Overview

Comprehensive Description

Description

M 30-40 mm, F 32-41 mm. Tibiotarsal articulation reaches beyond snout tip. Fifth toe longer than third toe. Femoral glands in males small and indistinct. Frenal stripe very distinct and reaching the nostril. Ventrally often with a dark throat with a thin light median line. Dorsally often with a diamond-shaped marking (Glaw and Vences 2007).

Taken with permission from Glaw and Vences (2007) and Vences and Glaw (2008).

  • Vences, M. and Glaw, F. (2008). Mantidactylus melanopleura. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 07 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species ranges widely in eastern Madagascar from Marojejy south to Andohehela, at 200-900m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Widely distributed in eastern Madagascar (Vences and Glaw 2008). Ambatovaky, An’Ala, Andasibe, Andohahela, Andranomena, Anjozorobe, Bekazaha, Chaines Anosyennes, Ifanadiana, Ilampy, Isaka-Ivondro, Manantantely, Mantadia, Marojejy, Marovitsika, Midongy, Moramanga, Nahampoana, Ranomafana (Imaloka, Maharira forest, Ranomena, Vohiparara), near Ifanadiana, Sahembendrana, Tsararano, Vohidrazana, Zahamena (Glaw and Vences 2007). Found in rainforest and at forest edges at 200-900 m asl (Vences and Glaw 2008).

  • Vences, M. and Glaw, F. (2008). Mantidactylus melanopleura. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 07 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a species of rainforest and forest edge, not surviving in heavily degraded areas. It lives along, and breeds in, brooks.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantidactylus melanopleura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCGCCCTAAGCCTCCTCATCCGAGCTGAGCTGGGACAACCCGGGACCCTTCTTGGCGAT---GACCAAATCTACAATGTAATTGTTACCGCTCATGCGTTCGTAATGATCTTTTTTATGGTAATACCTGTCTTAATCGGGGGGTTCGGAAATTGACTTGTGCCCCTAATAATTGGAGCCCCCGACATAGCCTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTCCCCCCATCATTTTTTCTTCTTCTTGCCTCCTCCATAGTAGAGGTTGGGGCTGGGACTGGTTGAACAGTGTACCCACCACTGGCTAGCAACCTAGCCCACGCAGGCCCGTCAGTAGACCTCACCATTTTTTCCTTACACCTCGCTGGTGTATCCTCAATTCTTGGGGCAATCAACTTTATTACGACCATCTTAAATATAAAGCCCCCATCAATAATTCAATACCAAACTCCACTATTTGTCTGATCCGTCCTAATTACAGCTGTACTGCTCCTCCTCTCCCTACCTGTCTTAGCTGCGGGCATCACAATACTCCTCACAGACCGGAACCTTAACACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mantidactylus melanopleura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Miguel Vences, Frank Glaw

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is an abundant species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: Juvenile and adult specimens are commonly encountered on the forest floor near streams. Males call during the day from the ground or from elevated positions up to 50 cm above the ground, such as tree holes (Glaw and Vences 2007). Breeds in brooks (Vences and Glaw 2008).

Calls: Rapid series of 12-48 short pulsed notes. Notes are shorter and call series faster than in M. opiparis (Glaw and Vences 2007).

  • Vences, M. and Glaw, F. (2008). Mantidactylus melanopleura. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 07 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Its forest habitat is receding due to subsistence agriculture, timber extraction, charcoal manufacture, and invasive spread of eucalyptus, livestock grazing and expanding human settlements.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Abundant but decreasing. The main threat is habitat loss due to subsistence agriculture, logging, charcoal manufacture, invasion and spread of eucalyptus, grazing, and expanding human settlement. It does not tolerate heavy forest degradation. However, this species occurs within many protected areas (Vences and Glaw 2008).

  • Vences, M. and Glaw, F. (2008). Mantidactylus melanopleura. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 07 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mantidactylus melanopleura

Mantidactylus melanopleura is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests and rivers. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!