Overview

Brief Summary

Caption

Golden frogs, which exist only in Panama, are a national symbol of this country.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Atelopus zeteki, the Panamanian golden frog, is a small, brightly-colored frog. Adult dry forest males measure 35-40 mm in SVL and weigh 3-5 g; adult dry forest females measure 45-55 mm and weigh 4-7 g. Wet forest males and females are larger; adult males measure 39-48 mm in SVL and weigh 8-12 g, while adult females measure 55-63 mm and weigh 10-15 g (Poole 2006). The head is longer than broad, with a pointed, protuberant snout and rounded canthus rostralis (Savage 2002). The pupil is horizontally elliptical (Savage 1972). There is no tympanum, and the ostia pharyngea are slitlike or absent, implying the lack of other middle ear structures such as the auditory ossicle and middle ear cavity (in common with most other species of Atelopus) (Lindquist and Hetherington 1996). However, standard inner ears with well-developed auditory end organs are present (Savage 2002; Lindquist and Hetherington 1996). The body is slim with long limbs, and the upper surface is smooth with minute spicules; when magnified, the skin takes on a shagreened appearance (Savage 2002; Savage 1972). The fingers are elongate and narrow. The first finger is much shorter than the second, and there is basal webbing between the first and second fingers in atelopid males; the other fingers are free. The undersides of the hands are wrinkled and fleshy, having only a large rounded thenar tubercle but no other tubercles. The toes are extensively webbed with only toe IV substantially free of webbing, and the undersides of the feet are fleshy and wrinkled with smooth subarticular tubercles. No tarsal fold is present, and the inner and outer metatarsal tubercles are moderate, smooth, and rounded, with the inner metatarsal tubercle being larger. Paired elongate vocal slits are present along with a single internal vocal sac in adult atelopid males. Males also have a well-developed brownish nuptial pad on the upper and inner surface of the first finger (Savage 1972).

The sexes have similar coloration, and the coloration is usually uniform golden yellow with one to several large black dorsal markings (Savage 1972). Normally the abdomen is also yellow, but when carrying eggs, the female's ventral surface will have a lighter-colored abdomen (Poole 2006).

At stage 36, the tadpole body length is 5.8 mm, with a body width of 4.3 mm, and total length of 12.2 mm. The larval body is ovoid, with the greatest width at the body midpoint. The body is also depressed, and flattened ventrally, being about 3/5 as high as wide. Nares (nostrils) are small and located closer to the eyes than the tip of the snout. Eyes are dorsal and directed anterodorsolaterally; they are moderately large, nonbulging, and separated by a distance 1.5 times the diameter of the eye. Atelopus zeteki tadpoles are gastromyzophorous, possessing a large sucker that covers the anterior part of the belly and numerous tooth rows. The tadpole mouth is large, ventral, and surrounded by labia forming an unbroken oral disc 3.6 mm wide. The posterior lip has no papillae, while other lips bear a single row of small blunt papillae. The rows are complete and roughly equal in length. Beaks are thin and smooth. A large ventral suctorial disc extends and broadens from the posterior labium. The suctorial disc lacks papillae. On the venter, the spiracle is sinistral, medial, elongate, and directed posteriorly. The vent tube is moderate in length and medial. Caudal musculature is well defined and deep on the anterior half of the tail, narrowing abruptly at midlength and extending nearly to the tip. The tip of the tail is moderately rounded (Lindquist and Hetherington 1998b).

Tadpoles (at least in captivity) are completely white for the first few days post-hatching, developing pigmentation after a few days (Poole 2006). At that point the larval coloration begins to change to dark brown to black dorsally with metallic gold flecks. The venter is pale gray to translucent. Metamorphosing tadpoles (stage 45) have lost the gold flecking and gained small dark green markings against the dark brown dorsum, and are slightly darker than fully metamorphic juveniles (Lindquist and Hetherington 1998b).

Newly metamorphosed froglet size is 6 mm in SVL, in captive-bred frogs (Poole 2006). Recent metamorphs are vivid green with dark black or brown markings, matching the color of mosses growing on stones in or around the stream habitat (Lindquist and Hetherington 1998b). Dorsal markings on the metamorphs always include the following: brick-red warts inside the dorsal markings; a rostral spot or band running transversely, an interorbital "X" from the crest of the eyes to the suprascapular area, a single lumbar chevron with the point towards the anterior of the frog and ending at the flanks, a transverse post-sacral band, and 1-3 lateral bands encircling arms and legs. In addition,the digits sometimes have markings. Palmar and plantar surfaces are also yellow (Lindquist and Hetherington 1998b). The juvenile venter may be either yellow or white, without markings or spotted. If the venter is white, there is a yellow anal patch. Juveniles from El Cope, Panama, had differences in ventral coloration (yellow or white), and it is not known whether this might be sexually dimorphic. In contrast, juveniles at Campana Heights, Panama, had only yellow venters, but were also thought to be older than those observed at El Cope (Lindquist and Hetherington 1998). It is not until the frogs reach older juvenile to subadult age that they undergo ontogenetic color change and acquire the typical yellow or goldenrod overall ground color. In addition, adults that have black patterning have considerably narrower markings than do metamorphic or subadult frogs (Lindquist and Hetherington 1998b), implying that the extent of black marking also changes with age.

