Overview

Comprehensive Description

Description

Phyllobates terribilis is a small frog (though large for a dendrobatid), with adult females having a maximum snout-vent length of 47 mm, and adult males reaching 45 mm in snout-vent length. Males mature at 37 mm while females mature at 40-41 mm. The snout is sloping and rounded in lateral profile, and bluntly rounded to truncate in dorsal view. The canthus rostralis is rounded, and the loreal region is both vertical and slightly concave. The tympanum is concealed posterodorsally. Hands and feet lack webbing and fringe. Fingers and toes terminate in moderately expanded discs; the disc of the third finger is expanded to the same degree in both males and females. If measured while appressed, the third finger is longest with the fourth, first, and second following in decreasing or approximately equal length; if measured from the base, the third finger is longest and the first finger is next while fingers 2 and 4 are roughly equal. Hands have a large, low, rounded tubercle on the palm. An inner metacarpal tubercle is present on the base of the first finger, with one subarticular tubercle on each of fingers 1 and 2, and two subarticular tubercles on fingers 3 and 4. On the feet, the relative length of the toes is 4>3>5>2>1. The distal third of the tarsus is ridged, with the ridge continuous from the inner metarsal tubercle to the tarsal tubercle. Toes 1 and 2 each bear one subarticular tubercle, toes 3 and 5 have two subarticular tubercles, and toe 4 bears three subarticular tubercles. Phyllobates terribilis skin is smooth to somewhat rugose or finely granular, becoming noticeably rugose and coarsely granular on the upper hind limbs. Teeth are present on the maxillary arch. Males have a shallow subgular vocal sac that is indicated by small expansion wrinkles at the base of the throat, and well-developed paired vocal slits on the floor of the mouth. (Myers et al. 1978).

The dorsal coloration on adult specimens of Phyllobates terribilis is bright golden yellow or golden orange, or pale metallic green, depending on the location of collection. Occasional individuals were deep orange or pale greenish yellow. Ventrally the color is the same as or slightly lighter than the dorsal color, except for the underside of the hands and feet, which are black, and the undersides of the thighs, which have a black seat patch. There is also a black crease at the axilla and groin. The eyes, nares and digit tips are black. There is usually black edging on the lower rim of the tympanum. In many individuals the mouth is edged with black, and the creases of limb articulations are often black. Males generally have some gray coloration on the base of the throat. In some individuals there is also a light gray suffusing the axilla and groin, as well as the posterior of the venter and the concealed part of the shank. In individuals that are pale metallic green in overall color, the venter may be slightly bluish green and the concealed part of the shank is sometimes a definite blue-green. Variation in ground color hue was associated with microgeographic variation (i.e. frogs collected from a given ridge or slope area tended to be the same hue) (Myers et al. 1978).

Phyllobates terribilis tadpoles measure an average of 4.1 mm in body length and 11.1 mm in total length at hatching. At stage 37 (with well-developed hind legs), tadpoles have reached an average size of 12.6 mm in body length and 35.4 mm in total length. The head and body are depressed, with body width being greater than body depth. Eyes and nostrils are dorsal, and the eyes are directed dorsolaterally. The spiracle is sinistral and the vent is dextral (in some stage 25 larvae, the vent was located medially). The mouth is anteroventral with finely serrated beaks and 2/3 tooth formula; the second row of teeth above the mouth has a gap above the beak. The oral disc is anteriorly nude and indented laterally, with the lateral and posterior edges of the disc having one or two rows of papillae, depending on the developmental stage of the larva. Mouthparts are incompletely developed at stage 25 (the stage at which many dendrobatid tadpoles mount onto the back of the attendant parent frog). At stage 25 the denticles begin to keratinize and beak serrations are only just beginning to develop. Stage 25 larvae have a single row of papillae while stage 27 and older larvae have two rows (similar to the ontogenetic changes seen in tadpole oral papillae of some hylid frogs) (Myers et al. 1978).

Newly hatched tadpoles are gray on the bodies and throats with paler gray tails and tail fins, with tiny flecks on the body and tail. At stage 26 the tail fins begin to become essentially transparent; there is weak pigmentation along the base of the fins and sparse flecking. At stage 37 the body color changes to blackish gray. Dense flecks are present dorsally and concentrate into paired dorsolateral stripes that run from the snout over the eyes to the base of the tail. To the naked eye the dorsolateral stripes look gray on a grayish black body, but under magnification the stripes appear pale bronze. At stage 42 (when forelimbs appear) the body is black and the dorsolateral stripes are brighter bronze to bronze-gold (Myers et al. 1978).

Juvenile frogs are black in color, with gold dorsolateral stripes. This species undergoes an ontogenetic color change. As the frogs reach maturity, the dorsolateral stripes disappear, and the body becomes a more brightly colored uniform golden yellow. The bright golden dorsal coloration is achieved by 18 weeks, when the frog is about 21 mm in SVL, with the venter taking another several weeks to reach the same bright color. Since the frog reaches adult size in somewhat more than a year, the adult coloration is actually attained fairly early. Juvenile P. terribilis resemble P. aurotaenia in that both are black with paired gold dorsolateral stripes. However, juvenile P. terribilis can be distinguished by the lack of blue or green ventral spotting (present in juvenile P. aurotaenia). (Myers et al. 1978). The juvenile pattern of light stripes on a dark background is also lost in P. bicolor upon reaching maturity, but is retained into adulthood in the other members of the P. bicolor group, P. aurotaenia, P. lugubris and P. vittatus (Myers et al. 1978; Silverstone 1976).

This species produces the steroidal alkaloids batrachotoxin, homobatrachotoxin, and batrachotoxinin A. These compounds are extremely potent modulators of voltage-gated sodium channels, acting to keep the channels open and depolarizing nerve and muscle cells irreversibly, potentially leading to arrhythmias, fibrillation, and eventually cardiac failure (Albuquerque and Daly 1977). When accidentally transferred onto human facial skin, these toxins have been reported to cause a burning sensation lasting several hours (Myers et al. 1978).

Batrachotoxin by itself is also capable of inducing numbness (see below for Myers' (1978) description of the effect of tasting P. vittatus), through its profound effects on a specific voltage-gated sodium channel (Na 1.8) known to be involved in pain reception. Thus batrachotoxin might be useful to develop as a topical pain-relief medication (Bosmans et al. 2004).

