Overview

Brief Summary

Caption

Agalychnis callidryas embryos hatch early to escape a wide variety of egg-stage risks, including snake and wasp predation, fungal infection, and oxygen deprivation (Warkentin 1995, Warkentin 2000, Warkentin et al. 2001, Warkentin 2002).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Agalychnis callidryas, the red-eyed tree frog, is a slender, colorful, medium-sized frog. Females measure up to 77 mm, and males to 59 mm (Savage 2002). This frog has leaf-green to dark green dorsal surfaces; dark blue, purple, or brownish flanks, with cream-colored or yellow vertical or diagonal bars; blue or orange upper arms; thighs that are blue or orange on the anterior, posterior, and ventral surfaces; orange hands and feet, except for the outermost digits on each; a white ventrum; and protuberant red eyes, with vertical pupils (Savage 2002; Leenders 2001; Duellman 2001). The back is sometimes marked with faint tranverse darker green lines (especially in individuals from Nicaragua or Costa Rica) or small white dots (Duellman 2001). The average number of bars on the flanks increases in populations from north to south, with a mean of 5.0 bars in Mexico and a mean of 9.0 bars in Panama (Duellman 2001). In some populations from the middle part of the range (Nicaragua and Costa Rica, on the Caribbean side), there is often a continuous, longitudinal yellowish stripe connecting the upper ends of the vertical bars and separating the blue flanks from the green dorsum (Duellman 2001).

The skin is smooth both dorsally and ventrally (Savage 2002). Agalychnis callidryas has a rounded head and a truncated snout when viewed from above (Duellman 2001). Eyes are large and directed sideways (Leenders 2001). When this frog closes its eyes, transparent lower eyelids marked with a network of gold are apparent (Leenders 2001). It has distinct tympana (Savage 2002). The body is slender and somewhat flattened (Leenders 2001). Fingers are short, about one-half webbed, and have moderately large discs (Duellman 2001). The toes are short, about two-thirds webbed, and also have moderately large discs that are nearly as large as those on the fingers, with a narrow fold running from the heel to the disc of the fifth toe (Duellman 2001; Savage 2002). Adult males have paired vocal slits and a single internal median subgular vocal sac, as well as a grayish brown spinose nuptial pad at the base of each thumb (Savage 2002).

Young froglets (at least from Panama) are able to change color; they are green by day and change to purplish or reddish brown at night (Pyburn 1963). In addition, young froglets have yellow rather than red eyes, and have lighter-colored flanks lacking whitish bars (Pyburn 1963). The red eye coloration appears first at the periphery of the eye at about two weeks post-metamorphosis, and over a period of several days spreads inward to make the iris wholly red (Starrett 1960).

Agalychnis callidryas tadpoles are large, with a robust body that can measure 48 mm in total length at stage 34 (Savage 2002). The tail and caudal fins are moderately sized, with the tail tip narrowing to a thin flagellum (Savage 2002). The spiracle is sinistral and lateroventral, while the vent is dextral (Savage 2002). Eyes and nostrils are dorsolateral (Savage 2002). The mouth is anteroventral, with a small and complete oral disk, serrated beaks, and two upper plus three lower rows of denticles (Savage 2002; Duellman 2001). The row of denticles just above the mouth has a small gap medially (Savage 2002). Labial papillae are present on the lower lip in one to three rows lateral and ventral to the mouth, and on the upper lip in one to two rows lateral to the mouth, but lacking directly above the mouth (Duellman 2001). The tadpole body is olive gray dorsally, shading into a bluish gray speckled with olive-brown on the sides and undersides (Duellman 2001). Larval caudal musculature is a light grayish brown while the caudal fins are transparent, but both are speckled with dark gray (Duellman 2001).

The diploid number of chromosomes is 26 for Agalychnis callidryas (Duellman and Cole 1965).

