Overview

Distribution

Range Description

This species is distributed in eastern and central Brazil, Bolivia, Paraguay, and north Argentina (Gardner 2007). In Paraguay is extremely abundant in the Chaco region in western Paraguay, but the records from Argentina are scarce.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Monodelphis domestica is found throughout the forests of Brazil, Bolivia, Argentina, and Paraguay.

Biogeographic Regions: neotropical (Native )

  • Andromeda Oxford Ltd. 1984. American Opossums. Pp. 830-837 in D Macdonald, ed. The Encyclopedia of Mammals, Vol. 1/1, 1 Edition. New York, NY: Facts On File, Inc..
  • Andromeda Oxford Ltd. 2001. American Opossums. Pp. 808-814 in D Macdonald, S Norris, eds. The New Encyclopedia of Mammals, Vol. 1/1, 1 Edition. Oxford, UK: Oxford University Press.
  • Kalafut, M. 2005. "Know Your STO" (On-line). Short-Tailed Opossums, Keeping and Caring for These Pets. Accessed February 15, 2006 at http://www.knowyoursto.com/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Monodelphis domestica is a member of the group of short-tailed opossums, Monodelphis, which are some of the smallest didelphids. Body length of adults ranges from 10 to 15 cm. Adult males weigh between 90 and 155 g, females are between 80 and 100 g. Most individuals have light grey fur, but fur color does vary, with some popluations having more reddish or whitish fur. Their tails are naked, rat-like, and semi-prehensile. Tail length varies but is usually about half the length of the of body.

Range mass: 90 to 155 g.

Range length: 10 to 15 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.335 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Primarily found in xeric situations, this species has been trapped in grassy areas, brush piles, and among jumbled rocks in a dry riverbed. It is also tolerant of man-made clearings. It is an accomplished predator, feeding primarily on invertebrates (Eisenberg and Redford 1999). Extensive work on colony animals has made M. domestica one of the best studied of the South American small opossums. In captivity this species breeds throughout the year, and some females produce four litters a year, some studies suggest up to six litters. The female builds a compact, complicated nest, carrying nesting material with her tail. Gestation lasts fourteen or fifteen days; young are born at about 0.10 g; litter size is three to fourteen, with an average of seven; and the oestrous cycle is twenty-eight days. Other studies give age of first reproduction is five to seven months, and a litter range from 6 to 11 with an average of 8.4. Young are attached to the nipple for about two weeks and then enter a nest phase. The female does not have a pouch but will transport young on her back. Young eat solid food at four to five weeks, can be separated from the females at seven weeks, and can reproduce at fifteen months. In captivity males often weigh considerably more than females.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Gray short-tailed opossums are found in tropical forests, scrublands, and grassy areas, on the ground or in low level vegetation. As with other short-tailed opossums (Monodelphis), gray short-tailed opossums may inhabit human dwellings, where they feed on small rodents and insects.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gray short-tailed opossums are omnivorous, eating insects, fruits, and small animals, such as rodents.

Animal Foods: mammals; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Gray short-tailed opossums are insectivores and negatively impact insect populations where they occur. No list of predators which feed upon M. domestica has been published; however, they are likely part of the diets of other mammalian carnivores, such as other didelphids, and large birds of prey. Monodelphis domestica also acts as a host for a variety of parasites, such as the echinostomatiform protozoan Rhopalias dobbini.

Commensal/Parasitic Species:

  • Prod, H. 1968. Phopalias-Dobbini New Species of Parasitic Trematode of Monodelphis-Domestica-Domestica. Bulletin du Museum National d'Histoire Naturelle, 40/2: 393-395.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Specific information on predators of M. domestica was not found. Harpy eagles (Harpia harpyja), other birds of prey, and other predatory mammals are likely predators. Gray short-tailed opossums are cryptically colored and secretive, thereby avoiding some predation.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Gray short-tailed opossums vocalize when threatened or approached by a possible mate. A series of chirps or barks is used to advertise threat level. Olfaction also plays an important role in the lives of gray short-tailed opossums; scent marking is used for territorial purposes and for assessment of reproductive condition of females.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Just over six years seems the most agreed upon upper lifespan in captivity. In the wild, two years is the standard lifespan.