Atelopus zeteki is the most toxic species of Atelopus, with the skin of a single individual containing enough toxins to kill 1,200 20g mice (Savage 2002). Zetekitoxin AB, the major alkaloid in Atelopus zeteki's skin extracts, is an analog of saxitoxin and an extremely potent blocker of voltage-dependent sodium channels (Yotsu-Yamashita et al. 2004). Atelopus zeteki is currently the only known amphibian with saxitoxin-analog activity, producing zetekitoxin C as in addition to zekekitoxin AB (Yotsu-Yamashita et al. 2004). It has been hypothesized that zetekitoxin production requires the presence of symbiotic bacteria, as various forms of bacteria (marine, anaerobic, and cyanobacteria) are known to produce saxitoxin (Daly 2004; Yotsu-Yamashita et al. 2004).

This species appears to undergo an ontogenetic change in color, from cryptic green and black coloration in new and recently metamorphosed frogs and juveniles, to aposematic bright yellow, or yellow and black, in subadults and adults. Lindquist and Hetherington (1998b) hypothesized that this may parallel the acquisition of skin toxicity. They reported that metamorphs and young juveniles were secretive, unlike the adults which moved about openly (Lindquist and Hetherington 1998b).

The genus Atelopus, with 113 described and putative species, appears to be the most threatened clade of amphibians. At least 30 species appear to be extinct, having been missing from all known localities for at least 8 years. Only 52 of the surviving species have sufficient data with which to evaluate population trends; of these, 81% (42 of 52) have population sizes that have been reduced by at least half. Higher-elevation species (those living at least 1000 m asl) have been hit the worst, with 75% (21 of 28) having disappeared entirely. Chytridiomycosis is thought to be a primary factor in the decline and disappearance of species in this genus. Habitat loss has occurred within the ranges of many Atelopus species, but does not appear to be a major factor in the decline of most Atelopus species; 22 species declined despite occurring in protected areas. Many Atelopus species are local endemics, putting them at particular risk of extinction, with at least 26 species known only from a single population inhabiting a narrow altitudinal range (La Marca et al. 2005).

Atelopus zeteki is possibly extinct in the wild, with frogs having been removed to captive breeding facilities in 2006, to protect them against possible death from infection with Batrachochytrium dendrobatidis (Bd). The BBC filmed these frogs courting, wrestling, and semaphoring in the wild shortly before removal. The amphibian chytrid fungus (Batrachochytrium dendrobatidis, or Bd) is spreading through Central America, decimating frog populations (Lips et al. 2006), and overtook the study location soon after the filming.

Richards-Zawacki (2010) has shown that behavioral thermoregulation may be an important mechanism by which this species (and possibly other amphibians as well) can combat Bd infection. Body temperatures were collected before and during a Bd epidemic in Panama. Average body temperature was higher during the epidemic, regardless of air temperature, and this influenced the prevalence of chytrid fungal infection (Richards-Zawacki 2010).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • La Marca, E., Lötters, S., Puschendorf, R., Ibáñez, R., Rueda-Almonacid, J. V., Schulte, R., Marty, C., Castro, F., Manzanilla-Puppo, J., García-Pérez, J. E., Bolaños, F., Chaves, G., Pounds, J. A., Toral, E., and Young, B. E. (2005). ''Catastrophic population declines and extinctions in neotropical harlequin frogs (Bufonidae: Atelopus).'' Biotropica, 37(2), 190-201.
  • Daly, J. W. (2004). ''Marine toxins and nonmarine toxins: convergence or symbiotic organisms?'' Journal of Natural Products, 67, 1211-1215.
  • Yotsu-Yamashita, M., Kim, Y.H., Dudley, Jr., S.C., Choudhary, G., Pfahnl, A., Oshima, Y., and Daly, J.W. (2004). ''The structure of zetekitoxin AB, a saxitoxin analog from the Panamanian golden frog Atelopus zeteki: a potent sodium-channel blocker.'' Proceedings of the National Academy of Sciences of the United States of America, 101(13), 4346-4351.
  • Savage, J.M. (1972). ''The harlequin frogs, genus Atelopus, of Costa Rica and western Panama.'' Herpetologica, 28(2), 77-94.
  • Crump, M.L. (1988). ''Aggression in Harlequin Frogs: male-male competition and a possible conflict of interest between the sexes.'' Animal Behaviour, 36(4), 1064-1077.
  • Dunn, E. R. (1933). ''Amphibians and reptiles from El Valle de Anton, Panama.'' Occasional Papers of the Boston Society of Natural History, 8, 65-79.
  • Karraker, N. E., Richards, C. L., and Ross, H. L. (2006). ''Reproductive ecology of Atelopus zeteki and comparisons to other members of the genus.'' Herpetological Review, 37(3), 284-288.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Semaphoring in an earless frog: the origin of a novel visual signal.'' Animal Cognition, 1, 83-87.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Tadpoles and juveniles of the Panamanian Golden Frog, Atelopus zeteki (Bufonidae), with information on development of coloration and patterning.'' Herpetologica, 54(3), 370-376.
  • Lindquist, E. D., and Hetherington, T. E. (1996). ''Field studies on visual and acoustic signaling in the ''earless'' Panamanian Golden Frog, Atelopus zeteki.'' Journal of Herpetology, 30(3), 347-354.
  • Lips, K. R., Brem, F., Brenes, R., Reeve, J. D., Alford, R. A., Voyles, J., Carey, C., Livo, L., Pessier, A. P., and Collins, J. P. (2006). ''Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community.'' Proceedings of the National Academy of Sciences, 103(9), 3165-3170.
  • Poole, V. (2006). Golden Frog Husbandry Manual, 2nd ed. [Internet PDF]. Denver: Denver Zoological Foundation's Project Golden Frog. Retrieved 2 October 2007, from http://www.ranadorada.org/species-info.htm
  • Richards-Zawacki, C. L. (2010). ''Thermoregulatory behaviour affects prevalence of chytrid fungal infection in a wild population of Panamanian golden frogs.'' Proceedings of the Royal Society B, 277, 519-528.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution and Habitat