The combination of batrachotoxin and homobatrachotoxin is produced in quantities up to 1900 micrograms per frog, which is at least 20-fold more than other toxic species in the family Dendrobatidae. The range of batrachotoxin-homobatrachotoxin produced by individual frogs was 700-1900 micrograms, with an average of 1100 micrograms per frog. The lethal dose of batrachotoxin-homobatrachotoxin for a 20 gram white laboratory mouse is .05 micrograms when injected subcutaneously. Thus one P. terribilis frog skin contains enough toxin to kill about 22,000 mice. The lethal dose of batrachotoxin for humans is not known but has been estimated at 200 micrograms, with a single frog thus potentially holding enough poison to kill about 10 humans. Wild-caught frogs that had been held in captivity for periods ranging from three weeks up to one year had toxicities of about 50% of recently caught specimens, with frogs maintained in captivity for three years still maintaining toxicity at about 40% the level of recently captured animals (Myers et al. 1978). In contrast, poison frogs born and reared in captivity do not contain toxins in their skin, although they can accumulate alkaloid toxins if these are part of the diet (Daly et al. 2004).

Tadpoles did not contain batrachotoxin but a juvenile of 27 mm SVL was found to contain 200 micrograms of toxin, implying that the batrachotoxin alkaloids are synthesized or sequestered after metamorphosis (Myers et al. 1978). The toxins are concentrated in granular glands, which are most dense on the dorsal skin surfaces of the frog (Dumbacher et al. 2000).

In contrast, the related species P. bicolor is much less toxic, containing from 17-56 micrograms of batrachotoxin-homobatrachotoxin per frog, with an average of 47 micrograms per individual. Despite P. bicolor being more brightly colored, larger, and more openly active than P. aurotaenia, the two species are thought to be roughly the same in toxicity levels (Myers et al. 1978). The more distantly related Central American species Phyllobates vittatus and P. lugubris also produce batrachotoxins but at much lower quantities. Despite these lower levels of toxin, Myers et al. (1978) reported that tasting the back of P. vittatus gave the human taster a sensation of near-numbness of the tongue, followed by a distinctly unpleasant tightening in the throat.

Interestingly, batrachotoxins have also been found in feathers, but not the skin, of multiple species of passerine birds from New Guinea (particularly Pitohui dichrous, P. kirhocephalus, and Ifrita kowaldi) (Dumbacher et al. 2000). Breast, belly, and leg feathers show the highest toxin concentrations. Both toxin levels and toxin profiles in these birds vary considerably from population to population and can also change seasonally, implying that these toxins are acquired or synthesized from an environmental (dietary) source (Dumbacher et al. 2000). This source is most likely beetles of the genus Choresine (family Melyridae), which contain batrachotoxins and have been found in the stomach contents of New Guinea's toxic passerine birds. The family Melyridae is cosmopolitan and thus beetles could potentially be the source of the Phyllobates toxin as well (Dumbacher et al. 2004). Dietary arthropods (formicine ants, myrmecine ants, and in Madagascar, ponerine ants, as well as the siphonotid millipede Rhinotus purpureus) are known to provide defensive alkaloids to other toxic dendrobatid and mantellid frogs (Clark et al. 2005).

  • Clark, V. C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P., and Fisher, B. L. (2005). ''Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics.'' Proceedings of the National Academy of Sciences, 102(33), 11617-11622.
  • Albuquerque, E. X. and Daly, J. W. (1977). ''Batrachotoxin, a selective probe for channels modulating sodium conductances in electrogenic membranes.'' The Specificity and Action of Animal, Bacterial and Plant Toxins. Receptors and Recognition, Series B., Volume 1 P. Cuatrecasas, eds., Chapman and Hall, London, 297-338.
  • Daly, J. W., Secunda, S. I., Garraffo, H. M., Spande, T. F., Wisnieski, A., and Cover, J. F. (1994). '' An uptake system for dietary alkaloids in poison frogs (Dendrobatidae).'' Toxicon, 32(6), 657-663.
  • Dumbacher, J. P., Spande, T. F., and Daly, J. W. (2000). ''Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea.'' Proceedings of the National Academy of Sciences, 97, 12970-12975.
  • Maxson, L. R., and Myers, C. W. (2007). ''Albumin evolution in tropical poison frogs (Dendrobatidae): a preliminary report.'' Biotropica, 17(1), 50-56.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Bosmans, F., Maertensa, C., Verdonck, F., and Tytgat, J. (2004). ''The poison Dart frog’s batrachotoxin modulates Nav 1.8.'' Federation of European Biochemical Societies Letters, 577(2004), 245-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species is known only from tiny areas on the Pacific coast of Colombia on the Río Saija drainage, in Cauca Department, occurring up to 200m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Golden Poison Frogs can be found in the western foothills of the Andes on a "northerly inclined spur of the Cordillera Occidental" in Pacific coastal Colombia. The terrain is rough and hilly, with mostly steep, even perpendicular slopes. Elevation in their range varies from 90-200 m above sea level. They live in rainforest, occurring throughout the forest both on drier ridge tops and on moister slopes. They tend to live near smaller streams since forest along the larger streams has either been cleared for agriculture or is dense secondary growth forest (Myers et al. 1978).