Range lifespan

Status: wild:
3 to 6 years.

Average lifespan

Status: wild:
4 years.

Range lifespan

Status: captivity:
6 to 10 years.

Typical lifespan

Status: wild:
1 to 3 years.

Typical lifespan

Status: captivity:
2 to 6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.1 years (captivity) Observations: One captive specimen lived for 5.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating behavior in M. domestica is strongly tied to olfaction. Males habitually mark their surroundings with a chemical mark produced by a sternal gland. This scent likely serves as an advertisement to local females and a warning to local males. When a male and a receptive female meet, a precopulatory dance of sniffing, chasing, biting, and licking ensues. At the completion of this dance, the male immobilizes the female's hind legs and begins copulation, which lasts from 4 to 7 minutes. The majority of matings take place with the animals laying on their right sides.

Mating System: polygynandrous (promiscuous)

Sexual maturity in M. domestica is reached by 18 to 20 weeks. Gestation lasts 14 to 15 days and females can have up to 5 litters per year. Typical litter size is from 7 to 9.

Breeding interval: On average gray short-tailed opossums breed 4 times per year.

Breeding season: In the wild, breeding occurs most often during the spring and summer months, when daylight hours are the longest.

Range number of offspring: 1 to 15.

Range gestation period: 14 to 15 days.

Range weaning age: 3 to 4 weeks.

Average weaning age: 3 weeks.

Range time to independence: 6 to 8 weeks.

Range age at sexual or reproductive maturity (female): 5 to 7 months.

Range age at sexual or reproductive maturity (male): 5 to 7 months.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; viviparous

Average birth mass: 0.1 g.

Average number of offspring: 9.

Immediately after birth, newborn M. domestica crawl to their mother's stomach and attach to a nipple. They remain attached this way for 3 to 4 weeks. After detachment the young climb on their mother and/or follow her around for another three months or more. Paternal care in M. domestica is nonexistent, moreover, in captivity when fathers are confronted with their offspring, they act aggressively towards them.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Andromeda Oxford Ltd. 1984. American Opossums. Pp. 830-837 in D Macdonald, ed. The Encyclopedia of Mammals, Vol. 1/1, 1 Edition. New York, NY: Facts On File, Inc..
  • Andromeda Oxford Ltd. 2001. American Opossums. Pp. 808-814 in D Macdonald, S Norris, eds. The New Encyclopedia of Mammals, Vol. 1/1, 1 Edition. Oxford, UK: Oxford University Press.
  • Kalafut, M. 2005. "Know Your STO" (On-line). Short-Tailed Opossums, Keeping and Caring for These Pets. Accessed February 15, 2006 at http://www.knowyoursto.com/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monodelphis domestica

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0621-06|NC_006299|Monodelphis domestica| AATCGTTGACTCTTCTCAACTAACCATAAAGATATTGGTACTTTATATTTATTATTTGGTGCTTGAGCAGGAATAGTTGGAACCGCACTA---AGCCTCCTAATTCGAGCAGAATTAGGCCAACCAGGGACTCTAATTGGTGAT---GATCAAATTTATAACGTAATCGTAACTGCCCACGCTTTCGTTATAATTTTCTTCATAGTAATACCTATCATGATTGGAGGTTTTGGTAACTGACTAGTACCACTAATA---ATTGGAGCACCAGATATAGCATTTCCCCGAACAAATAATATAAGTTTCTGACTACTACCACCCTCATTCCTTCTTTTACTAGCATCATCCACAGTTGAAGCAGGGGCAGGAACTGGTTGAACAGTATATCCCCCATTAGCAGGAAACCTAGCCCACGCAGGTGCCTCAGTAGACCTA---GCAATCTTCTCACTTCACTTAGCTGGTATTTCCTCCATCTTAGGTGCTATTAATTTTATTACCACTATTATCAACATAAAACCCCCAGCAATATCTCAATACCAGACCCCGCTGTTTGTATGATCAGTTATAATTACAGCCGTGCTTCTACTACTGTCTCTTCCAGTTCTAGCTGCA---GGCATTACTATACTATTAACTGATCGAAATCTTAATACTACCTTCTTTGATCCTGCAGGTGGAGGAGATCCCATCCTTTATCAGCACCTGTTTTGATTTTTTGGTCACCCAGAAGTTTATATTCTTATTCTCCCAGGATTTGGGATCATCTCGCACATTGTTACATATTATTCAGGTAAAAAA---GAGCCTTTTGGCTATATAGGAATAGTGTGGGCTATAATATCTATTGGGTTTTTAGGTTTTATTGTATGAGCCCATCATATATTTACTGTAGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monodelphis domestica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Vilela, J., Solari, S., Flores, D., de la Sancha, N. & Astua de Moraes, D.

