimental Marine Biology and Ecology, 254 (1): 37-51.
  • Jones, T. 2007. "Carcinus maenas" (On-line). Accessed March 16, 2010 at http://www.marine.csiro.au/crimp/nimpis/spSummary.asp?txa=6275.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sacculina carcini differs greatly from other barnacles. While the larval form is typical of the barnacle cypris larvae, the adult form is extremely reduced. At first, the female adult form resembles a microscopic slug, but as it parasitizes the crab, it grows tendrils that allow S. carcini to obtain nutrients from the crab's tissues. As it develops, it becomes more of an ovoid sack hanging off the parasitized crab, essentially nothing but a mass of reproductive tissue enclosed in chitinous armor. The male S. carcini is extremely small and serves only to fertilize the female's eggs.

Range mass: <1 (low) g.

Other Physical Features: ectothermic ; heterothermic ; radial symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Takahashi, T., J. Lutzen. 1998. Asexual reproduction as part of the life cycle in Sacculina polygenea (Cirripedia: Rhizocephala: Sacculinidae). Journal of Crustacean Biology, 18 (2): 321-331.
  • Zimmer, C. 2001. "Animal Parasites" (On-line). Science World. Accessed April 23, 2011 at http://findarticles.com/p/articles/mi_m1590/is_9_57/ai_70872766/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Sacculina carcini lives in a marine environment. During the brief larval period, S. carcini is pelagic, but as an adult, it lives as a parasite within a crab. The crabs that S. carcini prefers to parasitize live in coastal waters with mud, rock, or sand substrates.

Range depth: 200 to 0 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic ; benthic ; coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 13 - 13
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sacculina carcini is entirely parasitic, relying on its host for nutrition. Its host secretes nutrients, which it absorbs.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
adult of Sacculina carcini endoparasitises body of Carcinus maenas

Animal / parasite / endoparasite
adult of Sacculina carcini endoparasitises body of Macropodia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Sacculina carcini is a parasite on a wide variety of crab species, and causes decreased fertility in infected crabs. Since Carcinus maenas is a primary host, S. carcini works to somewhat control the green crab population. Currently S. carcini is being considered whether it is an effective invasive species regulatory control. In some populations, S. carcini can render up 50% of the crab population infertile, so in theory, S. carcini can have an important effect on the ecosystem balance.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Because S. carcini is an internal crab parasite, its only predators are animals that predate on crabs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The adult S. carcini is extremely reduced. Because the female consists, literally, of only its root-system of tendrils which allow it to draw nutrients and influence its host and the external reproductive sac, S. carcini lacks any real sensory perception. However, they aer able to locate a host through chemical perception. Adult males have enough sensory perception to presumably allow it to find a female.

Communication Channels: tactile ; chemical

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The life cycle of S. carcini begins with a nauplius larvae being emitted from the mantle cavity of the host. The free-living nauplius larvae molts several times over five or six days, and then enters the cypris stage. Three days into the cypris stage, S. carcini attaches to its host's antenna. From there, it sheds its abdomen and thorax, and enters the crab as a mass of embryonic cells through its antennae. At this point, the mass of cells migrates to the mid-gut of the crab just below the heart and extends tendrils to secure itself and obtain nutrition.

Several weeks after it enters its host, Sacculina carcini extends a small knob through the abdomen of its host called an externa. This knob is where the male S. carcini enters the female.

Development - Life Cycle: neotenic/paedomorphic; metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of S. carcini is host-dependent, as its life-span matches that of the host. In many crabs this is 1-2 years.

  • Zimmer, C. 2000. Parasite Rex: Inside the Bizarre World of Nature's Most Dangerous Creature. New York, New York: Touchstone.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The female S. carcini extends a small knob to the outside of a crab, through which a microscopic male larvae enters. Typically, a female S. carcini has two males which live off of it and constantly fertilizes it. The female then produces hundreds of eggs a day, which incubate in the abdomen of the host.

Mating System: polyandrous

A Sacculina carcini female is fertilized by microscopic males which live within it. The female releases fertilized eggs into the abdominal cavity of the host, where the eggs are incubated and develop into free-living larvae. About 6 weeks after finding a host, the young are capable of reproducing.

Breeding season: On Carcinus maenas June or July to September, on Portunus holsatus the breeding season is short and in the early spring

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (Internal ); oviparous

While a female S. carcini provides no parental care, the hosts provide an efficient means of distribution for larvae. The behavior of both male and female infected crabs is modified so that they treat the externa from S. carcini like their own eggs. Infected crabs climb to high places with fast currents and disperse larval parasites like they would their own eggs, thus continuing the cycle of infection. At this point, the free-swimming S. carcini larvae are entirely independent.

Parental Investment: pre-hatching/birth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sacculina carcini

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATATATTTAATTTTTTCTATATGATCTGGTTTAGTGGGAGGCGTTTTAAGATTCATTATTCGTTTAGAACTTACTCGTCCAGGATCTTTACTAGAAAAT---GGACAATTATACAATGTTATTGTAACTTCTCATGCTTTTATCATAATTTTCTTTATAGTGATACCTGCTTTAATTGGAGGGTTTGGTAATTGGATTCTTCCTTTAACTTTAGGAACAGTGGATATAGCTTTCCCTCGTTTAAATAATTTAAGGTTTTTATTATTAATTCCTTCTATAGTGTTATTAATTTTAAGATCCTTTTCTAATTCAGGAGTAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTAATAATCTTTCACATAGAGGATTTTCTGTGGATATGGCTATTTTTTCTTTGCATATTGCAGGTATCTCTTCTATTTTAGGGGCTATAAATTTTTTAGTAACTTTTCTATGTATAACTAATCAAAGA------TTGATGAAATTAAGTCTGTTTTCTTGAAGAGTCTTTATTACAGCTGTACTATTATTATTATCTTTACCAGTACTAGCTGGTGCAATTACTATATTGTTAAGAGATCGAAATTTTAATACTTCTTTTTTTGATCCTAGAGGAGGAGGGGATCCTGTTCTATTTCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sacculina carcini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Sacculina carcini does not have any conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sacculina carcini causes economic damage to humans by decreasing the viability of crabs harvested for human consumption. Crabs infected with S. carcini cease molting, and so do not grow to a suitable size for eating. Carcinus maenas in particular is considered to be of gastronomic importance, and is frequently eaten in many European countries.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sacculina carcini has been considered as a means of controlling invasive crab species, but due to low host specificity it also seems to damage non-invasive crab populations. As such, it is not yet known whether or not S. carcini will be an appropriate invasive species control.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!