  • Clark, V. C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P., and Fisher, B. L. (2005). ''Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics.'' Proceedings of the National Academy of Sciences, 102(33), 11617-11622.
  • Albuquerque, E. X. and Daly, J. W. (1977). ''Batrachotoxin, a selective probe for channels modulating sodium conductances in electrogenic membranes.'' The Specificity and Action of Animal, Bacterial and Plant Toxins. Receptors and Recognition, Series B., Volume 1 P. Cuatrecasas, eds., Chapman and Hall, London, 297-338.
  • Daly, J. W., Secunda, S. I., Garraffo, H. M., Spande, T. F., Wisnieski, A., and Cover, J. F. (1994). '' An uptake system for dietary alkaloids in poison frogs (Dendrobatidae).'' Toxicon, 32(6), 657-663.
  • Dumbacher, J. P., Spande, T. F., and Daly, J. W. (2000). ''Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea.'' Proceedings of the National Academy of Sciences, 97, 12970-12975.
  • Maxson, L. R., and Myers, C. W. (2007). ''Albumin evolution in tropical poison frogs (Dendrobatidae): a preliminary report.'' Biotropica, 17(1), 50-56.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Bosmans, F., Maertensa, C., Verdonck, F., and Tytgat, J. (2004). ''The poison Dart frog’s batrachotoxin modulates Nav 1.8.'' Federation of European Biochemical Societies Letters, 577(2004), 245-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Phyllobates terribilis is found in the Amazonian rainforest along the Pacific coast of Colombia. Other members of the Family Dendrobatidae have been found in close proximity along the coast of South America into the southern part of Central America. Phyllobates terribilis population is concentrated along the upper Rio Saija drainage in the vicinity of Quebrada Guangui’ and at La Brea in Colombia. Geographically isolated populations exist along the east and west banks along this river, dividing the population. Overall P. terribilis has a limited range, but is abundant within that area.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Golden poison frogs have a variety of bright vibrant colors that cover their entire bodies, from mint green to yellow to orange and sometimes white. Yellow or deep yellow, is the most common color seen, giving them their common name. Phyllobates terribilis is the most toxic species of frog. Unlike most other members of the Family Dendrobatidae, Phyllobates terribilis has uniform body coloration, rather than dark spots and stripes, as in their relatives Phyllobates aurotaenia , Phyllobates lugubris and Phyllobates vittatus. Adults are more brightly colored than young, which have the same primitive pattern of most other members of the family Dendrobatidae. They have dorsolateral stripes on dark bodies until they mature. By the time they reach adulthood, their coloration has changed to a single bright color.

An easy way to identify these frogs is by the odd protrusion from their mouth. This gives the false illusion that these frogs have teeth. Instead, they have an extra bone plate in their jaw that projects outwards and gives the appearance of teeth. These frogs have three toes on each foot. Each outside toe is almost equal in length but the middle toe is longer than the other two.

Bright skin coloration in P. terribilis is thought to be a warning to predators that they are poisonous. Their skin is saturated in an alkaloid poison that contains batrachotoxins. These toxins prevent nerves from transmitting nerve impulses and ultimately result in muscle paralysis. About 1900 micrograms of batrachotoxins can be found in these frogs. Only 2 to 200 micrograms is thought to be lethal to humans.

Adult females are typically larger than males. The average body length reaches 47 mm but females can reach 50 to 55 mm. Compared to the 175 species of dendrobatids, P. terribilis does not have a wide range of sizes. Other species can be as small as a human fingernail.

Range length: 47 to 55 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: female larger

  • Duellman, W., L. Trueb. 1994. Biology of Amphibians. Baltimore, Maryland: McGraw-Hill Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Phyllobates terribilis
Catalog Number: USNM 211527
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1971
Locality: Quebrada Guangui, 0.5 km above Río Patia (Upper Río Saija drainage), Cauca, Colombia, South America
Elevation (m): 100 to 200
  • Paratype: Myers, C. W., et al. 1978. Bull. Amer. Mus. Nat. Hist. 161 (2): 313, plate 2 and text figures 1-3, 8D.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Phyllobates terribilis
Catalog Number: USNM 211526
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1971
Locality: Quebrada Guangui, 0.5 km above Río Patia (Upper Río Saija drainage), Cauca, Colombia, South America
Elevation (m): 100 to 200
  • Paratype: Myers, C. W., et al. 1978. Bull. Amer. Mus. Nat. Hist. 161 (2): 313, plate 2 and text figures 1-3, 8D.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Phyllobates terribilis
Catalog Number: USNM 211525
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1971
Locality: Quebrada Guangui, 0.5 km above Río Patia (Upper Río Saija drainage), Cauca, Colombia, South America
Elevation (m): 100 to 200
  • Paratype: Myers, C. W., et al. 1978. Bull. Amer. Mus. Nat. Hist. 161 (2): 313, plate 2 and text figures 1-3, 8D.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chocó-Darién Moist Forests Habitat

This taxon can be found in the Chocó-Darién moist forests ecoregion, one of the most species rich lowland areas on Earth, with exceptional abundance and endemism over a broad range of taxa including plants, birds, amphibians and arthropods. The biological distinctiveness is exceptional, with considerable biodiversity.

There are three principal geomorphologic types in the ecoregion: alluvial plains of recent origin, low mountains formed by the relatively recent dissection of sediments from the Tertiary and Pleistocene periods, and the complexes in mountain areas consisting of mesozoic rocks. The high precipitation and the topography mean that the ecoregion includes a complex of great hydrographic basins, the most important being those of the Atrato, Baudó, and San Juan Rivers and the Micay and Patía Rivers in the south. The force of the water in many of these rivers form deep gorges cutting through the mountains, creating spectacular rapids and waterfalls in the mountains. At lower elevations, large rivers become very wide and with many meanders. Given the high precipitation in the region, it is not surprising that the soils are severely leached and poor in nutrients. Most of the ecoregion has typical laterite soils with reddish clay, although the soils are younger and less leached in some areas, especially close to the base of the Andes and in the floodplains of the major rivers. Of particular botanical interest are the white clay soils in the region of Bajo Calima in Colombia, which are associated with the gigantic sclerophyllous leafed and unusually large fruited vegetation.

Depending on the altitudinal gradient, soil water content and the effect of the sea, there are various types of vegetation that make up the ecoregion. In broad terms, in the northern part of the ecoregion, the lowland rainforests correlate to the Brosimun utilis alliance, including communities dominated by the deciduous Cuipo tree (Cavanillesia platanifolia), the Espavé wild cashew (Anacardium excelsum), the Panamanian rubber tree (Castilla elastica), Brosimum guianense, Bombacopsis spp., Ceiba pentandra, Dipteryx panamensis, and others. In the undergrowth Mabea occidentalis, Clidemia spp., Conostegia spp. and Miconia spp. are abundant. In zones that are occasionally flooded, the Cativo (Prioria copaifera) flourishes as well. In the southern part of the ecoregion, these rainforests have multiple strata, with two layers of trees, lianas, and epiphytes with vigorous growth rates. The number of deciduous plants increases in the north and south, where there is a dry season, particularly near the coast. The forests at higher altitudes, starting at 600 meters, have communities with the following species: Guamos (Inga spp.), Billia columbiana, Brosimum sp., Sorocea spp., Jacaranda hesperia, Pourouma chocoana, Guatteria ferruginea, Cecropia spp., Elaegia utilis, and Brunellia spp.

