Overview

Distribution

Range Description

This species occurs in eastern Colombia, Venezuela, Guyana, Suriname, French Guiana, south to northern Brazil (bounded by Orinoco, Negro and Amazon) (Voss et al. 2001; Gardner 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Monodelphis brevicaudata is predominantly found in the South American countries of Venezuela, the Guyanas, Columbia, parts of Brazil, and Bolivia.

Biogeographic Regions: neotropical (Native )

  • Ventura, J., R. Perez-Hernandez, M. Lopez-Fuster. 1998. Morphometric Assessment of the Monodelphis brevicaudata Group in Venezuela. Journal of Mammalogy, 79/1: 104-111.
  • NatureServe, 2003. "Didelphis brevicaudata: Red-legged, short-tailed opossum." (On-line). InfoNatura: Birds, mammals, and amphibians of Latin America. Accessed February 09, 2004 at http://www.natureserve.org/infonatura/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red-legged short-tailed opossums have a body length of approximately 16 cm, a tail length of roughly 9 cm, and weigh between 67 and 95 g. Males are reported to be slightly larger than females.

One distinctive feature of M. brevicaudata is that members of the species usually have grey or black fur on their backs, reddish fur on their sides continuing onto the legs, and black feet and tail. Their tails are very short and furred. Their fur is usually short and dense.

The skull is characterized by the presence of the jugal and zygomatic arch. The dental formula of this opossum species is 5/4, 1/1, 3/3, 4/4= 50.

Range mass: 67 to 95 g.

Average length: 16 cm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.366 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It tolerates a variety of habitats types. Although occurs in rain forests in all strata, including secondary forest. It also may be found in edge habitats around clearings. It is less abundant in dry deciduous forests. Found in mature, disturbed, and secondary rainforest, gardens, and plantations. This species is predominantly terrestrial and crepuscular in its habits. It is apparently chiefly insectivorous. Up to seven young are born in a single litter. In northern Venezuela the breeding season extends from May through August. The behaviour patterns and breeding biology are probably similar to those of M. domestica, a species well studied in captivity (Eisenberg and Redford, 1999; Emmons and Feer, 1997). It occurs at up to 1,200 m elevation (Eisenberg and Redford, 1999; Emmons and Feer, 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-legged short-tailed opossums live mainly in forests and in shrubby areas with a great deal of vegetation. Nests have been reported in the hollows of trees.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

  • Linares, O. 1998. Mamiferos de Venezuela. Caracas: Socieda Conservacionista Audubon de Venezuela.
  • Eisenberg, J., K. Redford. 1999. Mammals of the Neotropics-Volume 3. Chicago and London: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Red-legged short-tailed opossums generally eat insects such as cockroaches and crickets and small animals such as spiders, but also eat fruit and seeds on occasion.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Through its foraging behavior, M. brevicaudata probably has a role in the regulation of insects and small animal populations in its habitat. To the extent that these animals serve as prey for predators, they may also have some affect on predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Details on the predation of M. brevicaudata are unknown, but common didelphid predators include owls, coyotes, foxes, and bobcats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Details of the communciation patterns of M. brevicaudata are not available. The species is reported to have tactile and chemical perception channels. As diurnal mammals, we can assume that they also use vision to some extent, and it is likely that they communicate with one another using body postures and other visual signals. Vocalizations have not been reported, but probably occur.

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of M. brevicaudata is unknown.

Average lifespan

Status: captivity:
3.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is relatively little known about the mating patterns of M brevicaudata in particular. It may be similar to that of other didelphids, which are polygynous. Competition between males may be extreme, and male opposums are often intollerant of one another. Because of the sexual dimorphism in size seen in this species, it is likely that they are similar to other members of their family.

Mating System: polygynous

There is not a great deal that is known about the reproduction of the M. brevicaudata. Although data for this species are scant, within one member of the genus the period of estrus was found to last 3 to 12 days, and the estrous cycle showed a bimodal distribution, being about 2 weeks long in one of captive females and about 1 month long in another group. The species usually reproduces during the dry season and they produce between 6 and 8 young. Reproduction of this species may be similar to that of other opossums which have an average gestation period of 12.5 days.

Regardless of the actual length of gestation, we can assume that because these animals are marsupials, the gestation is short, and the young are born fairly undeveloped. Because the pouch of females is not well developed in this genus, it is likley that the young must cling to the nipple until they are large enough to ride on the back of their mother.

Young are dependent upon their mother until about 50 days after birth. Sexual maturity in the genus Monodelphis is reached between 4 and 5 months of age, and breeding may occur as late as 39 months of age in males and 28 months in females.

It is not known how frequently these animals reproduce, and it is not possible to generalize from other members of the genus. Some species in Monodelphis are apparently semelparous, with few individuals living past their first reproduction. Others may produce up to four litters per year.

Breeding interval: The breeding interval of these animals is not known.

Breeding season: The breeding season of this species has not been reported.

Range number of offspring: 6 to 8.

Average time to independence: 50 days.

Range age at sexual or reproductive maturity (female): 4 to 5 months.

Range age at sexual or reproductive maturity (male): 4 to 5 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 7.

