Overview

Distribution

Range Description

This species is known from the western cordilleras and western Atlantic lowlands of Panama adjacent to south-eastern Costa Rica, and central Panama and the eastern lowlands and cordilleras. It is also present on Isla Colón. In Colombia, it is known from north of the Central and Western Cordillera in the departments of Choco and Antioquia. It has been recorded from 110-1,160m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (1968).  A small frog. Males and females are similarly sized (to about 24 mm), but can be distinguished because males have mottling on the throat whereas females throats are white. The third finger of adult males is swollen.

Dorsal

The dorsal surface is dark brown, bordered on either side by a lighter dorsolateral stripe.

Concealed surfaces

Lateral surface dark except for a light stripe (sometimes fragmented) extending from the groin to halfway to the eye. Rear surface of thighs have two dark marks above and below a central light line.

Extremities

Feet have no webbing between the toes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found on the forest floor and along rocky sections of forest streams in humid lowland and montane forest. The eggs are deposited in leaf-litter, and the adults carry the tadpoles to streams where they develop further.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland forest to 1600 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Colostethus pratti populations are likely beginning to decline east of the Panama Canal due to the spread of chytrid fungus to that region (Woodhams et al 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Tadpole

Tadpoles are pale in color (Savage 1968). Some brown flecks may be present on the dorsal surface (Savage 1968). Mouthparts consist of two upper (one continuous and one partial) and three lower teethrows (Savage 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colostethus pratti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTTGTATTTGGGGCATGGGCCGGAATAGTCGGAACCGCCCTAAGCCTGCTAATTCGAGCAGAATTAAGTCAGCCCGGGTCCTTACTAGGTGAT---GACCAGATCTACAATGTAATTGTTACCGCTCATGCCTTTGTTATAATCTTTTTTATAGTAATACCTATCCTAATCGGGGGCTTTGGTAACTGATTAGTCCCCCTCATAATTGGGGCCCCTGACATGGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTACTCCCTCCATCATTTATCCTCCTTCTAGCGTCCGCAGGTGTAGAAGCTGGAGCCGGCACCGGCTGAACTGTTTATCCCCCTTTGGCCGGCAATCTAGCCCACGCCGGCCCATCAGTGGATTTAACTATTTTTTCCCTTCACCTTGCCGGAGTGTCTTCAATTTTAGGGGCAATCAACTTTATCACTACCACCTTGAATATGAAACCCCCATCCCTAACTCAATACCAAACCCCTTTATTCGTCTGGTCTGTATTAATCACAGCCGTCCTCCTTCTTCTGTCTCTCCCAGTTTTAGCCGCCGGCATCACAATACTCTTAACTGACCGAAATCTGAACACTACTTTCTTTGACCCGGCCGGCGGAGGTGACCCTGTTCTCTACCAACATCTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostethus pratti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor, Martha Patricia Ramírez Pinilla, Mariela Osorno-Muñoz, Jose Vicente Rueda, Adolfo Amézquita, María Cristina Ardila-Robayo

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Agriculture (crops, plantations and livestock), as well as logging, agricultural pollution and the fumigation of crops are major threats to the species’ habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of the species in Colombia includes Parque Nacional Natural Los Katios, and in Panama it is known from a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostethus pratti

Colostethus pratti is a species of frog in the Dendrobatidae family. It is found in Colombia and Panama. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, and rivers. It is threatened by habitat loss.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!