Atelopus zeteki occurs in western-central Panama, in the Central Cordilleran rainforests and cloudforests (Lindquist and Hetherington 1998b), from 335-1,315 m above sea level (Stuart et al. 2008). They are found associated with montane streams in two habitat types, montane wet forest and montane dry forest. (Poole 2006).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • La Marca, E., Lötters, S., Puschendorf, R., Ibáñez, R., Rueda-Almonacid, J. V., Schulte, R., Marty, C., Castro, F., Manzanilla-Puppo, J., García-Pérez, J. E., Bolaños, F., Chaves, G., Pounds, J. A., Toral, E., and Young, B. E. (2005). ''Catastrophic population declines and extinctions in neotropical harlequin frogs (Bufonidae: Atelopus).'' Biotropica, 37(2), 190-201.
  • Daly, J. W. (2004). ''Marine toxins and nonmarine toxins: convergence or symbiotic organisms?'' Journal of Natural Products, 67, 1211-1215.
  • Yotsu-Yamashita, M., Kim, Y.H., Dudley, Jr., S.C., Choudhary, G., Pfahnl, A., Oshima, Y., and Daly, J.W. (2004). ''The structure of zetekitoxin AB, a saxitoxin analog from the Panamanian golden frog Atelopus zeteki: a potent sodium-channel blocker.'' Proceedings of the National Academy of Sciences of the United States of America, 101(13), 4346-4351.
  • Savage, J.M. (1972). ''The harlequin frogs, genus Atelopus, of Costa Rica and western Panama.'' Herpetologica, 28(2), 77-94.
  • Crump, M.L. (1988). ''Aggression in Harlequin Frogs: male-male competition and a possible conflict of interest between the sexes.'' Animal Behaviour, 36(4), 1064-1077.
  • Dunn, E. R. (1933). ''Amphibians and reptiles from El Valle de Anton, Panama.'' Occasional Papers of the Boston Society of Natural History, 8, 65-79.
  • Karraker, N. E., Richards, C. L., and Ross, H. L. (2006). ''Reproductive ecology of Atelopus zeteki and comparisons to other members of the genus.'' Herpetological Review, 37(3), 284-288.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Semaphoring in an earless frog: the origin of a novel visual signal.'' Animal Cognition, 1, 83-87.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Tadpoles and juveniles of the Panamanian Golden Frog, Atelopus zeteki (Bufonidae), with information on development of coloration and patterning.'' Herpetologica, 54(3), 370-376.
  • Lindquist, E. D., and Hetherington, T. E. (1996). ''Field studies on visual and acoustic signaling in the ''earless'' Panamanian Golden Frog, Atelopus zeteki.'' Journal of Herpetology, 30(3), 347-354.
  • Lips, K. R., Brem, F., Brenes, R., Reeve, J. D., Alford, R. A., Voyles, J., Carey, C., Livo, L., Pessier, A. P., and Collins, J. P. (2006). ''Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community.'' Proceedings of the National Academy of Sciences, 103(9), 3165-3170.
  • Poole, V. (2006). Golden Frog Husbandry Manual, 2nd ed. [Internet PDF]. Denver: Denver Zoological Foundation's Project Golden Frog. Retrieved 2 October 2007, from http://www.ranadorada.org/species-info.htm
  • Richards-Zawacki, C. L. (2010). ''Thermoregulatory behaviour affects prevalence of chytrid fungal infection in a wild population of Panamanian golden frogs.'' Proceedings of the Royal Society B, 277, 519-528.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to Panama, occurring east of the main Tabasará ridge in Provincias Coclé and Panamá at 335-1,315m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Countries

Countries

This species is endemic to Panama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Dorsal

The dorsal surface is bright golden yellow to yellow-orange with or without prominent spots or three irregular black bands.

Eye

Iris greenish-yellow. Pupil horizontal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Atelopus zeteki
Catalog Number: USNM 90892
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89280
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89281
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89283
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89282
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89284
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 90893
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 94393
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89285
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89985
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89286
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89273
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89274
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89275
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89986
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89276
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89277
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89278
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Atelopus zeteki
Catalog Number: USNM 89279
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: El Valle de Anton, Cocl?, Panama
  • Paratype: Dunn, E. R. 1933. Occ. Pap. Boston Soc. Nat. Hist. 8: 71.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a terrestrial species of tropical montane forest, with breeding and larval development taking place in forest streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lowland rainforest [from sea level] to 1315 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Ecology