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

  • Briggs, V. S. (2008). ''Mating patterns of red-eyed treefrogs, Agalychnis callidryas and A. moreletii.'' Ethology, 114, 489-498.
  • Caldwell, M. S., Johnston, G. R., McDaniel, J. G., and Warkentin, K. M. (2010). ''Vibrational signaling in the agonistic interactions of red-eyed treefrogs.'' Current Biology, doi:10.1016/j.cub.2010.03.069.
  • Cope, E. D. (1862). ''Catalogue of the reptiles obtained during the explorations of the Parana, Paraguay, Vermejo, and Uruguay Rivers, by Captain Thos. J. Page, U.S.N., and of those procured by Lieut. N. Michler, U.S. Top. Eng., Commander of the expedition conducting the survey.'' Proceedings of the Academy of Natural Sciences of Philadelphia, 14, 346-359.
  • D'Orgeix, C. A., and Turner, B. J. (1995). ''Multiple paternity in the red-eyed treefrog Agalychnis callidryas (Cope).'' Molecular Ecology, 4, 505-508.
  • Donnelly, M., and Guyer, C. (1994). ''Patterns of reproduction and habitat use in an assemblage of Neotropical hylid frogs.'' Oecologia, 98, 291-302.
  • Dudley, R., King, V. A., and Wassersug, R. J. (1991). ''The implications of shape and metamorphosis for drag forces on a generalized pond tadpole (Rana catesbeiana).'' Copeia, 1991, 252-257.
  • Duellman, W. E. (1967). ''Courtship isolating mechanisms in Costa Rican hylid frogs.'' Herpetologica, 23(3), 169-183.
  • Duellman, W. E. (1963). ''Amphibians and reptiles of the rainforest of southern El Petén, Guatemala.'' University of Kansas Publications, Museum of Natural History, 15, 205-249.
  • Duellman, W. E. (2001). The Hylid Frogs of Middle America. Society for the Study of Amphibians and Reptiles, Ithaca, New York.
  • Duellman, W. E., and Cole, C. J. (1965). ''Studies of chromosomes of some anuran amphibians.'' Systematic Zoology, 14(2), 139-143.
  • Fouquette, M. J., Jr. (1968). ''Some hylid frogs of the Canal Zone, with special reference to call structure.'' Caribbean Journal of Science, 6(3-4), 167-172.
  • Gray, L. A., and Nishikawa, K.C. (1995). ''Feeding kinematics of phyllomedusine tree frogs.'' The Journal of Experimental Biology, 198, 457-463.
  • Gray, L. A., and Rand, A. S. (1997). ''A daybreak chorus in the frog, Agalychnis callidryas.'' Journal of Herpetology, 31(3), 440-441.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • McCranie, J. R., Wilson, L. D., and Townsend, J. H. (2003). ''Agalychnis callidryas (Red-eyed Treefrog). Reproduction.'' Herpetological Review, 34(1), 43.
  • Mignogna, G., Severina, C., Erspamer, G. F., Siciliano, R., Kreil, G., and Barra, D. (1997). ''Tachykinins and other biologically active peptides from the skin of the Costa Rican phyllomedusid frog Agalychnis callidryas.'' Peptides, 18(3), 367-372.
  • Pyburn, W. F. (1963). ''Observations on the life history of the treefrog, Phyllomedusa callidryas (Cope).'' Texas Journal of Science, 15, 155-170.
  • Pyburn, W. F. (1964). ''Breeding behavior of the leaf-frog, Phyllomedusa callidryas, in southern Veracruz.'' The American Philosophical Society Yearbook, 1964, 291-294.
  • Pyburn, W. F. (1970). ''Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico.'' Copeia, 2, 209-218.
  • Roberts, W. E. (1994). ''Explosive breeding aggregations and parachuting in a neotropical frog, Agalychnis saltator (Hylidae).'' Journal of Herpetology, 28(2), 193-199.
  • Ruiz-Carranza, P.M., Ardila-Robayo, M.C., and Lynch, J.D (1996). ''Lista actualizada de la fauna de Amphibia de Colombia.'' Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20(77), 365-415.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Shi, Y-B. (2000). Amphibian Metamorphosis: From Morphology to Molecular Biology. Wiley-Liss, Inc., New York.
  • Starrett, P. (1960). ''Descriptions of tadpoles of Middle American frogs.'' Miscellaneous Publications Museum of Zoology, University of Michigan, 110, 5-37.
  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Valerio, C.E. (1971). ''Ability of some tropical tadpoles to survive without water.'' Copeia, 1971(2), 364-365.
  • Vonesh, J. R., and Warkentin, K. M. (2006). ''Opposite shifts in size at metamorphosis in response to larval and metamorph predators.'' Ecology, 87(3), 556-562.
  • Warkentin, K. M. (1995). ''Adaptive plasticity in hatching age: A response to predation risk trade-offs.'' Proceedings of the National Academy of Sciences, 92, 3507-3510.
  • Warkentin, K. M. (2000). ''Environmental and developmental effects on external gill loss in the Red-Eyed Tree Frog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 73(5), 557-565.
  • Warkentin, K. M. (2000). ''Wasp predation and wasp-induced hatching of red-eyed treefrog eggs.'' Animal Behavior, 60, 503-510.
  • Warkentin, K. M. (2002). ''Hatching timing, O2 availability and external gill regression in the treefrog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 75, 155-164.
  • Warkentin, K. M. (2005). ''How do embryos assess risk? Vibrational cues in predator-induced hatching of red-eyed treefrogs.'' Animal Behavior, 70, 59-71.
  • Warkentin, K. M., Buckley, C. R., and Metcalf, K. A. (2006). ''Development of red-eyed treefrog eggs affects efficiency and choices of egg-foraging wasps.'' Animal Behavior, 71, 417-425.
  • Warkentin, K. M., Caldwell, M. S., Siok, T. D., D'Amato, A. T., and McDaniel, J. G. (2007). ''Flexible information sampling in vibrational assessment of predation risk by red-eyed treefrog embryos.'' The Journal of Experimental Biology, 210, 614-619.
  • Warkentin, K. M., Caldwell, M. S., and McDaniel, J. G. (2006). ''Temporal pattern cues in vibrational risk assessment by embryos of the red-eyed treefrog, Agalychnis callidryas.'' Journal of Experimental Biology, 209, 1376-1384.
  • Warkentin, K. M., Currie, C. R., and Rehner, S. A. (2001). ''Egg-killing fungus induces early hatching of red-eyed treefrog eggs.'' Ecology, 82(10), 2860-2869.
  • Warkentin, K. M., and Wassersug, R. J. (2001). ''Do prostaglandins regulate external gill regression in anurans?'' Journal of Experimental Zoology, 289, 366-373.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Agalychnis callidryas can be found throughout most of Central America, as far north as southern Mexico.

(Abernathy and Abernathy, 1996)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found on the Atlantic slopes and lowlands from southern Veracruz and northern Oaxaca in Mexico, south-eastward to northern Honduras and continuing on to the Caribbean slope to Panama. There is also an isolated record from the Cartagena Botanic Garden in northern Colombia. Its altitudinal range is from sea level up to 1,250m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Red-eyed tree frogs are distributed from Mexico (Yucatán) to Panama, with an isolated report from the Cartagena Botanic Gardens in Colombia (Savage 2002; Ruiz-Carranza et al. 1996). They inhabit humid forests, primarily in lowlands and sometimes on premontane slopes up to 1,250 m (Leenders 2001).

