Overview

Distribution

Range Description

This species is known from the western cordilleras and western Atlantic lowlands of Panama adjacent to south-eastern Costa Rica, and central Panama and the eastern lowlands and cordilleras. It is also present on Isla Colón. In Colombia, it is known from north of the Central and Western Cordillera in the departments of Choco and Antioquia. It has been recorded from 110-1,160m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (1968).  A small frog. Males and females are similarly sized (to about 24 mm), but can be distinguished because males have mottling on the throat whereas females throats are white. The third finger of adult males is swollen.

Dorsal

The dorsal surface is dark brown, bordered on either side by a lighter dorsolateral stripe.

Concealed surfaces

Lateral surface dark except for a light stripe (sometimes fragmented) extending from the groin to halfway to the eye. Rear surface of thighs have two dark marks above and below a central light line.

Extremities

Feet have no webbing between the toes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found on the forest floor and along rocky sections of forest streams in humid lowland and montane forest. The eggs are deposited in leaf-litter, and the adults carry the tadpoles to streams where they develop further.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland forest to 1600 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Colostethus pratti populations are likely beginning to decline east of the Panama Canal due to the spread of chytrid fungus to that region (Woodhams et al 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Tadpole

Tadpoles are pale in color (Savage 1968). Some brown flecks may be present on the dorsal surface (Savage 1968). Mouthparts consist of two upper (one continuous and one partial) and three lower teethrows (Savage 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colostethus pratti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTTGTATTTGGGGCATGGGCCGGAATAGTCGGAACCGCCCTAAGCCTGCTAATTCGAGCAGAATTAAGTCAGCCCGGGTCCTTACTAGGTGAT---GACCAGATCTACAATGTAATTGTTACCGCTCATGCCTTTGTTATAATCTTTTTTATAGTAATACCTATCCTAATCGGGGGCTTTGGTAACTGATTAGTCCCCCTCATAATTGGGGCCCCTGACATGGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTACTCCCTCCATCATTTATCCTCCTTCTAGCGTCCGCAGGTGTAGAAGCTGGAGCCGGCACCGGCTGAACTGTTTATCCCCCTTTGGCCGGCAATCTAGCCCACGCCGGCCCATCAGTGGATTTAACTATTTTTTCCCTTCACCTTGCCGGAGTGTCTTCAATTTTAGGGGCAATCAACTTTATCACTACCACCTTGAATATGAAACCCCCATCCCTAACTCAATACCAAACCCCTTTATTCGTCTGGTCTGTATTAATCACAGCCGTCCTCCTTCTTCTGTCTCTCCCAGTTTTAGCCGCCGGCATCACAATACTCTTAACTGACCGAAATCTGAACACTACTTTCTTTGACCCGGCCGGCGGAGGTGACCCTGTTCTCTACCAACATCTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostethus pratti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor, Martha Patricia Ramírez Pinilla, Mariela Osorno-Muñoz, Jose Vicente Rueda, Adolfo Amézquita, María Cristina Ardila-Robayo

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Agriculture (crops, plantations and livestock), as well as logging, agricultural pollution and the fumigation of crops are major threats to the species’ habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of the species in Colombia includes Parque Nacional Natural Los Katios, and in Panama it is known from a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostethus pratti

Colostethus pratti is a species of frog in the Dendrobatidae family. It is found in the northwestern Colombia (Antioquia, Chocó, Córdoba, and Risaralda Departments) and Panama, possibly also in southeastern Costa Rica.[3][4] It is sometimes known as the Pratt's rocket frog.[3] Colostethus pratti is named after Antwerp Edgar Pratt, an explorer who collected the type series.[2][5]

Description[edit]

Colostethus pratti is a small member of its genus; both males and females grow to about 24 mm (0.94 in) snout–vent length. It is brown above with characteristic dull paired dorsolateral stripes.[2][6]

Reproduction[edit]

Reproduction of Colostethus pratti has been observed in captivity.[7] Males have a loud, peeping advertisement call. They appear to establish small territories and can be aggressive against each other, engaging in "wrestling" bouts. Amplexus has not been observed but is presumably cephalic as in related species. Egg clusters contain 8-20 eggs. They are deposited on top of leaves or within plastic hiding places, primarily during a simulated wet season. Eggs hatch in 1-2 weeks. After hatching, the female transports the tadpoles to a body of water, carrying them on her back, sometimes for several days. No further parental care is provided. Tadpoles metamorphose 8–13 weeks after hatching. Newly-metamorphosed froglets are 6–8 mm (0.24–0.31 in) in length. Some males start calling as soon as six months post-metamorphosis.[7]

Habitat and conservation[edit]

Colostethus pratti is a common frog. Its natural habitats are humid lowland and montane forests where it occurs on the forest floor and along rocky sections of forest streams. Agriculture, logging and pollution are threats to this species, although it is not considered threatened as a species due to its wide distribution and presumably large total population.[1]

References[edit]

  1. ^ a b Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor, Martha Patricia Ramírez Pinilla, Mariela Osorno-Muñoz, Jose Vicente Rueda, Adolfo Amézquita, María Cristina Ardila-Robayo (2004). "Colostethus pratti". IUCN Red List of Threatened Species. Version 2014.3. International Union for Conservation of Nature. Retrieved 3 December 2014. 
  2. ^ a b c Boulenger, G. A. (1899). "Descriptions of new batrachians in the collection of the British Museum (Natural History)". Annals and Magazine of Natural History, Series 7 3: 273–277. 
  3. ^ a b Frost, Darrel R. (2014). "Colostethus pratti (Boulenger, 1899)". Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History. Retrieved 3 December 2014. 
  4. ^ Acosta-Galvis, A.R. (2014). "Colostethus pratti (Boulenger, 1899)". Lista de los Anfibios de Colombia V.04.2014. www.batrachia.com. Retrieved 3 December 2014. 
  5. ^ Beolens, Bo; Watkins, Michael; Grayson, Michael (2013). The Eponym Dictionary of Amphibians. Exeter, England: Pelagic Publishing Ltd. ISBN 978-1-907807-44-2. 
  6. ^ Savage, Jay M. (1968). "The dendrobatid frogs of Central America". Copeia 1968: 745–776. JSTOR 1441845. 
  7. ^ a b Hill, R. L., J. B. Kaylock, R. W. Gagliardo, E. K. Timpe, E. Griffith, and H. Ross (2011). "Observations on the captive reproduction of Colostethus pratti". Herpetological Review 42 (3): 365–367. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!