Ranvestel et al (2004) showed that the abundance and diversity of basal resources (i.e. algae and sediment) and other primary consumers changed when tadpoles, including those of A. zeteki, were excluded from stream reaches. Thus, the loss of tadpoles from stream ecosystems is expected to lead to significant changes in stream characteristics, food web dynamics, and energy flow (Ranvestal et al 2004, Whiles et al 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Behavior and communication

Atelopus zeteki uses thermoregulation to reduce chances of infection with chytrid fungus (Richards-Zawacki 2009). Adults were able to modify their behavior to elevate their body temperatures above normal and above levels generally tolerated by the fungus (Richards-Zawacki 2009).  As in many species of Atelopus, A. zeteki does not have a middle ear. However, they do respond to playbacks of calls, which suggests that are able to hear (Lindquist and Hetherington 1996). Lindquist et al (1998) found that the body wall/lungs may serve as a route of sound transfer in these frogs. Male Panamanian Golden frogs wave their hands and feet at other males. These actions, combined with calling, are signals of aggression and territorial defense. The significance of hand and foot waving, along with calling, as a multimodal signal has been studied in detail by Criswell (2008).  Lindquist et al (2007) explored the nocturnal movements of juveniles and adults by tracking them with flourescent dye. They found that adults move more and to higher resting spots than juveniles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Life History

Breeding season

At one site in Panama, Karraker et al. (2006) found egg masses in December, during the transition from wet to dry season in Panama (Karraker et al 2006). Thus, this population appears to breed explosively, beginning in late November and ending in January (Karraker et al 2006). In other populations, breeding may occur year-round (Richards-Zawacki pers. comm.).

Egg

Cream-colored eggs are attached to rocky substrate in streams (Karraker et al 2006, includes a photograph). Clutch size ranges from about 200-600 eggs (Karraker et al 2006).

Tadpole

Tadpole bodies are dark brown to black with flecks of gold (Lindquist and Hetherington 1998). The ventral surface is grey or colorless (Lindquist and Hetherington 1998). Tadpoles have flattened bodies and a large ventral sucking disc for adhering to rocks in fast-moving streams (Lindquist and Hetherington 1998). An excellent description and illustration of the tadpole can be found in Lindquist and Hetherington (1998).   Tadpoles are typically found motionless on rocks or gravelly substrate in shallow stream pools (Lindquist and Hetherington 1998).

Metamorph juvenile

Metamorphs are a shade of green similar to the moss covering stream side rocks (in El Cope) to bright yellow (in Campana), all with dark markings (Lindquist and Hetherington 1998). The dark markings sometimes contained brick red warts (Lindquist and Hetherington 1998). The ventral surface varies from white to yellow (Lindquist and Hetherington 1998). Metamorphs have been observed in April at one site (Karraker et al 2006), but may be found year-round at other localities (Richards-Zawacki pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolotion

The status of Atelopus zeteki as a species separate from Atelopus varius has been questioned, but recent molecular work suggests that they are in fact distinct lineages (Richards and Knowles 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

The skin of Atelopus zeteki contains tetrodotoxin as well as the unique zetekitoxin (Kim et al 1975). This compound makes this species the most toxic of all the Atelopus (Kim et al. 1977, Pavelka et al. 1977). Juvenile A. zeteki are less conspicuously colored than adults, possibly because they have not yet developed the toxins in their skin (Lindquist and Hetherington 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cell Biology

Karyotype

Karyotype

2N = 22 (Ramos et al 2002)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Atelopus zeteki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTTATCTTCGGGGCATGGGCTGGCATAGTGGGCACAGCTCTAAGTCTATTAATCCGAGCAGAGCTGAGCCAGCCTGGCTCCCTCCTAGGTGAT---GACCAGATTTATAACGTGATCGTCACTGCCCACGCTTTCGTTATAATTTTTTTTATAGTTATGCCAATCTTAATTGGGGGTTTCGGAAATTGACTAGTCCCATTAATAATTGGAGCCCCTGACATAGCATTTCCGCGTATAAACAATATAAGTTTTTGATTACTACCTCCATCTTTTCTACTCCTACTAGCCTCTGCTGGCGTAGAGGCCGGAGCCGGAACAGGTTGAACAGTATACCCACCCCTGGCAGGAAATTTAGCTCACGCAGGTCCATCCGTTGATCTTACCATTTTTTCATTACATTTAGCCGGAGTCTCATCTATTCTTGGAGCTATTAATTTTATCACCACCTCTCTCAATATAAAACCACCCTCCATAACTCAATATCAGACCCCACTATTCGTTTGATCTGTTCTAATTACAGCAGTTCTTCTTCTTTTATCACTTCCAGTTCTTGCAGCCGGTATTACCATACTTTTAACTGATCGAAATCTGAACACAACATTTTTTGACCCTGCAGGCGGAGGAGACCCAGTTTTATACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Atelopus zeteki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ace

Version
3.1

Year Assessed
2010

Assessor/s
Karen Lips, Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Critically Endangered because of an observed drastic decline in population and extent of occurrence, estimated to be more than 80% over the last ten years, probably due to chytridiomycosis.

History
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 2004
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Atelopus zeteki, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Panamanian golden frogs are terrestrial, diurnal forest frogs that generally occur near rapid-flowing small streams (Savage 1972). Occasionally males are heard calling in the forest far from the water, more than 50 m away (Lindquist and Hetherington 1998b). These frogs move by a distinctive ambling walk (Savage 1972), and consume a variety of small invertebrates (Savage 2002). Panamanian golden frogs protect themselves from predators by skin secretions of a unique and potent nerve-poison called zetekitoxin (see Comments section below) (Savage 2002).