There are at least 127 species of amphibians in the Choco-Darien, including the following endemic anuran species: Isla Bonita robber frog (Craugastor crassidigitus); Kokoe poison frog (Phyllobates aurotaenia NT), found on western slopes of the Cordillera Occidental , along the Ra­o San Juan drainage south to the Ra­o Raposo; Golden poison frog (Phyllobates terribilis EN); La Brea poison frog (Oophaga occultator); Andagoya robber frog (Pristimantis roseus); Antioquia beaked toad (Rhinella tenrec); Atrato glass frog (Hyalinobatrachium aureoguttatum); Blue-bellied poison arrow frog (Ranitomeya minuta); Colombian egg frog (Ctenophryne minor), known only to the in the upper Ra­o Saija drainage; Condoto stubfoot toad (Atelopus spurrelli VU); Flecked leaf frog (Phyllomedusa psilopygion); LeDanubio robber frog (Strabomantis zygodactylus). An endemic salamander present in the Choco-Darien is the Finca Chibigui salamander (Bolitoglossa medemi VU).

Some other non-endemic anurans found here are: Anatipes robber frog (Strabomantis anatipes); Banded horned treefrog (Hemiphractus fasciatus); Black-legged poison frog (Phyllobates bicolor NT); Horned marsupial frog (Gastrotheca cornuta EN), known for having the largest amphibian eggs in the world; El Tambo stubfoot toad (Atelopus longibrachius EN); Elegant stubfoot toad (Atelopus elegans CR). Endemic caecilians in the ecoregion include the Andagoya caecilian (Caecilia perdita).

There are a number of reptilian taxa within the ecoregion, including: Adorned graceful brown snake (Rhadinaea decorata); the endemic Black centipede snake (Tantilla nigra); Boulenger's least gecko (Sphaerodactylus scapularis VU); the endemic Iridescent ground snake (Atractus iridescens); the endemic Cauca coral snake (Micrurus multiscutatus); the endemic Colombian coral snake (Micrurus spurelli); the endemic Dark ground snake (Atractus melas); the endemic Colombian mud turtle (Atractus melas VU); and the endemic Echternacht's ameiva (Ameiva anomala).

There are 577 species of birds recorded; Tyrannidae is listed as the most diverse avian family, presenting 28 genera and 60 species within the ecoregion. The Choco-Daroemis is a center of avian endemism of the Neotropics; moreover, according to Stattersfield, this ecoregion spans two Endemic Bird Areas, one in Central America and one in South America.

Between these two Endemic Bird Areas there are over sixty restricted range species, including the Chocó tinamou (Crypturellus kerriae VU), Chestnut-mantled Oropendola (Psarocolius cassini EN), Viridian dacnis (Dacnis viguieri), Crested ant-tanager (Habia cristata), Lita woodpecker (Piculus litea), and Plumbeous forest-falcon (Micrastur plumbeus EN). Also to be noted is the presence of the Harpy eagle (Harpia harpyja), the Black and white crowned eagle (Spizastur melanoleucus), taxa increasingly rare in many areas of the Neotropics, and possibly the Speckled antshrike (Xenornis setifrons EN) although one has not been recorded in Colombia since the 1940s.

The region is rich in mammalian taxa, but the larger animals have received inadequate research. These include the Bush dog (Speothos venaticus NT); Chocó tamarin (Saguinus geoffroyi EN), the Baird's Tapir (Tapirus bairdii EN), the Giant anteater (Myrmecophaga tridactyla VU), the Brown-headed spider monkey (Ateles fuscipens CR), the Puma (Puma concolor VU), the Ocelot (Leopardus pardalis LC), and the jaguar (Panthera onca NT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
It lives on the ground in humid forests, and is only known from primary forest. It is not known whether or not it can adapt to secondary habitats. The eggs are laid on the ground and the males transport the larvae to permanent pools.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden poison frogs thrive in lowland Amazonian rainforests. This an extremely humid region that receives up to 5 m of rain per year and a minimum of 1.25 m. The region they inhabit is characterized by a hilly landscape, elevations varying from 100 to 200 m, and is covered by areas of wet gravel and small saplings and relatively little leafy debris. They are terrestrial animals that live on the forest floor, but they rely on freshwater to support their young.

Range elevation: 100 to 200 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Aquatic Biomes: temporary pools

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Golden poison frogs are insectivores and prey primarily on species of Brachymyrmex and Paratrechina ants. They also consume small invertebrates such as termites and beetles. Golden poison frogs use their long, sticky tongues to capture prey. They stalk and attack prey in one quick movement; this movement is so fast it's hard to see the mechanics of it with the naked eye. An adhesive tongue enables the prey to stick to its mouth to aid in capturing. Typically, they will not attack an insect bigger than a full grown cricket, approximately 1 inch. It has recently been discovered that feeding on a small Choresine beetle (Family Melyridae) may be the main source of toxicity for P. terribilis.

Animal Foods: insects; terrestrial non-insect arthropods; terrestrial worms

Primary Diet: carnivore (Insectivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Golden poison frogs have only one natural predator. They usually sit out in the open. When approached they do not try to hide, but rather further their distance from the thing that approaches it. They are generalist feeders, preying on all types of fruit flies, crickets, beetles, and termites. Recent research shows that these frogs may obtain some of their poison by eating a beetle that belongs to the family, Melyridae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Golden poison frogs are best known for their extremely potent poison. The toxins they produces are twenty times more powerful than any other poison dart frog toxin. Their brightly colored bodies warn predators of their extreme toxicity. This serves as the frog’s main anti-predator adaptation. The toxins produced are steroidal alkaloids batrachotoxin, homobatrachotoxin, and batrachotoxinin A. These compounds are extremely potent modulators of voltage-gated sodium channels. They keep the channels open and depolarize nerve and muscle cells irreversibly. This damaging action may lead to arrhythmias, fibrillation, and eventually cardiac failure. When accidentally transferred onto human facial skin, these toxins have been reported to cause a burning sensation lasting several hours.

There is only one known predator of P. terribilis: Liophis epinephelus. This is a small snake that feeds on young frogs. The snake is immune to the toxins produced by golden poison frogs but since it is so small, it can only feed on juvenile frogs.