  • Briggs, V. S. (2008). ''Mating patterns of red-eyed treefrogs, Agalychnis callidryas and A. moreletii.'' Ethology, 114, 489-498.
  • Caldwell, M. S., Johnston, G. R., McDaniel, J. G., and Warkentin, K. M. (2010). ''Vibrational signaling in the agonistic interactions of red-eyed treefrogs.'' Current Biology, doi:10.1016/j.cub.2010.03.069.
  • Cope, E. D. (1862). ''Catalogue of the reptiles obtained during the explorations of the Parana, Paraguay, Vermejo, and Uruguay Rivers, by Captain Thos. J. Page, U.S.N., and of those procured by Lieut. N. Michler, U.S. Top. Eng., Commander of the expedition conducting the survey.'' Proceedings of the Academy of Natural Sciences of Philadelphia, 14, 346-359.
  • D'Orgeix, C. A., and Turner, B. J. (1995). ''Multiple paternity in the red-eyed treefrog Agalychnis callidryas (Cope).'' Molecular Ecology, 4, 505-508.
  • Donnelly, M., and Guyer, C. (1994). ''Patterns of reproduction and habitat use in an assemblage of Neotropical hylid frogs.'' Oecologia, 98, 291-302.
  • Dudley, R., King, V. A., and Wassersug, R. J. (1991). ''The implications of shape and metamorphosis for drag forces on a generalized pond tadpole (Rana catesbeiana).'' Copeia, 1991, 252-257.
  • Duellman, W. E. (1967). ''Courtship isolating mechanisms in Costa Rican hylid frogs.'' Herpetologica, 23(3), 169-183.
  • Duellman, W. E. (1963). ''Amphibians and reptiles of the rainforest of southern El Petén, Guatemala.'' University of Kansas Publications, Museum of Natural History, 15, 205-249.
  • Duellman, W. E. (2001). The Hylid Frogs of Middle America. Society for the Study of Amphibians and Reptiles, Ithaca, New York.
  • Duellman, W. E., and Cole, C. J. (1965). ''Studies of chromosomes of some anuran amphibians.'' Systematic Zoology, 14(2), 139-143.
  • Fouquette, M. J., Jr. (1968). ''Some hylid frogs of the Canal Zone, with special reference to call structure.'' Caribbean Journal of Science, 6(3-4), 167-172.
  • Gray, L. A., and Nishikawa, K.C. (1995). ''Feeding kinematics of phyllomedusine tree frogs.'' The Journal of Experimental Biology, 198, 457-463.
  • Gray, L. A., and Rand, A. S. (1997). ''A daybreak chorus in the frog, Agalychnis callidryas.'' Journal of Herpetology, 31(3), 440-441.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • McCranie, J. R., Wilson, L. D., and Townsend, J. H. (2003). ''Agalychnis callidryas (Red-eyed Treefrog). Reproduction.'' Herpetological Review, 34(1), 43.
  • Mignogna, G., Severina, C., Erspamer, G. F., Siciliano, R., Kreil, G., and Barra, D. (1997). ''Tachykinins and other biologically active peptides from the skin of the Costa Rican phyllomedusid frog Agalychnis callidryas.'' Peptides, 18(3), 367-372.
  • Pyburn, W. F. (1963). ''Observations on the life history of the treefrog, Phyllomedusa callidryas (Cope).'' Texas Journal of Science, 15, 155-170.
  • Pyburn, W. F. (1964). ''Breeding behavior of the leaf-frog, Phyllomedusa callidryas, in southern Veracruz.'' The American Philosophical Society Yearbook, 1964, 291-294.
  • Pyburn, W. F. (1970). ''Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico.'' Copeia, 2, 209-218.
  • Roberts, W. E. (1994). ''Explosive breeding aggregations and parachuting in a neotropical frog, Agalychnis saltator (Hylidae).'' Journal of Herpetology, 28(2), 193-199.
  • Ruiz-Carranza, P.M., Ardila-Robayo, M.C., and Lynch, J.D (1996). ''Lista actualizada de la fauna de Amphibia de Colombia.'' Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20(77), 365-415.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Shi, Y-B. (2000). Amphibian Metamorphosis: From Morphology to Molecular Biology. Wiley-Liss, Inc., New York.
  • Starrett, P. (1960). ''Descriptions of tadpoles of Middle American frogs.'' Miscellaneous Publications Museum of Zoology, University of Michigan, 110, 5-37.
  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Valerio, C.E. (1971). ''Ability of some tropical tadpoles to survive without water.'' Copeia, 1971(2), 364-365.
  • Vonesh, J. R., and Warkentin, K. M. (2006). ''Opposite shifts in size at metamorphosis in response to larval and metamorph predators.'' Ecology, 87(3), 556-562.
  • Warkentin, K. M. (1995). ''Adaptive plasticity in hatching age: A response to predation risk trade-offs.'' Proceedings of the National Academy of Sciences, 92, 3507-3510.
  • Warkentin, K. M. (2000). ''Environmental and developmental effects on external gill loss in the Red-Eyed Tree Frog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 73(5), 557-565.
  • Warkentin, K. M. (2000). ''Wasp predation and wasp-induced hatching of red-eyed treefrog eggs.'' Animal Behavior, 60, 503-510.
  • Warkentin, K. M. (2002). ''Hatching timing, O2 availability and external gill regression in the treefrog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 75, 155-164.
  • Warkentin, K. M. (2005). ''How do embryos assess risk? Vibrational cues in predator-induced hatching of red-eyed treefrogs.'' Animal Behavior, 70, 59-71.
  • Warkentin, K. M., Buckley, C. R., and Metcalf, K. A. (2006). ''Development of red-eyed treefrog eggs affects efficiency and choices of egg-foraging wasps.'' Animal Behavior, 71, 417-425.
  • Warkentin, K. M., Caldwell, M. S., Siok, T. D., D'Amato, A. T., and McDaniel, J. G. (2007). ''Flexible information sampling in vibrational assessment of predation risk by red-eyed treefrog embryos.'' The Journal of Experimental Biology, 210, 614-619.
  • Warkentin, K. M., Caldwell, M. S., and McDaniel, J. G. (2006). ''Temporal pattern cues in vibrational risk assessment by embryos of the red-eyed treefrog, Agalychnis callidryas.'' Journal of Experimental Biology, 209, 1376-1384.
  • Warkentin, K. M., Currie, C. R., and Rehner, S. A. (2001). ''Egg-killing fungus induces early hatching of red-eyed treefrog eggs.'' Ecology, 82(10), 2860-2869.
  • Warkentin, K. M., and Wassersug, R. J. (2001). ''Do prostaglandins regulate external gill regression in anurans?'' Journal of Experimental Zoology, 289, 366-373.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Belize, Columbia, Costa Rica, Ecuador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Columbia

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Agalychnis callidryas are known foremost for their huge, bright red eyes, a possible adaption to nocturnality or the central component of a defensive strategy called startle coloration. Their dorsal area is usually a neon-like shade of green, but can sometimes range from blue to yellow in coloring. The sides are light blue with cream to yellow colored stripes. The upper legs are bright blue, and the feet are a bright orange or red. Agalychnis callidryas have large, specially developed suction cup toe pads, which allow them to attach to leaves, branches, and the sides of trees.

Young A. callidryas start out brown in coloring and change to green as they mature to adult frogs.

Male A. callidryas are generally smaller than the females, the males reaching an adult length of about 2 inches, and the females reaching and adult length of as much as 3 inches.

Adult A. callidryas can change their color to a darker green or reddish-brown as their mood changes.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Identification

Adult

Species description based on Ibanez et al (1999), Duellman (2001), and Savage (2002).  Moderately-sized green treefrog with very slender arms and legs. Males are smaller than females: males to 56 mm; females to 71 mm.

Dorsal

Bright to dark green. The dorsal skin is smooth, but may have one to many slightly raised white spots.

Concealed surfaces

Concealed portions of the thigh are orange or sometimes blue.

Distinguishing characteristics

Agalychnis callidryas has dark blue to purple flanks with vertical bars that range in color from cream to yellow. The width and number of vertical bars varies greatly.

Eye

Iris bright red. Pupil vertical. Palpebral membrane has pale to bright yellow reticulations.

Extremities

Hands and feet moderately webbed. Toes with large terminal discs. Hands and feet are mostly orange.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Agalychnis callidryas
Catalog Number: USNM 13737
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1883
Locality: No Further Locality Data, Nicaragua
  • Holotype: Cope, E. D. 1884. Proc. Amer. Philos. Soc. 22 (118): 182.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Agalychnis callidryas inhabit tropical rainforest areas, where they are commonly found in the lowland rainforests and surrounding hills, particularly in areas close to rivers.

They prefer temperatures between 75-85 degrees during the day, between 66-77 degrees during the nighttime, and humidity at around 80%-100%.

Red-eyed tree frogs are excellent climbers and, as mentioned before, have suction-cup toes that help them attach themselves to the underside of leaves, where they rest during the day. They can also be found clinging to branches, tree trunks, and leaves throughout their habitat. Red-eyed tree frogs are also able to swim.

(Abernathy and Abernathy, 1996)

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits tropical lowland and montane forest, where there is a continuous forest cover. The presence of temporary or permanent ponds is important for its reproduction. It can live in secondary forest, and even very heavily degraded areas as long as there is a tree close to a pond (Federico Bolaños pers. comm.). It does well in areas where there has been selective logging.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Humid, lowland forest to less than 1000 m (Duellman 1970).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Agalychnis callidryas are carnivorous and feed primarily at night. The red-eyed tree frog's green coloring permits it to stay hidden among the leaves of trees, waiting for insects or other small animals to come their way. Agalychnis callidryas eat any type of insect that fits into their mouth, but their usual diet is composed of crickets, moths, flies, grasshoppers, and sometimes even smaller frogs. As babies they feed on fruit flies and pinhead crickets.