There is no information about the specific parental investment of red-legged, short-tailed opossums. It is likely that the female, who provides nourishment for the young gives most, if not all of the parental care. The pouch of these animals is reported to be poorly developed, and so the young must cling to a nipple until they are large enough to ride on the the mother's back. The role of the male in parental care of M. bevicaudata is not known.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monodelphis brevicaudata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATACTTACTATTTGGTGCTTGAGCAGGAATAGTTGGAACCGCACTAAGTCTCCTCATCCGAGCAGAACTAGGTCAACCAGGAACTCTAATTGGTGATGATCAGATTTATAATGTAATTGTAACNGCCCACGCTTTCGTTATAATTTTCTTTATAGTAATACCTATTATGATTGGAGGTTTTGGTAACTGACTAGTACCACTGATAATTGGAGCCCCGGATATAGCATTCCCCCGAATAAATAATATAAGTTTTTGATTACTACCACCCTCATTCCTTCTTTTACTAGCATCATCTACCGTTGAAGCAGGGGCAGGAACTGGTTGAACAGTTTATCCTCCACTAGCAGGAAACCTAGCCCACGCAGGCGCCTCAGTTGATCTAGCAATTTTCTCCCTTCACTTGGCTGGTATCTCTTCCATCTTAGGCGCTATTAACTTTATTACTACTATTATTAATATAAAACCTCCAGCAATATCTCAATATCAAACCCCACTATTTGTTTGATCAGTTATAATTACAGCTGTACTCCTACTTCTATCNCTTCCAGTCCTAGCTGCAGGCATCACTATACTACTAACTGATCGAAATCTTAATACTACCTTCTTTGACCCCGCAGGCGGAGGCGACCCAATCCTTTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Monodelphis brevicaudata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Catzeflis, F., Costa, P., Lew D. & Soriano, P.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is no special conservation status for M. brevicaudata. Howver,there are reportes that most members of the genus are declining due to habitat destruction.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Sometimes common, but populations show large year-to-year variation: they may be common one year and absent the next (Emmons and Feer, 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats, however, there is habitat loss in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Found in several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative consequences of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern red-sided opossum

The northern red-sided opossum or the Guianan short-tailed opossum,[3] Monodelphis brevicaudata, is an opossum species from South America. It is found in Bolivia, Brazil. French Guyana, Guyana, Surinam and Venezuela.

Characteristics[edit]

Body length is 11–14 cm (4 1/4-5 1/2 in). Tail length is 4.5-6.5 cm (1 3/4-2 1/2 in). They are red-legged mouse like marsupials that weight anywhere between 67 and 95 g. There is no recognizable sexual dimorphism between the males and females, though the males are slightly larger than the females. The distinctive feature of the M. brevicaudata is the short, dense, grey or black fur they on their dorsal side with red fur on the lateral side that continues down to the feet.[4]

Habitat[edit]

They are found in the rainforest, typically in mature, secondary rainforest. plantations, or gardens, including the edges of clearings. It is not as often found in dry deciduous forests. They reside in shrubby areas with lots of vegetation and often are found in the hollows of trees. Being in this environment also exposes them to their predators such as owls, coyotes, foxes and bobcats. It is regularly found up at 1,2000m in elevation.[4]

Behavior[edit]

Life span in the wild is unknown but in captivity they are live, on average, about 3.9 years.[4] They live in forested areas, but are poor climbers and stay on the forest floor. They are nocturnal and during the day they stay in nests in hollow logs or tree trunks and are active during twilight. Their diet consists of seeds, shoots and fruits, carrion, insects such as cockroaches, crickets and spiders, and some small rodents. Rodents are killed with a powerful bite in the back of the head.[5]


Reproduction[edit]

They are polygynous and become sexually mature at around 4 to 5 months. The males in the groups may be violent and fight one another for territory and mates. There are 7 young born per litter, and if healthy enough, females can have 4 litters per year.[4] Breeding season is typically from May to August, but are seen to be similar to that of ‘’Monodelphis domestica’’. It is speculated that the females may show some form of parental care since they need to care for the young after birth for about 50 days.[4] The pouch of the M. brevicaudata is not as developed as in other marsupials. The young cling to the mother's fur and nipples and ride on her back when they are old enough to hold on .[5] The shape of the urethral grooves of the males' genitalia is used to distinguish between Monodelphis brevicaudata, Monodelphis domestica, and Monodelphis americana. The grooves form 2 separate channels that form the ventral and dorsal folds of the erectile tissue.[6]

Taxonomy[edit]

M. brevicaudata was previously thought to have been a member of Monodelphis glirina. After close examination and gene sequence studies in 2010, it was determined that there were actually three different species in the Bolivian area: M. brevicaudata and M.domestica.[7]

References[edit]

  1. ^ Gardner, A. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 14. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Catzeflis, F., Costa, P., Lew, D. & Soriano, P. (2008). Monodelphis brevicaudata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ Carvalho, B de A., Oliveira, L. F. B., Langguth, A. Freygang, C. C., Ferrax, R. S., Mattevi, M. Phylogenetic relationships and phylogeographic patterns in Monodelphis (Didelphimorphia: Didelphidae). Journal of Mammalogy. 92(1): 121-133. 2011
  4. ^ a b c d e Unknown. Monodelphis Brevicaudata: Details. Encyclopedia of Life. EOL, n.d. Web. 01 Dec. 2013.
  5. ^ a b Dr. Whitfield, Philip.The Simon & Schuster Encyclopedia of Animals, New York:Marshall Editions Development Limited, 1998. pg 21.
  6. ^ Nogueira, J., Castro, A. S., Câamara, E. C., & Câmara, B. O. (2004). Morphology of the Male Genital System of Chironectes Minimus and Comparison to other Didelphid Marsupials. Journal Of Mammalogy, 85(5), 834-841.
  7. ^ Robert S. Voss, "A New Species of the Didelphid Marsupial Genus Monodelphis from Eastern Bolivia", American Museum Novitates, 3740, 1-14.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!