Known Predators:

Anti-predator Adaptations: aposematic

  • Daly, J., C. Myers, J. Warnick, E. Albuquerque. 1980. Levels of Batrachotoxin and Lack of Sensitivity to its Action in Poison-Dart Frogs ( Phyllobates ). Science, 208: 1383-1385.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Golden poison frog males engage females in courtship by singing a long, melodious trill. This trill lasts 6 to 7 seconds followed by a 2 to 3 second version. The trill is usually a uniform train of notes uttered at a rate of 13 beats per second. The frequency for this tune is 1800Hz. This is a lower frequency when compared to related species of the family Dendrobatidae. They also communicate through gestures. A push up movement of the body represents dominance while the lowering of the head implies submission. A sign of excitement usually seen during hunting and courting includes the tapping of their long middle toe.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Like most frogs, golden poison frogs go through complete metamorphosis. Eggs are laid in small clutches of less than 20 and carried on the backs of males to small pools of water, where they develop and metamorphose into froglets.

  • Myers, C., J. Daly, B. Malkin. 1978. A Dangerously Toxic New Frog (Phyllobates) Used by Embera' Indians of Western Colombia, with Discussion of Blowgun Fabrication and Dart Poisoning. Bulletin of the American Museum of Natural History, 161/2: 313-337.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild golden poison frogs are believed to live up to 5 years or more. Due to their high toxicity levels, these frogs have few predators, contributing to their long lifespan. Lifespan in the wild has not been confirmed because these frogs have only been observed in captivity, where they have lived up to 5 years old.

Range lifespan

Status: captivity:
5 (high) years.

Typical lifespan

Status: captivity:
5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Phyllobates terribilis is polygynandrous; both males and females have multiple mates. Courtship and egg laying have only been observed in captivity, with limited specimens. Each breeding involved two or more male frogs and one female. Males attract females by using a variety of high pitched calls. Mating could be described as a frantic frenzy where individuals move quickly around each other during egg laying. This is hard to observe because the movement is so fast and done under cover of vegetation. Specifics on mode of reproduction are unconfirmed but it is believed that there is some vent to vent contact between frogs during copulation. However, golden poison frog mating rituals have not been observed in their natural habitat. Golden poison frogs are thought to mate year round.

Mating System: polygynandrous (promiscuous)

Golden poison frog eggs have not been found in the wild. In captivity, clutches of eggs usually do not exceed 20. In captivity, once eggs are laid and fertilized in water (by captive carers) they hatch 11 to 12 days later, typically taking 2 to 4 days for all the eggs to be completely hatched. Not even 10 days after leaving the water, they begin to feed on Drosophila flies.

Breeding interval: Breeding intervals are unknown.

Breeding season: Golden poison frogs seem to breed year round.

Range number of offspring: 8 to 18.

Average number of offspring: 13-14.

Range time to hatching: 11 to 12 days.

Range time to independence: 55 to 60 days.

Range age at sexual or reproductive maturity (female): 12 to 18 months.

Average age at sexual or reproductive maturity (female): 13 months.

Range age at sexual or reproductive maturity (male): 12 to 18 months.

Average age at sexual or reproductive maturity (male): 13 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

In the wild, once the female lays the eggs, the male fertilizes them and attaches them to its back. Only three male frogs have been captured with clutches of eggs on their backs. It seems that this period of carrying tadpoles on their backs is brief. It is a method of getting the eggs from their laying and fertilization site to the water to hatch. After fertilization and transfer to a small area of water for development, there is no further parental care.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male)

  • Myers, C., J. Daly, B. Malkin. 1978. A Dangerously Toxic New Frog (Phyllobates) Used by Embera' Indians of Western Colombia, with Discussion of Blowgun Fabrication and Dart Poisoning. Bulletin of the American Museum of Natural History, 161/2: 313-337.
  • Stewart, S. 2010. "The True Poison-Dart Frog: The Golden Poison Frog Phyllobates terribilis" (On-line). Accessed February 20, 2011 at http://www.herpetologic.net/frogs/caresheets/terribilis.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyllobates terribilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTATCTAGTGTTCGGCGCATGGGCCGGGATGGTAGGCACGGCCCTTAGCCTACTAATTCGAGCAGAGCTAAGTCAACCCGGCTCTTTACTGGGCGAT---GATCAAATTTATAATGTAATCGTCACCGCTCACGCCTTTGTAATAATTTTTTTTATGGTTATGCCAATTCTTATCGGGGGGTTCGGAAACTGACTTGTTCCTTTAATAATTGGAGCCCCTGATATAGCCTTTCCTCGAATAAACAACATAAGTTTTTGACTTCTCCCCCCTTCTTTCCTTCTCCTGTTAGCTTCAGCAGGAGTTGAAGCAGGCGCAGGCACAGGTTGAACAGTTTACCCCCCCCTCGCAAGCAACCTGGCTCATGCTGGACCATCAGTGGATTTAACAATTTTTTCACTGCATTTAGCTGGGGTTTCATCTATTCTGGGAGCAATTAATTTTATCACTACTACCCTAAACATAAAACCCCCTTCACTAACACAATATCAAACCCCCTTATTTGTGTGGTCTGTCTTGATCACCGCTATTCTCCTTCTCCTTTCCCTTCCGGTCTTGGCCGCAGGCATCACAATGCTGCTTACTGACCGAAATTTAAACACAACCTTCTTCGACCCCGCCGGAGGTGGGGACCCAGTTCTTTACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyllobates terribilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2004

Assessor/s
Wilmar Bolívar, Stefan Lötters

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Endangered because its Extent of Occurrence is less than 5,000 km2, all individuals are in fewer than five locations, and there is continuing decline in the extent and quality of its habitat in Cauca Department, Colombia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden poison frog populations have been decreasing due to deforestation for agricultural purposes. They can be found in fewer than five areas. This species is listed as endangered according to the IUCN Red List of Threatened Species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is extremely common in its tiny range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species, like all other members of the family Dendrobatidae, is diurnal. It is also terrestrial, preferring to sit on the ground or perched only a few centimeters above the ground on tree roots or ground litter. They are noticeably bolder than other poison dart frogs and are found out in the open. When disturbed, they will usually only hop away rather than try and hide. While these frogs normally are solitary in the wild, they have been occasionally observed in pairs. Their calls are long sustained trills, consisting of a rapid succession of individual notes uttered at a rate of 13 per second, with a dominant frequency of 1.8 kHz. This frequency is lower than that of P. aurotaenia, P. bicolor, P.lugubris and P. vittatus (Myers et al. 1978).

Eggs are laid terrestrially in small clutches of less than 20. Larvae, at developmental stage 25, are transported to pools on the backs of the male frogs. Male frogs have been observed carrying up to nine larvae simultaneously (Myers et al. 1978).