(Abernathy and Abernathy, 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Diet

Adult diet is unknown. Presumably adults eat small arthropods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Adults likely live in the forest canopy. Frogs have been heard calling from high in the trees just as dusk falls, and observed descending to breeding ponds (Duellman 2001). Individuals have been found in palm fronds (Stuart 1958) and bromeliads (Duellman 2001) during the dry season.  Egg consumers include snakes (Warkentin 1995, Ryan and Lips 2004), wasps (Warkentin 20001) and a pathogenic fungus (Villa 1979, Warkentin et al. 2000). Monkeys have also been observed eating frog eggs (Hughey pers. obs.). Clutches sometimes become infested with phorid and psychodid fly larvae (Villa 1980). Fly larvae largely subsist on eggs that are already dead, but occasionally attack and kill live embryos of other species of frogs (Villa 1980, Villa and Townsend 1983). If they fall into the water, eggs may be eaten by con- and hetero-specific tadpoles as well as the turtle Kinosternon leucostomum, but not by fish (Roberts 1994). Tadpoles are consumed by a wide variety of vertebrate and invertebrate predators (Touchon and Vonesh pers. comm.). Adults are susceptible to infection by at least 4 species of helminths (Goldberg and Helsey 2008).  Because A. callidryas are not as susceptible as other species to chytridiomycosis, they may act as disease reservoirs (Lips et al. 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A single or sometimes double "chock". Males produce aggressive chuckles towards other males (Pyburn 1970). Duellman (1970) and Gray and Rand (1970) reported calling activity at daybreak.

Behavior and communication

Eggs hatch prematurely in response to disturbance (Warkentin 1995, Warkentin et al. 2000, Warkentin 2001). Embryos can distinguish between dangerous and benign disturbances based on the vibrational frequencies produced by the disturbance as well as the temporal pattern of the vibrations (Warkentin 2005, Warkentin et al. 2006, Caldwell et al. 2009). Embryos do not hatch immediately upon disturbance. Instead, embryos require time to sample cues; thus, hatching is delayed to until enough information is accrued (Warkentin et al. 2007). Tadpoles also adjust the timing of metamorphosis, emerging smaller in the presence of tadpole predators but later and larger if there are metamorph predators (Vonesh and Warkentin 2006).  Males often engage in aggressive interactions, ranging from rapid push-ups to wrestling (Caldwell et al. 2010). Many males will grab onto and try to amplex a female, and multiple paternity sometimes results from multiple male breeding (d'Orgeix and Turner 1995). Amplexus is axillary. For an extensive description of breeding behavior see Pyburn (1964, 1970) and McCranie et al. (2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

Breeding season

The breeding season is largely concordant with the rainy season (Duellman 1970). In Panama, the breeding season lasts roughly from May to November or even January, depending on the duration of the rainy season. Large breeding choruses form at the edges of temporary and permanent ponds, particularly on nights after heavy afternoon rainstorms. Males call from trees and bushes around ponds. It is thought that females ovulate at least twice during the breeding season (Duellman 2001).

Egg

Eggs are laid terrestrially on leaves overhanging water. Eggs range in color from white to yellow to green to teal. The jelly surrounding the eggs is clear but quite thick. Typically, multiple clutches of less than 10 to more than 100 eggs are laid by a single female in a night (Duellman 2001). Females must go to the water prior to laying a clutch of eggs to absorb water to hydrate the jelly surrounding the clutch (Pyburn 1970). Eggs become capable of hatching four days post-oviposition, but if undisturbed, embryos typically remain in the egg until the night of age 6 days (Warkentin 1995).

Tadpole

Tadpoles develop in ponds where they can easily be dipnetted from the water column. Tadpole bodies are mostly tannish brown to grey or bluish. Caudal fins are transparent, however the tail sometimes develops dark grey pigmentation. Tadpoles typically orient themselves almost vertically, with the head up, in the water column. Agalychnis callidryas tadpoles survive for no more than 20 hours out of water (Valerio 1971). Tadpoles are rather tasteless (Wassersug 1971).Tadpoles are primarily midwater suspension feeders (Satel and Wassersug 1981). However, tadpoles have also been observed feeding on dead conspecifics, fish flakes, and rabbit chow (Hughey pers. obs.).

Metamorph juvenile

Metamorphs emerge in as little as four weeks but duration of the larval stage varies considerably depending on pond conditions. Metamorphs range in color from green to brown. The eye is initially yellow and newly emerged metamorphs lack side patterning. Adult coloration becomes apparent within several weeks (Starrett 1960). Time to maturity and lifespan in the wild is unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
4.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: These animals have been known to live up to 4.1 years in captivity (Andrew Snider and J. Bowler 1992). Most likely, however, their lifespan is considerably greater. Anecodtal claims of animals living over 8 years in captivity are plausible. Further studies are needed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Agalychnis callidryas usually reproduce in the rainy season. The reproduction process is initiated by a croaking and quivering mating ritual described below. Red-eyed tree frogs utilize a process called amplexus, a common form of reproduction for frog species. In amplexus the smaller male clasps the larger female when her eggs are mature. The male inseminates the eggs as they emerge from the female, and he does not leave until the eggs have been laid. Amplexus may persist for a day or longer.

As reproduction takes place on the underside of leaves, the female must hold on to the underside of the leaf with her suction-cup toes, holding on for both herself and her mate. Each group of eggs that a female produces is called a clutch, and the female must enter the water after laying each clutch, with the male still attached to her back, in order to fill her bladder with water. If the female does not fill her bladder between clutches, her eggs will dry up and die. Sometimes when a female and her mate enter the water, other males see them entering and attempt to force the male from her back. If this is accomplished, another male will take his positon and fertilize the next clutch eggs.

While most frog species lay their eggs directly into the water, A. callidryas lay theirs on the underside of leaves that hang over bodies of water. When the clutches of eggs have developed into tadpoles, which occurs very quickly, the tadpoles swim around within their eggs until the egg ruptures. The rupturing of all the eggs in the clutch occurs within a one minute time period, and the fluid released from the ruptured eggs helps to wash all the tadpoles down the leaf and into the waiting water below. Reproduction is a very strenous activity for A. callidryas.