In wet forest stream habitats, the frogs are dispersed in and along streams. They can climb and are found up to 3 meters above ground, perching on large moss-covered boulders near waterfalls and along the banks of streams. In contrast, in dry forest stream habitats the frogs are smaller (2/3 the size), distributed mainly over the forest floor, and occur only up to 1.5 meters above ground. The population density of Panamanian Golden Frogs is higher in dry forests than in wet forests (Poole 2006).

Female frogs move into the forests in the late dry and early rainy season (February-March) and return to streams to breed in the late rainy and early dry season (November-January) (Karraker et al. 2006). Males tend to stay in streams year-round establishing territories and waiting for the females to return (Poole 2006). Male frogs perch on rocks in or along the banks of streams and waterfalls, and they defend their territory by semaphoring (hand-waving, plus an unusual form of foot-raising--not foot-flagging, and reorientation) (Lindquist and Hetherington 1996; Lindquist and Hetherington 1998a; Lindquist and Hetherington 1998b). Males also vocalize, but prefer semaphoring over vocalization, apparently due to the noisiness of waterfalls and stream flow in their natural habitat (Lindquist and Hetherington 1996). Females also semaphore in this species, as they do in the related species Atelopus varius (Lindquist and Hetherington 1998a; Crump 1988). There is a male-favored gender bias, resulting in the majority of males being single, and thus all females encountered in streams are amplexed (Poole 2006). Amplexus can last from a few days to two months in captivity (Poole 2006).

Oviposition occurs in wider stream sections along shallow margins, where the water runs quickly and there is slightly lower canopy closure, during periods of lower water flow (Karraker et al. 2006). The mean depth of preferred streams in Karraker et al.'s (2006) study was 16.5 � 15.7 cm, and the mean stream velocity was 0.34 � 0.15 m/s, with a mean water temperature of 23.4�C � 0.8�C. A single string of cream-colored eggs is attached to a rocky stream substrate, which is most often large (such as a boulder or bedrock) (Karraker et al. 2006). Selection of larger substrates in confined channels may reduce the risk of eggs being washed downstream in late rainy season storms (Karraker et al. 2006). The single strand is looped back upon itself, forming two or more layers of eggs in a loose, elongated mass (Karraker et al. 2006). Average clutch size is 370 eggs (ranging from 202-623), with an average ovum diameter of 1.8 mm (Karraker et al. 2006). Clutches are usually found within 2 m of the stream border and are evenly distributed between riffle and run habitats; they are generally placed 1.1 � 1.3 m apart, implying communal oviposition (Karraker et al. 2006). It has been suggested that if this is communal oviposition, it may occur in Atelopus zeteki in order to distribute the risk of predation and to accommodate a lack of suitable oviposition sites (Karraker et al. 2006). In captivity, the embryonic development ranged from 7-11 days at 22.0�C and averaged 8.9 � 1.3 days (Detroit Zoo unpublished cited in Karraker et al. 2006).

Tadpoles are commonly found resting on top of stones and stream gravel at the edges of shallow pools below cascades (Lindquist and Hetherington 1998). Their coloration is similar to the color of the sand, which is the predominant surrounding substrate (Karraker et al. 2006). They may live anywhere along the stream where water pools, as long as the pool is directly connected to flowing channels. They prefer water depths of 5-35 cm (Lindquist and Hetherington 1998b). The development of the larvae takes place with the onset of the wet season, and the possession of a large ventral adhesive disk allows the larvae to remain attached to objects on the bottom of the stream against the torrential current (Savage 1972). However, Karraker et al. (2006) observed that the ventral suctatorial disc of newly hatched Atelopus zeteki larvae is either undeveloped or not yet functional immediately upon hatching. It is not known at what point the disc acquires functionality.

Juveniles were always observed within 2 m of the stream (Lindquist and Hetherington 1998b). Interestingly, although adult males are territorial and do not allow conspecifics other than gravid females to approach, Lindquist and Hetherington (1998b) observed subadults in close proximity and sometimes even touching adult males. However, as soon as significant rainfall began, all juveniles vanished from open streamside areas used by adult males. Lindquist and Hetherington (1998b) hypothesized this might be due to rain triggering territorial defense behavior in adult A. zeteki males.