The populations appear to be large and dispersed through the forest, with both adults and juveniles found on the forest floor, although juveniles appear to be relatively rare (2.5% of all specimens collected). Recruitment appears to be low since clutch size is small and few nurse frogs were observed carrying tadpoles, yet P. terribilis adults were fairly abundant at the type locality. This species takes more than a year to attain sexual maturity and is relatively long-lived (five years in captivity) (Myers et al. 1978).

Given its toxicity, Phyllobates terribilis seems likely to have few predators other than the snake Leimadophis epinephelus. This snake has a high resistance to various anuran toxins (zetekitoxin from Atelopus zeteki, atelopid toxins from Atelopus elegans, piperidine alkaloids from Dendrobates auratus, and batrachotoxins from Phyllobates sp.). It is not a large snake (500 mm in total length); since adult Phyllobates terribilis frogs are fairly stocky and quite toxic, these snakes may only consume the juvenile P. terribilis and not the adults (Myers et al. 1978).

During feeding in captivity, frogs may clasp each other around the head (cephalic clasping) or sometimes the body. Interestingly, Phyllobates terribilis males have been observed in captive aggressive behavior to press the upper surfaces of their hands against their opponent's chin (rather than grasping the other frog's head with the palms contacting the head). (Myers et al. 1978).

  • Clark, V. C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P., and Fisher, B. L. (2005). ''Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics.'' Proceedings of the National Academy of Sciences, 102(33), 11617-11622.
  • Albuquerque, E. X. and Daly, J. W. (1977). ''Batrachotoxin, a selective probe for channels modulating sodium conductances in electrogenic membranes.'' The Specificity and Action of Animal, Bacterial and Plant Toxins. Receptors and Recognition, Series B., Volume 1 P. Cuatrecasas, eds., Chapman and Hall, London, 297-338.
  • Daly, J. W., Secunda, S. I., Garraffo, H. M., Spande, T. F., Wisnieski, A., and Cover, J. F. (1994). '' An uptake system for dietary alkaloids in poison frogs (Dendrobatidae).'' Toxicon, 32(6), 657-663.
  • Dumbacher, J. P., Spande, T. F., and Daly, J. W. (2000). ''Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea.'' Proceedings of the National Academy of Sciences, 97, 12970-12975.
  • Maxson, L. R., and Myers, C. W. (2007). ''Albumin evolution in tropical poison frogs (Dendrobatidae): a preliminary report.'' Biotropica, 17(1), 50-56.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Bosmans, F., Maertensa, C., Verdonck, F., and Tytgat, J. (2004). ''The poison Dart frog’s batrachotoxin modulates Nav 1.8.'' Federation of European Biochemical Societies Letters, 577(2004), 245-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats are deforestation for agricultural development, the planting of illegal crops, logging, and human settlement, and pollution resulting from the spraying of illegal crops. It is very occasionally reported in international trade in small numbers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species avoids secondary growth and cultivated areas, and prefers primary growth forest, making it sensitive to human land use. It is not prevalent along larger streams in its range, due to development in the form of plantain fields, or secondary growth from previous forest resource utilization. Major threats include pollution from illegal spraying of crops, and deforestation (Myers et al. 1978).

  • Clark, V. C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P., and Fisher, B. L. (2005). ''Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics.'' Proceedings of the National Academy of Sciences, 102(33), 11617-11622.
  • Albuquerque, E. X. and Daly, J. W. (1977). ''Batrachotoxin, a selective probe for channels modulating sodium conductances in electrogenic membranes.'' The Specificity and Action of Animal, Bacterial and Plant Toxins. Receptors and Recognition, Series B., Volume 1 P. Cuatrecasas, eds., Chapman and Hall, London, 297-338.
  • Daly, J. W., Secunda, S. I., Garraffo, H. M., Spande, T. F., Wisnieski, A., and Cover, J. F. (1994). '' An uptake system for dietary alkaloids in poison frogs (Dendrobatidae).'' Toxicon, 32(6), 657-663.
  • Dumbacher, J. P., Spande, T. F., and Daly, J. W. (2000). ''Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea.'' Proceedings of the National Academy of Sciences, 97, 12970-12975.
  • Maxson, L. R., and Myers, C. W. (2007). ''Albumin evolution in tropical poison frogs (Dendrobatidae): a preliminary report.'' Biotropica, 17(1), 50-56.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Bosmans, F., Maertensa, C., Verdonck, F., and Tytgat, J. (2004). ''The poison Dart frog’s batrachotoxin modulates Nav 1.8.'' Federation of European Biochemical Societies Letters, 577(2004), 245-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It does not occur in any protected areas, and the protection of part of this species' lowland forest habitat is recommended. Management practices that could allow a commercial, sustainable harvest of this species should be investigated. Decree INDERENA No. 39 of 9 July, 1985, forbids the collection of Phyllobates spp. from the wild in Colombia for breeding (or other) purposes. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Golden poison frogs do not display aggressive behavior towards humans. However, contact with their skin can prove fatal because of their extreme toxicity. This is not true of captive individuals, which tend to lose their toxicity in the absence of the wild prey that are the source of that toxin.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Golden poison frogs are the most highly toxic of all frogs. Colombian tribes, such as the Embre and Choco Indians, use poison secreted from the frogs’ skin to poison their blowgun darts. After heating darts over a fire, they are wiped over the frogs’ backs. Heat causes the back of the frog to moisten with poison which makes it easily accessible. Poisoned darts can stay lethal for up to two years. The toxin enables these tribes to catch small animals for food. These frogs are also being captured, bred, and sold as pets. This is possible because of their decrease in toxicity once held in captivity for a certain period of time. Medical research is also being done to see if these poisons can be developed into muscle relaxants, anesthetics, and heart stimulants. It is thought that it could even become a better anesthetic than morphine.

Positive Impacts: pet trade ; body parts are source of valuable material; source of medicine or drug ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

Phyllobates terribilis is the most highly toxic of all frogs, and is one of three species known to be used by native Colombians such as the Chocó and Cofán to poison their blow-gun darts (the other species being P. aurotaenia and P. bicolor). Once P. terribilis has been captured, the darts are rubbed over the skin of the live frog to collect the poison (in contrast to the other two Phyllobates species which are impaled on sticks and sometimes heated, to maximize the amount of toxic secretions). The poisoned darts are then used for hunting (Myers et al. 1978).