(Hickman and Roberts,1995,   http://www.discovery.com/)

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolotion

Considerable geographic variation in body size, flank coloration and patterning, and leg coloration exists in A. callidryas (Robertson 2008, Robertson and Robertson 2008, Robertson et al. 2009). Patterns of biogeographic diversification differ from those of Dendropsophus ebbraccatus (Robertson et al. 2009).  Hatching in response to risk appears to be an ancestral characteristic in phyllomedusines (Gomez-Mestre et al. 2008). The trait was most likely originally a response to flooding, but some species, such as A. callidryas, have evolved to respond to additional risks such as snakes (Gomez-Mestre and Warkentin 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

Agalychnis callidryas have very low calling rates (Duellman and Pyles 1983). The trunk muscles of this species (used for calling) have both low enzyme activity (Bevier 1995) and low mitochondrial volume (Ressel 1996) compared to other frogs with higher calling rates. The skin of A. callidryas has low reflectance in visible wavelengths but reflectance is higher in the near infrared (Emerson et al 1990). Testis size larger than average, probably because of multiple male mating in this species (Emerson 1997). Oxygen availability is variable within the egg (Warkentin et al. 2005). Embryos have large external gills, which they position to maximize oxygen consumption (Rogge and Warkentin 2008, Warkentin et al. 2005). Prostaglandins regulate external gill loss of embryos (Warkentin and Wassersug 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cell Biology

Karyotype

Karyotype

2N = 26 (Duellman and Cole 1965, Schmid et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agalychnis callidryas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATTTTTGGTGCGTGAGCCGGAATAGTGGGCACTGCTCTTAGCCTCTTAATTCGAGCTGAGCTAAGCCAGCCAGGCTCACTTTTAGGGGATGATCAAATTTATAATGTAGTTGTAACTGCCCACGCTTTTGTTATAATTTTTTTTATGGTAATACCAGTTATAATCGGAGGATTCGGAAACTGACTTGTACCTCTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGTATAAACAATATAAGTTTTTGACTCCTACCTCCATCCTTCCTTCTTCTTTTAGCTTCCGCTGGGGTAGAAGCCGGAGCCGGGACTGGGTGAACCGTGTATCCACCTCTCGCCGGAAATTTAGCTCATGCAGGACCATCTGTTGACTTAACTATTTTTTCTCTACATTTGGCAGGAGTCTCTTCTATCTTAGGGGCAATTAACTTTATCACAACTATTTTAAATATAAAACCTCCTTCGATGTCTCAGTACCAAACTCCGCTGTTTGTTTGGTCTGTCTTAATCACTGCTGTCTTACTTTTACTCTCTCTACCAGTTTTAGCAGCAGGTATTACTATATTACTAACAGATCGTAATCTAAATACCACATTCTTTGACCCCGCTGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agalychnis callidryas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

These frogs are not considered threatened in their natural environment. However there has been much concern about the overall condition of the rain forest habitat in which A. callidryas resides. Global warming, deforestation, climatic and atmospheric changes, wetland drainage, and pollution have caused dramatic declines in the amphibian population in, and among the rainforests of Central and South America.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Solís, F., Ibáñez, R., Santos-Barrera, G., Jungfer, K., Renjifo, J. & Bolaños, F.

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is generally considered to be an abundant species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Agalychnis callidryas is nocturnally active. This frog is arboreal and shelters on the underside of a broad leaf during the day and during the dry season, with limbs folded underneath its body (Leenders 2001). It has also been found in bromeliads, though this appears to be rare (Duellman 2001). This species is abundant in suitable habitat (Stuart et al. 2008).

Breeding occurs during the wet season (late May to November), beginning with the first rains (Pyburn 1970). Mating takes place throughout the rainy season but is particularly frequent in June, and occasionally peaks again in October (Donnelly and Guyer 1994). Agalychnis callidryas generally prefers quiet pools of water with overhanging vegetation as breeding sites (but see the paragraph below for other types of sites used); the pools may be permanent, seasonal but long-lasting, or temporary (Warkentin et al. 2001; Pyburn 1970). Males make aggressive calls, to deter other males from intruding onto their territories, and advertisement calls, to attract females (Gray and Rand 1997). The aggressive call sounds like a soft chuckle, and the advertisement call is a "chack" or "chack-chack", repeated at intervals of 8-60 seconds (Duellman 1967; Pyburn 1970; Duellman 2001). The dominant call frequency ranges from 1.5-2.5 kHz (Gray and Rand 1997). Calling begins at dusk and is most frequent in the evening, especially during rains, as males advertise for mates (Pyburn 1970). However, Agalychnis callidryas have also been reported to participate in a brief daybreak chorus of advertisement calls, at a much higher call rate than evening or morning advertisement choruses (Gray and Rand 1997; Duellman 2001). On dry nights, males call from higher perches in the tree canopy (Pyburn 1970). On wetter nights, or when the ponds are full, males begin calling from the ground and from small trees and bushes near the edges of ponds or backwaters (Pyburn 1970). Calls are generally made from horizontal perches on leaves or branches, although vertical perches on stems are occasionally used (Pyburn 1970). Males move about frequently while calling, changing both their positions and the direction of calling (Pyburn 1970). If precipitation or water level conditions are sufficient, males then descend to the breeding sites at the water's edge and continue calling (Savage 2002). Females descend from the canopy, approach selected calling males in a straight line, and allow amplexus to take place (Pyburn 1970). Descent generally occurs slowly hand-over-hand, but parachuting has also been observed in this species, both in the wild (Pyburn 1964), and in experimental trials (Roberts 1994).

Once amplexed, a female will carry the amplectant male into the water and remain there for about ten minutes (Pyburn 1970; D'Orgeix and Turner 1995). Pyburn (1970) carried out experiments showing that the purpose of this behavior is to allow the female to absorb water through her skin, into her bladder, in order to make the jelly mass surrounding the clutch of eggs (Pyburn 1970). The amplectant pair then moves up into the trees, as the female searches for an appropriate egg deposition site on vegetation overhanging the water (Pyburn 1970; D'Orgeix and Turner 1995). Eggs are generally deposited on either the upper side (Pyburn 1970) or lower side (Fouquette 1968) of a broad leaf, as high as 12 feet over the water (Fouquette 1968). Sturdy plants and trees at the water's edge are preferred, but oviposition may also take place on emergent vegetation (Pyburn 1970). Egg clutches may also occasionally be deposited on substrates such as branches or fence wire (Pyburn 1970). Very rarely eggs will be deposited on the ground (Pyburn 1970). This species has also been reported to sometimes make use of a wide variety of other types of sites, such as water-filled depressions made by human and pack animals, completely lacking overhanging vegetation; vines and small trees overhanging cavities of water in fallen trees; passionflower vines growing above a trickle of water from a pig pen; or by attaching eggs to the inside surface of water collection devices (McCranie et al. 2003). Occasionally clutches are found with leaves partially or completely folded over the eggs (Duellman 2001). If the deposition site is on top of a leaf, the parents may be protecting the clutch from sun and predators by folding the leaf edge over, where it adheres to the sticky jelly mass surrounding the eggs (Leenders 2001). Other leaf-breeding frogs (Phyllomedusa iheringi, P. hypochondrialis, and P. sauvagii) protect their clutches within folded leaves (Pyburn 1970). However, Duellman (2001) cautions that for Agalychnis callidryas, the occasional folding may be due to attachment of the eggs to particular types of leaves more prone to curling, as neither he nor others (e.g. Pyburn) have observed this species actively curling leaves during oviposition. Pyburn (1970), in fact, specifically mentions that Agalychnis callidryas lays its eggs on open leaves, in contrast to other phyllomedusine frogs.