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • La Marca, E., Lötters, S., Puschendorf, R., Ibáñez, R., Rueda-Almonacid, J. V., Schulte, R., Marty, C., Castro, F., Manzanilla-Puppo, J., García-Pérez, J. E., Bolaños, F., Chaves, G., Pounds, J. A., Toral, E., and Young, B. E. (2005). ''Catastrophic population declines and extinctions in neotropical harlequin frogs (Bufonidae: Atelopus).'' Biotropica, 37(2), 190-201.
  • Daly, J. W. (2004). ''Marine toxins and nonmarine toxins: convergence or symbiotic organisms?'' Journal of Natural Products, 67, 1211-1215.
  • Yotsu-Yamashita, M., Kim, Y.H., Dudley, Jr., S.C., Choudhary, G., Pfahnl, A., Oshima, Y., and Daly, J.W. (2004). ''The structure of zetekitoxin AB, a saxitoxin analog from the Panamanian golden frog Atelopus zeteki: a potent sodium-channel blocker.'' Proceedings of the National Academy of Sciences of the United States of America, 101(13), 4346-4351.
  • Savage, J.M. (1972). ''The harlequin frogs, genus Atelopus, of Costa Rica and western Panama.'' Herpetologica, 28(2), 77-94.
  • Crump, M.L. (1988). ''Aggression in Harlequin Frogs: male-male competition and a possible conflict of interest between the sexes.'' Animal Behaviour, 36(4), 1064-1077.
  • Dunn, E. R. (1933). ''Amphibians and reptiles from El Valle de Anton, Panama.'' Occasional Papers of the Boston Society of Natural History, 8, 65-79.
  • Karraker, N. E., Richards, C. L., and Ross, H. L. (2006). ''Reproductive ecology of Atelopus zeteki and comparisons to other members of the genus.'' Herpetological Review, 37(3), 284-288.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Semaphoring in an earless frog: the origin of a novel visual signal.'' Animal Cognition, 1, 83-87.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Tadpoles and juveniles of the Panamanian Golden Frog, Atelopus zeteki (Bufonidae), with information on development of coloration and patterning.'' Herpetologica, 54(3), 370-376.
  • Lindquist, E. D., and Hetherington, T. E. (1996). ''Field studies on visual and acoustic signaling in the ''earless'' Panamanian Golden Frog, Atelopus zeteki.'' Journal of Herpetology, 30(3), 347-354.
  • Lips, K. R., Brem, F., Brenes, R., Reeve, J. D., Alford, R. A., Voyles, J., Carey, C., Livo, L., Pessier, A. P., and Collins, J. P. (2006). ''Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community.'' Proceedings of the National Academy of Sciences, 103(9), 3165-3170.
  • Poole, V. (2006). Golden Frog Husbandry Manual, 2nd ed. [Internet PDF]. Denver: Denver Zoological Foundation's Project Golden Frog. Retrieved 2 October 2007, from http://www.ranadorada.org/species-info.htm
  • Richards-Zawacki, C. L. (2010). ''Thermoregulatory behaviour affects prevalence of chytrid fungal infection in a wild population of Panamanian golden frogs.'' Proceedings of the Royal Society B, 277, 519-528.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species was reasonably common at a number of localities, and has been recorded as recently as 2005, but it is apparently less abundant north of El Copé, in comparison with observations in 1980. It is very rare or extinct on Cerro Campana. It has been extinct in the El Valle de Antón for approximately 40 years. In recent years, populations have been declining catastrophically due to chytridiomycosis, and the well-known El Copé population collapsed and disappeared over the course of a few months in late 2004 (K. Lips pers. comm.). The chytridiomycosis epidemic appears to be spreading from west to east through Panama, and populations in the eastern part of its range are now at severe risk of disappearing.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Life History, Abundance, Activity, and Special Behaviors

This species has declined in numbers by over 80% over the past decade, most likely due to chytridiomycosis (Stuart et al. 2008). It is also threatened by collection for local zoos and hotels, illegal pet trading, deforestation, and habitat alteration by logging and farming (Poole 2006). Project Golden Frog is an ongoing conservation consortium which connects the Republic of Panama and the United States, in an effort to ensure the survival of this species. Plans for captive breeding in Panama are being supported by Project Golden Frog. Captive breeding programs for this species are already in place at a number of zoos, including the Maryland Zoo in Baltimore, the Houston Zoo, the Denver Zoo, the Detroit Zoo, and the Oakland Zoo.