  • Clark, V. C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P., and Fisher, B. L. (2005). ''Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics.'' Proceedings of the National Academy of Sciences, 102(33), 11617-11622.
  • Albuquerque, E. X. and Daly, J. W. (1977). ''Batrachotoxin, a selective probe for channels modulating sodium conductances in electrogenic membranes.'' The Specificity and Action of Animal, Bacterial and Plant Toxins. Receptors and Recognition, Series B., Volume 1 P. Cuatrecasas, eds., Chapman and Hall, London, 297-338.
  • Daly, J. W., Secunda, S. I., Garraffo, H. M., Spande, T. F., Wisnieski, A., and Cover, J. F. (1994). '' An uptake system for dietary alkaloids in poison frogs (Dendrobatidae).'' Toxicon, 32(6), 657-663.
  • Dumbacher, J. P., Spande, T. F., and Daly, J. W. (2000). ''Batrachotoxin alkaloids from passerine birds: A second toxic bird genus (Ifrita kowaldi) from New Guinea.'' Proceedings of the National Academy of Sciences, 97, 12970-12975.
  • Maxson, L. R., and Myers, C. W. (2007). ''Albumin evolution in tropical poison frogs (Dendrobatidae): a preliminary report.'' Biotropica, 17(1), 50-56.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Bosmans, F., Maertensa, C., Verdonck, F., and Tytgat, J. (2004). ''The poison Dart frog’s batrachotoxin modulates Nav 1.8.'' Federation of European Biochemical Societies Letters, 577(2004), 245-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Golden poison frog

The golden poison frog (Phyllobates terribilis),[3] also known as the golden frog, golden poison arrow frog, or golden dart frog, is a poison dart frog endemic to the Pacific coast of Colombia. The optimal habitat of P. terribilis is the rainforest with high rain rates (5 m or more per year), altitudes between 100 and 200 m, temperatures of at least 26°C, and relative humidity of 80–90%. In the wild, P. terribilis is a social animal, living in groups of up to six individuals; however, captive P. terribilis specimens can live in much larger groups. These frogs are often considered innocuous due to their small size and bright colours, but wild frogs are lethally toxic, and may be the most poisonous of any living animal.[4]

Distribution and habitat[edit]

The golden poison frog is endemic to humid forests of the Pacific coast of Colombia in the Cauca and Valle del Cauca Departments.[5] It is only known from primary forest. The eggs are laid on the ground; the males transport the tadpoles to permanent pools.[1]

Poison[edit]

The golden poison frog's skin is densely coated in an alkaloid toxin, one of a number of poisons common to dart frogs (batrachotoxins), which prevents nerves from transmitting impulses, leaving the muscles in an inactive state of contraction. This can lead to heart failure or fibrillation. Some native people use this poison to hunt by coating darts with the frog's poison. Alkaloid batrachotoxins can be stored by frogs for years after the frog is deprived of a food-based source, and such toxins do not readily deteriorate, even when transferred to another surface.[6][7]

The golden poison frog is not venomous, but poisonous: venomous animals have a delivery method for the toxin, such as fangs or spines, while poisonous animals and plants do not have a delivery method and rely on transference of the toxin. Like most poison dart frogs, P. terribilis uses poison only as a self-defense mechanism and not for killing prey. The most venomous animal, in terms of LD50, is the inland taipan, although its venom is less potent than the defensive toxins in P. terribilis.

P. terribilis

The average dose carried will vary between locations, and consequent local diet, but the average wild P. terribilis is generally estimated to contain about one milligram of poison, enough to kill about 10,000 mice. This estimate will vary in turn, but most agree this dose is enough to kill between 10 and 20 humans, which correlates to up to two African bull elephants.[8] This is roughly 15,000 humans per gram.

This extraordinarily lethal poison is very rare. Batrachotoxin is only found[9] in three poisonous frogs from Colombia (genus Phyllobates) and three poisonous birds from Papua New Guinea: Pitohui dichrous, Pitohui kirhocephalus, and Ifrita kowaldi. Other related toxins, histrionicotoxin and pumiliotoxin, are found in frog species from the genus Dendrobates.[10]

The golden poison frog, like most other poisonous frogs, stores its poison in skin glands. Due to their poison, the frogs taste vile to predators; P. terribilis poison kills whatever eats it, except for one snake species, Liophis epinephelus. This snake is resistant to the frog's poison, but is not completely immune.

The poisonous frogs themselves are perhaps the only creatures to be immune to this poison. Batrachotoxin attacks the sodium channels of the cells, but the frog has special sodium channels the poison cannot harm.

Since easily purchased foods are not rich in the alkaloids required to produce batrachotoxins, captive frogs do not produce toxins and they eventually lose their toxicity in captivity. In fact, many hobbyists and herpetologists have reported that most dart frogs will not consume ants at all in captivity, though ants constitute the larger portion of their diets in the wild, likely due to the unavailability of the natural prey species of ants to captive frog keepers. Though all poison frogs lose their toxicity when deprived of certain foods, and captive-bred golden poison frogs are born harmless, a wild-caught poison frog can retain alkaloids for years. It is not clear which prey species supplies the potent alkaloid that gives golden poison frogs their exceptionally high levels of toxicity, or whether the frogs modify another available toxin to produce a more efficient variant, as do some of the frogs from the genus Dendrobates.

Thus, the high toxicity of P. terribilis appears to be due to the consumption of small insects or other arthropods, and one of these may truly be the most poisonous creature on Earth.[8] Scientists have suggested the crucial insect may be a small beetle from the family Melyridae. At least one species of these beetles produces the same toxin found in P. terribilis. Their relatives in Colombian rainforests could be the source of the batrachotoxins found in the highly toxic Phyllobates frogs of that region.[11]

Physical description[edit]

P. terribilis is the largest species of poison dart frog, and can reach a size of 55 mm as adults, with females typically being larger than males. Like all poison dart frogs, the adults are brightly coloured, but they lack the dark spots present in many other dendrobatids. The frog's colour pattern is aposematic (which is a warning pigmentation to warn predators of its toxicity). The frog has tiny adhesive disks on its toes, which aid climbing of plants. It also has a bone plate in the lower jaw, which gives it the appearance of having teeth, a distinctive feature not observed in the other species of Phyllobates. The frog is normally diurnal. P. terribilis occurs in three different colour varieties or morphs:

Mint green[edit]

Mint green morph

The largest morph of P. terribilis exists in the La Brea area of Colombia, and is the most common form seen in captivity. The name "mint green" is actually rather misleading, as the frogs of this morph can be metallic green, pale green, or white.