Fertilization occurs immediately after egg deposition (Leenders 2001). Occasionally amplectant pairs are attacked by single males, as the intruder attempts to dislodge the first male or attach himself alongside or on the first male's back (Pyburn 1970; D'Orgeix and Turner 1995). This strategy sometimes succeeds, as molecular analysis has confirmed that multiple paternity does occur and that the second male can contribute significantly to clutch fertilization in the wild (D'Orgeix and Turner 1995). Briggs (2008) conducted male-displacement trials, where a male at least 5 mm longer in SVL was placed into a covered 5-gallon bucket with a recently amplexed pair and checked every hour with red light, but found no male takeovers occurred. Over a three-year study period, Briggs (2008) reported that mating patterns varied; red-eyed tree frogs showed evidence of size-assortative mating in one of the three years and evidence of large-male mating advantage in another one of the three years (the driest year).

Clutches consist of about 40 green eggs, each surrounded by a clear jelly coat, with each egg having a diameter of about 3.7 mm at oviposition and 5.2 mm when mature enough to hatch (Pyburn 1963; Warkentin 2000a; Warkentin 2002). The entire clutch is itself surrounded in more jelly, which is sticky and serves to adhere the clutch to the substrate as well as to prevent desiccation (Pyburn 1963; Pyburn 1970; Warkentin et al. 2006). Yolk color is consistent within clutches, but varies between clutches, from cream to gold to turquoise to lime green (Warkentin et al. 2006); as the clutches get older, the yolk changes color from pale green to yellow (Duellman 2001). Females may lay multiple clutches (up to five) in a single night (Pyburn 1970). In between clutches, the female carries the amplectant male down into the water again as she rehydrates (D'Orgeix and Turner 1995). Ovulation is likely to occur twice during the reproductive season, given that gravid females containing ovulated eggs were also found to have equal numbers of immature half-size eggs still within the ovary, (Duellman 1963; Duellman 2001). This observation also fits with the second peak in mating sometimes observed near the end of the rainy season (Donnelly and Guyer 1994). Fertilization success is high, with Briggs (2008) noting 100% fertilization in 54 of 56 experimental clutches and reporting that this did not differ from her field observations.

Since the egg clutches are attached to vegetation overhanging the water, hatching tadpoles generally fall into the water below as soon as they hatch (Pyburn 1963). Thus hatching involves a shift in habitat, from aerial to aquatic, with a concomitant change in the suite of potential predators and selection pressures (Warkentin 1995). Occasionally, hatching tadpoles may also fall onto the ground (Pyburn 1970). Tadpoles are able to live out of water for up to 20 hours (Valerio 1971). Those that fall onto the ground or remain stuck to the leaf may still survive if a later rain washes them into standing water, or if they are able to flip themselves into the water by thrashing about with their tails (Pyburn 1963; Pyburn 1970).

Agalychnis callidryas shows remarkable adaptive plasticity in the timing of hatching (Warkentin 1995). In undisturbed clutches, embryos develop essentially synchronously but hatch asynchronously, from six to ten days post-oviposition (Warkentin 1995; Warkentin 2005). Most undisturbed embryos will hatch at about seven days, with the study population in Panama hatching on average at about 6-7 days and the study population in Costa Rica hatching at about 7-8 days (Warkentin 2005). However, if disturbed, Agalychnis callidryas embryos can undergo early, relatively synchronous hatching, as early as 4 days in Panama (Warkentin 2000b) or 5 days in Costa Rica (Warkentin 1995). Accelerated hatching can occur in entire clutches or small groups of eggs within a clutch, in response to at least four different natural risks: snake attack (Warkentin 1995), wasp attack (Warkentin 2000b), fungus infestation (Warkentin et al. 2001), and flooding or submersion (Pyburn 1963; Warkentin 2002). Hypoxia from exposure to hypoxic gas mixtures also induces early hatching (Warkentin 2002). Fungal attack, flooding,and hypoxia result in more gradual early hatching than immediate threat of predation (Warkentin 2000b). The decision to hatch is a behavioral decision since highly energetic movement is required; embryos which remain motionless do not hatch, even though they have reached an appropriate developmental stage (Warkentin 1995; Warkentin et al. 2001). Mechanical disturbance is both sufficient and necessary to induce rapid, synchronous hatching, since simultaneous touching and jiggling of the eggs by poking forceps into the surrounding jelly results in rapid hatching (Warkentin 1995). However, Agalychnis callidryas embryos do not respond to all mechanical disturbances by rapid hatching (Warkentin 1995). Five-day-old embryos are insensitive to movements of the leaf substrate caused by simply touching the egg jelly coats, or collecting and transporting egg clutches, or even high winds and heavy rain (Warkentin 1995). The plasticity in timing and synchronization of hatching, particularly early hatching, is thus not simply a response to mechanical stimulus intensity (Warkentin 2000b), nor is it a response to visual or chemical cues from snake or wasp predators, or cues such as wetting of the clutch from precipitation (Warkentin 2005). Rather, experiments have shown that red-eyed tree frog embryos assess the temporal pattern of substrate-borne vibrations when making the decision to hatch (Warkentin 2005; Warkentin et al. 2006; Warkentin et al. 2007). Further, they do not hatch at the earliest possible moment following stimulation, but wait some seconds to minutes to evaluate the information before deciding to hatch (Warkentin et al. 2007).

A video clip is available on Karen Warkentin's website of Agalychnis callidryas embryos undergoing accelerated hatching resulting from snake attack. Developing Agalychnis callidryas embryos are commonly preyed on by snakes (e.g., Leptodeira septentrionalis) (Warkentin 1995). Snake attack induces embryos to hatch up to 30% early (as early as five days post-oviposition), rapidly (within seconds to minutes), and relatively synchronously, as the entire clutch hatches within a few minutes rather than over several days (Warkentin 1995). Embryos are able to distinguish between the potentially lethal event of a snake attack and the relatively non-dangerous event of a rainstorm by the duration and timing of resulting vibrations (Warkentin et al. 2006). When vibrational recordings produced by a snake attack or by a rainstorm are edited and played back, such that the timing of vibrations more closely resembles the other stimulus, the hatching response shifts in the expected direction: higher for more snakelike vibrations, lower for more rainlike vibrations (Warkentin et al. 2006). Tadpoles first enter the water on hatching, shifting their habitat from aerial to aquatic as they fall from from the overhanging leaves to which the egg clutch was attached (Pyburn 1963). If undisturbed by snakes, embryos tend to delay hatching until they are about seven days old, because more developed larvae are less vulnerable to aquatic predators such as shrimp and fish (Warkentin 1995; Warkentin 2005).

Developing Agalychnis callidryas embryos are also frequently vulnerable to predation by several different species of polybid wasps (Warkentin 2000b; Warkentin et al. 2006). Wasp predation, like snake predation, induces early and rapid hatching of Agalychnis callidryas embryos (Warkentin 2000b). Interestingly, the number of embryos hatching is different, depending on the predation scenario. Warkentin (2000b) reports that embryos hatch individually or in small groups (the ones grasped by a wasp, plus sometimes the nearest neighbors) in response to wasps, which consume a single embryo at a time, whereas whole clutches hatch in response to snakes, which eat entire clutches.