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • La Marca, E., Lötters, S., Puschendorf, R., Ibáñez, R., Rueda-Almonacid, J. V., Schulte, R., Marty, C., Castro, F., Manzanilla-Puppo, J., García-Pérez, J. E., Bolaños, F., Chaves, G., Pounds, J. A., Toral, E., and Young, B. E. (2005). ''Catastrophic population declines and extinctions in neotropical harlequin frogs (Bufonidae: Atelopus).'' Biotropica, 37(2), 190-201.
  • Daly, J. W. (2004). ''Marine toxins and nonmarine toxins: convergence or symbiotic organisms?'' Journal of Natural Products, 67, 1211-1215.
  • Yotsu-Yamashita, M., Kim, Y.H., Dudley, Jr., S.C., Choudhary, G., Pfahnl, A., Oshima, Y., and Daly, J.W. (2004). ''The structure of zetekitoxin AB, a saxitoxin analog from the Panamanian golden frog Atelopus zeteki: a potent sodium-channel blocker.'' Proceedings of the National Academy of Sciences of the United States of America, 101(13), 4346-4351.
  • Savage, J.M. (1972). ''The harlequin frogs, genus Atelopus, of Costa Rica and western Panama.'' Herpetologica, 28(2), 77-94.
  • Crump, M.L. (1988). ''Aggression in Harlequin Frogs: male-male competition and a possible conflict of interest between the sexes.'' Animal Behaviour, 36(4), 1064-1077.
  • Dunn, E. R. (1933). ''Amphibians and reptiles from El Valle de Anton, Panama.'' Occasional Papers of the Boston Society of Natural History, 8, 65-79.
  • Karraker, N. E., Richards, C. L., and Ross, H. L. (2006). ''Reproductive ecology of Atelopus zeteki and comparisons to other members of the genus.'' Herpetological Review, 37(3), 284-288.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Semaphoring in an earless frog: the origin of a novel visual signal.'' Animal Cognition, 1, 83-87.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Tadpoles and juveniles of the Panamanian Golden Frog, Atelopus zeteki (Bufonidae), with information on development of coloration and patterning.'' Herpetologica, 54(3), 370-376.
  • Lindquist, E. D., and Hetherington, T. E. (1996). ''Field studies on visual and acoustic signaling in the ''earless'' Panamanian Golden Frog, Atelopus zeteki.'' Journal of Herpetology, 30(3), 347-354.
  • Lips, K. R., Brem, F., Brenes, R., Reeve, J. D., Alford, R. A., Voyles, J., Carey, C., Livo, L., Pessier, A. P., and Collins, J. P. (2006). ''Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community.'' Proceedings of the National Academy of Sciences, 103(9), 3165-3170.
  • Poole, V. (2006). Golden Frog Husbandry Manual, 2nd ed. [Internet PDF]. Denver: Denver Zoological Foundation's Project Golden Frog. Retrieved 2 October 2007, from http://www.ranadorada.org/species-info.htm
  • Richards-Zawacki, C. L. (2010). ''Thermoregulatory behaviour affects prevalence of chytrid fungal infection in a wild population of Panamanian golden frogs.'' Proceedings of the Royal Society B, 277, 519-528.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The major threat is likely to be chytridiomycosis, which has led to catastrophic population declines in many other species of montane Atelopus. The deforestation of habitat for both agriculture and general infrastructure development, water pollution, and over collection for the pet trade are also threats to this species. In 2003, a road from Sorá to El Valle was opened along the ridge of the Cordillera Central, resulting in heavy sedimentation of most streams on the Pacific and Caribbean slopes, which has negatively affected a significant portion of the habitat used by this species (R. Ibañez, in litt. to E. La Marca).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected in Panama by national legislation (as Atelopus varius zeteki) decree No. 23 of January 30, 1967. It has been recorded from the protected areas of Parque Nacional Altos de Campana and Parque Nacional Omar Torrijos Herrera. A successful captive-breeding programme involving many zoos in North America is in place, although no re-introductions will be made until existing threats can be addressed. An ex-situ population of this species is held at the El Valle Amphibian Conservation Center in Panama; eggs and/or larvae have been produced to date (Edgardo Griffith pers. comm. September 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

Atelopus zeteki is the Panamanian national animal. As a cultural symbol, it represents good fortune and is frequently shown on lottery tickets. Panamanian golden frogs are often captured and used to promote hotels, restaurants, and tourism. They were revered by Pre-Columbian indigenous people and images of this frog were crafted in gold and clay talismans called huacas (Poole 2006).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • La Marca, E., Lötters, S., Puschendorf, R., Ibáñez, R., Rueda-Almonacid, J. V., Schulte, R., Marty, C., Castro, F., Manzanilla-Puppo, J., García-Pérez, J. E., Bolaños, F., Chaves, G., Pounds, J. A., Toral, E., and Young, B. E. (2005). ''Catastrophic population declines and extinctions in neotropical harlequin frogs (Bufonidae: Atelopus).'' Biotropica, 37(2), 190-201.
  • Daly, J. W. (2004). ''Marine toxins and nonmarine toxins: convergence or symbiotic organisms?'' Journal of Natural Products, 67, 1211-1215.
  • Yotsu-Yamashita, M., Kim, Y.H., Dudley, Jr., S.C., Choudhary, G., Pfahnl, A., Oshima, Y., and Daly, J.W. (2004). ''The structure of zetekitoxin AB, a saxitoxin analog from the Panamanian golden frog Atelopus zeteki: a potent sodium-channel blocker.'' Proceedings of the National Academy of Sciences of the United States of America, 101(13), 4346-4351.
  • Savage, J.M. (1972). ''The harlequin frogs, genus Atelopus, of Costa Rica and western Panama.'' Herpetologica, 28(2), 77-94.
  • Crump, M.L. (1988). ''Aggression in Harlequin Frogs: male-male competition and a possible conflict of interest between the sexes.'' Animal Behaviour, 36(4), 1064-1077.
  • Dunn, E. R. (1933). ''Amphibians and reptiles from El Valle de Anton, Panama.'' Occasional Papers of the Boston Society of Natural History, 8, 65-79.
  • Karraker, N. E., Richards, C. L., and Ross, H. L. (2006). ''Reproductive ecology of Atelopus zeteki and comparisons to other members of the genus.'' Herpetological Review, 37(3), 284-288.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Semaphoring in an earless frog: the origin of a novel visual signal.'' Animal Cognition, 1, 83-87.
  • Lindquist, E. D. and Hetherington, T. E. (1998). ''Tadpoles and juveniles of the Panamanian Golden Frog, Atelopus zeteki (Bufonidae), with information on development of coloration and patterning.'' Herpetologica, 54(3), 370-376.
  • Lindquist, E. D., and Hetherington, T. E. (1996). ''Field studies on visual and acoustic signaling in the ''earless'' Panamanian Golden Frog, Atelopus zeteki.'' Journal of Herpetology, 30(3), 347-354.
  • Lips, K. R., Brem, F., Brenes, R., Reeve, J. D., Alford, R. A., Voyles, J., Carey, C., Livo, L., Pessier, A. P., and Collins, J. P. (2006). ''Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community.'' Proceedings of the National Academy of Sciences, 103(9), 3165-3170.
  • Poole, V. (2006). Golden Frog Husbandry Manual, 2nd ed. [Internet PDF]. Denver: Denver Zoological Foundation's Project Golden Frog. Retrieved 2 October 2007, from http://www.ranadorada.org/species-info.htm
  • Richards-Zawacki, C. L. (2010). ''Thermoregulatory behaviour affects prevalence of chytrid fungal infection in a wild population of Panamanian golden frogs.'' Proceedings of the Royal Society B, 277, 519-528.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Panamanian golden frog