Reviewer/s
Teta, P. & Chiozza, F.

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Monodelphis domestica is both common in the wild and in the pet trade.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Monodelphis domestica is common in the wild (Eisenberg and Redford 1999, Emmons and Feer 1997). In Paraguay is abundant in the Chaco region in western Paraguay, but the records from Argentina are scarce.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Monodelphis domestica can invade human dwellings and become an annoyance.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Gray short-tailed opossums have become a popular species in the exotic pet trade. They are important in research because they are one of the few animals to get skin cancer at a rate similar to humans. Gray short-tailed opossums are at the top of the list for full genome sequencing. Dozens of research projects are currently being done with M. domestica.

Gray short-tailed opossums are often welcome visitors in human households, as they consume insects, scorpions, and other pests.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray short-tailed opossum

The gray short-tailed opossum (Monodelphis domestica) is a small member of the Didelphidae family of opossums. It was the first marsupial to have its genome sequenced. It is naturally found in arboreal habitats in Bolivia, Brazil and Paraguay. The opossum is used as a research model in science,[3] and is also frequently found in the exotic pet trade. It is also known as the Brazilian opossum, rainforest opossum and in a research setting the laboratory opossum.

Laboratory opossum

The gray short-tailed opossum possesses several features that make in ideal research model, particularly in studies of marsupials, as well as the immunological and developmental research on mammalian systems. It breeds relatively easily in laboratory settings, and neonates are exposed and can be readily accessed because, unlike other marsupial species, female opossums lack a pouch: neonates simply cling to the teats. Opossums are born at a stage that is approximately equivalent to 13- to 15-day-old fetal rats or 40-day-old human embryos. Like other marsupials, the inadequacies of the neonate's immune system function make it an ideal model for both transplant and cancer research, as well as general investigations into immune system development.[4] Its genome was sequenced and a working draft published in May 2007:[5] the decoding work, directed by MIT and Harvard, reveals the opossum to have between 18,000 and 20,000 protein-coding genes.

References

  1. ^ Gardner, Alfred (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 14. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Vilela, J., Solari, S., Flores, D., de la Sancha, N. & Astua de Moraes, D. (2011). "Monodelphis domestica". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/40514. Retrieved 18 January 2012.  Database entry includes justification for why this species is of least concern
  3. ^ "Extraordinary Resources: The Laboratory Opossum". SFBR. http://www.sfbr.org/pages/about_resources5.php. Retrieved 2007-04-13. 
  4. ^ Wang Z; Hubbard GB, Pathak S, and VandeBerg JL (October 1, 2003). "In vivo opossum xenograft model for cancer research". Cancer Research 63 (19): 6121–6124. PMID 14559788. http://cancerres.aacrjournals.org/cgi/content/full/63/19/6121. 
  5. ^ Mikkelsen TJ et al. (May 2007). "Genome of the marsupial Monodelphis domestica reveals innovation in non-coding sequences". Nature 447 (7141): 167–177. doi:10.1038/nature05805. PMID 17495919. http://www.nature.com/nature/journal/v447/n7141/full/nature05805.html. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!