Fungal infection of Agalychnis callidryas egg clutches by a filamentous ascomycete (family Phaeosphaeriaceae) also induces early hatching (Warkentin et al. 2001). While eggs in non-infected clutches hatch in a spatially random order, hatching in infected clutches is non-random (Warkentin et al. 2001). In infected clutches, those eggs which are specifically in direct contact with fungal hyphae will hatch early if they are at least five days old (Warkentin et al. 2001). Adjacent empty eggs can form a "barrier" which the fungus does not typically cross, allowing the remaining embryos to continue developing within the clutch (Warkentin et al. 2001). In contrast to the immediate, synchronous hatching in response to snake or wasp attack, fungus-infected clutches that are at a sufficient stage of development hatch over a period of days, but at an average younger age than healthy clutches (Warkentin et al. 2001).

Agalychnis callidryas larvae have unusually large, elaborate external gills for anurans, consisting of a gill trunk on each side of the body, with one row of branched filaments (Pyburn 1963). The presence of large, elaborate gills is likely to indicate oxygen limitation throughout development, especially since the embryos of this species develop in large, closely packed eggs under quite warm conditions (Warkentin 2000a). Larvae show strikingly rapid external gill loss on hatching, with substantial gill regression occurring as fast as three minutes post-hatching (Warkentin 2000a). Newly hatched tadpoles respire via internal gills, as well as cutaneously (Warkentin 2000a). The increase in environmentally available oxygen upon leaving the egg has been experimentally demonstrated to be the primary stimulus for external gill loss in this species, with the process of hatching itself playing a secondary role in triggering gill loss (Warkentin 2000a). Since the presence of external gills creates drag in the water (Dudley et al. 1991), rapid gill loss at the time these tadpoles first enter the water may enhance swimming performance, which could enable survival on exposure to aquatic predators (Warkentin 2000a). In this species (and probably other anurans with external gills), the loss of external gills at hatching appears to be mediated by prostaglandins of the E family, or PGEs (Warkentin and Wassersug 2001). In contrast, the loss of internal gills is mediated by thyroid hormone at the time of metamorphosis (Shi 2000).

Tadpoles of Red-Eyed Tree Frogs suspend themselves vertically in the water column to feed, with heads near the water surface (Savage 2002). They are primarily water-column filter feeders (Vonesh and Warkentin 2006). Gray and Nishikawa (1995) reported that in the laboratory, adult Agalychnis callidryas preferred crickets and moths as prey. To our knowledge, no field study has yet been published on the diet of adults of this species.

Eggs of Agalychnis callidryas are vulnerable to predation by arboreal snakes (such as the cat-eyed snake, Leptodeira septentrionalis), several species of polybid wasps (particularly Polybia rejecta), monkeys, and fly larvae (Hirtodrosophila batracida) (Warkentin 1995; Warkentin 2000b; Warkentin et al. 2001; Warkentin et al. 2006). In addition, eggs are susceptible to mortality from fungal infection by a filamentous ascomycete (family Phaeosphaeriaceae) (Warkentin et al. 2001). Tadpoles may be preyed on by aquatic predators such as shrimp (Macrobrachium americanum) and fish (Brachyraphis rhabdophora) (Warkentin 1995), as well as giant water bugs foraging below the water surface (Belostoma sp.) (Vonesh and Warkentin 2006). Newly metamorphosed froglets may be consumed by aquatic spiders foraging at or above the water surface (Thaumasia sp.) (Vonesh and Warkentin 2006). Predators on juvenile and adult Red-Eyed Tree Frogs include snakes (Warkentin 1995), as well as birds and bats (Leenders 2001).

Although phyllomedusine (leaf-breeding) frogs do not have the same sort of highly toxic compounds as other brightly colored frogs such as the dendrobatids, their skin does contain high levels of biologically active peptides (Mignogna et al. 1997). The skin of Agalychnis callidryas has been shown to contain five different families of biologically active peptides: tachykinins, bradykinins, caerulein, opioid peptides (dermorphin and [Hyp6]dermorphin), and sauvagine (Mignogna et al. 1997).

In addition to larvae being able to sense vibrations, it has now been shown that adult male Red-Eyed Tree Frogs also use vibrational signaling, in male-male aggressive interactions (Caldwell et al., 2010). The authors point out that substrate vibrations may be far more important in communication by arboreal vertebrates than had previously been realized. During contests over females, male Red-Eyed Tree Frogs emit "chuckle" calls and perform tremulation displays by shaking a branch rapidly with their hind legs. Tremulations only occurred when two males were within 2 m of each other or were on the same plant, and were often immediately followed by wrestling. To test whether the vibrations were important, various combinations of displays were made using a robotic frog on a wooden frame near a branch occupied by a live frog, plus a shaker on the branch where the live frog sat. In some tests, the robotic frog moved up and down, for a visual display, but no branch shaking was done; in others, the branch was vibrated but the robotic frog did not move; and in some tests, both visual and vibrational displays were made. The live males responded aggressively to all displays, both visual and vibrational, but only shook their own branch when vibrations were felt from the shaker (Caldwell et al. 2010).