The Panamanian golden frog (Atelopus zeteki) is a rare species of toad which is endemic to Panama. It has been considered a subspecies of A. varius, but is now generally regarded as a separate species.[1] The IUCN lists it as critically endangered.[2] Individuals have been collected for breeding in captivity in a bid to preserve the species.

Contents

Description [edit]

Despite its common name, the Panamanian golden frog is a true toad. Like some other frogs and toads, the golden frog is capable of secreting poison to help protect itself from predators. In the case of the golden frog, this is a water-soluble neurotoxin called zetekitoxin.[3]

In dry habitat, the adult male measures 35 millimetres (1.4 in) to 40 millimetres (1.6 in) and weighs 3 grams (0.11 oz) to 5 grams (0.18 oz). The adult female ranges from 45 to 55 mm and from 4 to 7 g. It is larger in wet forests, where the male can grow to 48 mm and weigh up to 12 g, and the female can be as large as 63 mm and weigh up to 15 g.[4] The toad inhabits tropical forest regions, particularly on mountains, near streams.[3]

Reproduction [edit]

"Semaphore" behavior at the National Zoo in Washington D.C.[5]

This toad is unusual in that it communicates by a form of semaphore, waving at rivals and prospective mates, in addition to the sounds more usual among frogs. This adaptation is thought to have evolved in the golden frog because of the noise of the fast-moving streams which formed its natural habitat.[6] The male tends to stay near the streams where breeding occurs, while in the non-breeding season the female retreats into the forests. The male uses a soft call to entice prospective mates, then grabs the female and hangs on when she crosses his path. If she is receptive, she will tolerate amplexus; if not she will attempt to buck him off by arching her spine.[citation needed]

Amplexus can last from a few days to a couple of months, with ovipositioning usually taking place in a shallow stream.[3] Tadpoles emerge from the eggs after 2 to 10 days and bury themselves into crevices where they remain for up to two weeks. They develop black and gold coloration as melanin floods their dermal layers, giving the larvae protection from the sun. The larvae feed on algae until they metamorphose.[citation needed]

Behavior [edit]

The golden frog appears to socialize with other amphibians using sounds from the throat and hand-waving, like the semaphore motion used in courtship. The movements may be friendly or aggressive warnings.[6]

A Panamanian golden frog at the Buffalo Zoo.

Conservation [edit]

The species was filmed for the last time in the wild in 2007 by the BBC Natural History Unit for the series Life in Cold Blood by David Attenborough. The remaining few specimens were taken into captivity and the location of filming was kept secret to protect them from potential poachers.

Populations of amphibians, including the golden frog, suffered major declines possibly due to the fungal infection chytridiomycosis. The infection is caused by an invasive fungal pathogen that reached El Valle, the home of the Panamanian golden frog in 2006.[7] Additional factors, such as habitat loss and pollution, may have also played a role.[3]

"Project Golden Frog" is a conservation project involving scientific, educational, and zoological institutions in the Republic of Panama and the United States. The intended outcomes of this project include greater understanding of the golden frog, coordinated conservation effort by governmental agencies and non-governmental organizations, heightened awareness of current global amphibian declines, greater respect for wildlife among Panamanians and global citizens, and greater land preservation for threatened and endangered species throughout the world. This organization will use education, field studies, producing offspring through the already captive toads, and offering financial support to help preserve these toads.[8]

In culture [edit]

The Panamanian golden frog is something of a national symbol, appearing on state lottery tickets and in local mythology. It is thought that when the toad dies it turns to gold. It is believed that the toad brings good luck to those fortunate enough to see it. In 2010, the Panamanian government passed legislation recognizing August 14 as National Golden Frog Day. The main celebration event is marked annually by a parade in the streets of El Valle de Anton, and a display of golden frogs at the El Valle Amphibian Conservation Center in the El Nispero Zoo, El Valle.[9]

See also [edit]

References [edit]

  1. ^ Savage, J.M. 2002. The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago. ISBN 0-226-73537-0
  2. ^ Lips, K., et al. 2010. Atelopus zeteki. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 28 May 2013.
  3. ^ a b c d Atelopus zeteki. AmphibiaWeb.
  4. ^ San Diego Zoo website: sandiegozoo.org
  5. ^ Nationalzoo.si.edu
  6. ^ a b 'Last wave' for wild golden frog. BBC News Online. 2 February 2008.
  7. ^ "Panama Amphibian Conservation Timeline". Panama Amphibian Rescue and Conservation Project. Retrieved 2009-09-13. 
  8. ^ Ranadorada.org
  9. ^ Happy First Annual National Golden Frog Day! Panama Amphibian Rescue and Conservation Project, 2010 Accessed September 28, 2010
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!