Yellow[edit]

The yellow morph is the reason it has the common name golden poison dart frog. Yellow P. terribilis specimens are found in Quebrada Guangui, Colombia. These frogs can be pale yellow to deep, golden yellow in colour. A frog sold under the name "gold terribilis" was once believed to be a deeper yellow P. terribilis. However, genetic tests have proven these frogs to be uniform-coloured morphs of Phyllobates bicolor.

Orange[edit]

While not as common as the other two morphs, orange examples of P. terribilis exist in Colombia, as well. They tend to be a metallic orange or yellow-orange in colour, with varying intensity.

Feeding[edit]

The main natural sources of food of P. terribilis are the ants in the genera Brachymyrmex and Paratrechina, but many kinds of insects and other small invertebrates can be eaten, specifically termites and beetles, which can easily be found on the rainforest floor. This frog is considered the most voracious of the dendrobatids.[12]

Captive subadult specimen

In captivity, the frog is fed with Drosophila fruit flies, cochineals, crickets (Gryllidae), the larvae of various insects, and other small, live, invertebrate foods. An adult frog can eat food items much larger in relation to its size than most other dendrobatids. Tadpoles feed on algae, mosquito larvae, and other edible material that may be present in their nursery. Unlike other Phyllobates spp., P. terribilis tadpoles are somewhat versatile feeders.

Poison frog and the indigenous peoples[edit]

P. terribilis is a very important frog to the local indigenous cultures, such as the Choco Emberá people in Colombia's rainforest. The frog is the main source of the poison in the darts used by the natives to hunt their food.

The Emberá people carefully expose the frog to the heat of a fire, and the frog exudes small amounts of poisonous fluid. The tips of arrows and darts are soaked in the fluid, and keep their deadly effect for over two years.[12]

P. terribilis in captivity

Behavior[edit]

P. terribilis is considered to be one of the most intelligent anurans. Like all poison dart frogs, captives can recognize human caregivers after exposure of a few weeks. They are also extremely successful tongue hunters, using their long, adhesive tongues to catch food, and almost never miss a strike. This success at tongue-hunting implies better brainpower and resolution of eyesight than some other frogs.

Golden poison frogs are social animals. Wild specimens typically live in groups of four to seven (average six); captive frogs can be kept in groups of 10 or even 15, although groups that rise past that number are extremely susceptible to aggression and disease.[citation needed] Like all poison dart frogs, they are rarely aggressive towards members of their own species; however, occasional minor squabbles may occur between members of the group.[citation needed] Being immune to their own poison, golden poison frogs interact constantly with each other. They communicate not only with their calls, but also with gestures. Push-up movements are a sign of dominance, while lowered heads seem to signal submission.

Like all members of the genera Phyllobates, Dendrobates, and Ranitomeya, family groups of golden poison dart frogs assemble into large breeding gatherings once or twice per year. While peaceful towards others of their species at other times, the male frogs can be formidably aggressive while competing for a breeding space. Females will remain fairly calm throughout this ordeal. Courtship for the golden poison frog is similar to that of the green and black poison dart frog. Its call consists of a rapid series of high-pitched squeaks. Golden poison frogs are notable for demonstrating tactile courtship during reproduction, each partner stroking its mate's head, back, flanks, and cloacal areas prior to egg deposition. The eggs are fertilized externally.

P. terribilis frogs are dedicated parents. The golden poison frogs lay their eggs on the ground, hidden beneath leaf litter. Once the tadpoles emerge from their eggs, they stick themselves to the mucus on the backs of their parents. The adult frogs carry their young into the canopy, depositing them in the pools of water that accumulate in the centre of bromeliads and water-filled tree holes. The tadpoles feed on algae and mosquito larvae in their nursery. After metamorphosis is complete, parent frogs lead the froglets to an existing group.

Captive care[edit]

Like the other poison dart frogs, P. terribilis is harmless when raised away from its natural food source. They are a popular rainforest vivarium subject, and are somewhat easier to feed than some other dart frogs. Larger species of fruit flies, small crickets, waxworms, small mealworms, termites, and phoenix worms can be used if supplemented with calcium and other minerals. The temperature should be in the low to mid 20s (°C). They are sensitive to high heat and suffer from a condition called "wasting syndrome" if overheated for too long. They require high humidity, as they come from one of the world's most humid rainforests. The Cali Zoo has a captive population of over 50 individuals. They are fed with crickets and share a habitat with several species of Colombian tree frogs.

References[edit]

  1. ^ a b Wilmar Bolívar, Stefan Lötters (2004). "Phyllobates terribilis". IUCN Red List of Threatened Species. Version 2014.2. International Union for Conservation of Nature. Retrieved 6 September 2014. 
  2. ^ Myers, C.W., Daly, J.W. & B. Malkin (1978). "A dangerously toxic new frog (Phyllobates) used by Embera Indians of western Colombia with discussion of blowgun fabrication and dart poisoning". Bulletin of the American Museum of Natural History 161: 307–366. 
  3. ^ Frost, Darrel R. (2014). "Phyllobates terribilis Myers, Daly, and Malkin, 1978". Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History. Retrieved 6 September 2014. 
  4. ^ Dart poison frogs and their toxins The ASA Newsletter 1999
  5. ^ Acosta-Galvis, A.R. (2014). "Phyllobates terribilis Myers, Daly, & Malkin, 1978". Lista de los Anfibios de Colombia V.03.2014. www.batrachia.com. Retrieved 6 September 2014. 
  6. ^ ADW: Phyllobates terribilis: Information
  7. ^ WonderQuest: Most poisonous animal, Contentious ethanol debate, Do fish sleep?
  8. ^ a b Most poisonous creature on earth could be a mystery insect
  9. ^ http://www.chm.bris.ac.uk/motm/batrachotoxin/batrah.htm
  10. ^ Daly, J.W. & Witkop, B. 1971. Chemistry and pharmacology of frog venoms. In Venomous animals and their venoms. Vol II. New York: Academic Press
  11. ^ Most poisonous creature update: mystery solved
  12. ^ a b Atlas Dr. Pez :: Phyllobates terribilis
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!