  • Briggs, V. S. (2008). ''Mating patterns of red-eyed treefrogs, Agalychnis callidryas and A. moreletii.'' Ethology, 114, 489-498.
  • Caldwell, M. S., Johnston, G. R., McDaniel, J. G., and Warkentin, K. M. (2010). ''Vibrational signaling in the agonistic interactions of red-eyed treefrogs.'' Current Biology, doi:10.1016/j.cub.2010.03.069.
  • Cope, E. D. (1862). ''Catalogue of the reptiles obtained during the explorations of the Parana, Paraguay, Vermejo, and Uruguay Rivers, by Captain Thos. J. Page, U.S.N., and of those procured by Lieut. N. Michler, U.S. Top. Eng., Commander of the expedition conducting the survey.'' Proceedings of the Academy of Natural Sciences of Philadelphia, 14, 346-359.
  • D'Orgeix, C. A., and Turner, B. J. (1995). ''Multiple paternity in the red-eyed treefrog Agalychnis callidryas (Cope).'' Molecular Ecology, 4, 505-508.
  • Donnelly, M., and Guyer, C. (1994). ''Patterns of reproduction and habitat use in an assemblage of Neotropical hylid frogs.'' Oecologia, 98, 291-302.
  • Dudley, R., King, V. A., and Wassersug, R. J. (1991). ''The implications of shape and metamorphosis for drag forces on a generalized pond tadpole (Rana catesbeiana).'' Copeia, 1991, 252-257.
  • Duellman, W. E. (1967). ''Courtship isolating mechanisms in Costa Rican hylid frogs.'' Herpetologica, 23(3), 169-183.
  • Duellman, W. E. (1963). ''Amphibians and reptiles of the rainforest of southern El Petén, Guatemala.'' University of Kansas Publications, Museum of Natural History, 15, 205-249.
  • Duellman, W. E. (2001). The Hylid Frogs of Middle America. Society for the Study of Amphibians and Reptiles, Ithaca, New York.
  • Duellman, W. E., and Cole, C. J. (1965). ''Studies of chromosomes of some anuran amphibians.'' Systematic Zoology, 14(2), 139-143.
  • Fouquette, M. J., Jr. (1968). ''Some hylid frogs of the Canal Zone, with special reference to call structure.'' Caribbean Journal of Science, 6(3-4), 167-172.
  • Gray, L. A., and Nishikawa, K.C. (1995). ''Feeding kinematics of phyllomedusine tree frogs.'' The Journal of Experimental Biology, 198, 457-463.
  • Gray, L. A., and Rand, A. S. (1997). ''A daybreak chorus in the frog, Agalychnis callidryas.'' Journal of Herpetology, 31(3), 440-441.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • McCranie, J. R., Wilson, L. D., and Townsend, J. H. (2003). ''Agalychnis callidryas (Red-eyed Treefrog). Reproduction.'' Herpetological Review, 34(1), 43.
  • Mignogna, G., Severina, C., Erspamer, G. F., Siciliano, R., Kreil, G., and Barra, D. (1997). ''Tachykinins and other biologically active peptides from the skin of the Costa Rican phyllomedusid frog Agalychnis callidryas.'' Peptides, 18(3), 367-372.
  • Pyburn, W. F. (1963). ''Observations on the life history of the treefrog, Phyllomedusa callidryas (Cope).'' Texas Journal of Science, 15, 155-170.
  • Pyburn, W. F. (1964). ''Breeding behavior of the leaf-frog, Phyllomedusa callidryas, in southern Veracruz.'' The American Philosophical Society Yearbook, 1964, 291-294.
  • Pyburn, W. F. (1970). ''Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico.'' Copeia, 2, 209-218.
  • Roberts, W. E. (1994). ''Explosive breeding aggregations and parachuting in a neotropical frog, Agalychnis saltator (Hylidae).'' Journal of Herpetology, 28(2), 193-199.
  • Ruiz-Carranza, P.M., Ardila-Robayo, M.C., and Lynch, J.D (1996). ''Lista actualizada de la fauna de Amphibia de Colombia.'' Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20(77), 365-415.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Shi, Y-B. (2000). Amphibian Metamorphosis: From Morphology to Molecular Biology. Wiley-Liss, Inc., New York.
  • Starrett, P. (1960). ''Descriptions of tadpoles of Middle American frogs.'' Miscellaneous Publications Museum of Zoology, University of Michigan, 110, 5-37.
  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Valerio, C.E. (1971). ''Ability of some tropical tadpoles to survive without water.'' Copeia, 1971(2), 364-365.
  • Vonesh, J. R., and Warkentin, K. M. (2006). ''Opposite shifts in size at metamorphosis in response to larval and metamorph predators.'' Ecology, 87(3), 556-562.
  • Warkentin, K. M. (1995). ''Adaptive plasticity in hatching age: A response to predation risk trade-offs.'' Proceedings of the National Academy of Sciences, 92, 3507-3510.
  • Warkentin, K. M. (2000). ''Environmental and developmental effects on external gill loss in the Red-Eyed Tree Frog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 73(5), 557-565.
  • Warkentin, K. M. (2000). ''Wasp predation and wasp-induced hatching of red-eyed treefrog eggs.'' Animal Behavior, 60, 503-510.
  • Warkentin, K. M. (2002). ''Hatching timing, O2 availability and external gill regression in the treefrog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 75, 155-164.
  • Warkentin, K. M. (2005). ''How do embryos assess risk? Vibrational cues in predator-induced hatching of red-eyed treefrogs.'' Animal Behavior, 70, 59-71.
  • Warkentin, K. M., Buckley, C. R., and Metcalf, K. A. (2006). ''Development of red-eyed treefrog eggs affects efficiency and choices of egg-foraging wasps.'' Animal Behavior, 71, 417-425.
  • Warkentin, K. M., Caldwell, M. S., Siok, T. D., D'Amato, A. T., and McDaniel, J. G. (2007). ''Flexible information sampling in vibrational assessment of predation risk by red-eyed treefrog embryos.'' The Journal of Experimental Biology, 210, 614-619.
  • Warkentin, K. M., Caldwell, M. S., and McDaniel, J. G. (2006). ''Temporal pattern cues in vibrational risk assessment by embryos of the red-eyed treefrog, Agalychnis callidryas.'' Journal of Experimental Biology, 209, 1376-1384.
  • Warkentin, K. M., Currie, C. R., and Rehner, S. A. (2001). ''Egg-killing fungus induces early hatching of red-eyed treefrog eggs.'' Ecology, 82(10), 2860-2869.
  • Warkentin, K. M., and Wassersug, R. J. (2001). ''Do prostaglandins regulate external gill regression in anurans?'' Journal of Experimental Zoology, 289, 366-373.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is threatened by habitat loss by the destruction of natural forests although it is known to survive in places with a degree of anthropogenic alteration. It is also recorded within the pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species can tolerate some habitat modification, such as in areas where selective logging has been done, but is thought not to be able to live where the forest has been heavily degraded (Stuart et al. 2008). However, McCranie et al. (2003) report finding Agalychnis callidryas eggs and tadpoles in a wide variety of breeding sites in Honduras, including some in heavily deforested areas (see Life History section above for a description).

All five Agalychnis species (A. annae, A. callidryas, A. moreletii, A. saltator, and A. spurrelli) are now under CITES protection, under Appendix II (as of March 21, 2010). Within the past decade the U.S. alone has imported 221,960 Agalychnis frogs, according to the Species Survival Network (SSN).

  • Briggs, V. S. (2008). ''Mating patterns of red-eyed treefrogs, Agalychnis callidryas and A. moreletii.'' Ethology, 114, 489-498.
  • Caldwell, M. S., Johnston, G. R., McDaniel, J. G., and Warkentin, K. M. (2010). ''Vibrational signaling in the agonistic interactions of red-eyed treefrogs.'' Current Biology, doi:10.1016/j.cub.2010.03.069.
  • Cope, E. D. (1862). ''Catalogue of the reptiles obtained during the explorations of the Parana, Paraguay, Vermejo, and Uruguay Rivers, by Captain Thos. J. Page, U.S.N., and of those procured by Lieut. N. Michler, U.S. Top. Eng., Commander of the expedition conducting the survey.'' Proceedings of the Academy of Natural Sciences of Philadelphia, 14, 346-359.
  • D'Orgeix, C. A., and Turner, B. J. (1995). ''Multiple paternity in the red-eyed treefrog Agalychnis callidryas (Cope).'' Molecular Ecology, 4, 505-508.
  • Donnelly, M., and Guyer, C. (1994). ''Patterns of reproduction and habitat use in an assemblage of Neotropical hylid frogs.'' Oecologia, 98, 291-302.
  • Dudley, R., King, V. A., and Wassersug, R. J. (1991). ''The implications of shape and metamorphosis for drag forces on a generalized pond tadpole (Rana catesbeiana).'' Copeia, 1991, 252-257.
  • Duellman, W. E. (1967). ''Courtship isolating mechanisms in Costa Rican hylid frogs.'' Herpetologica, 23(3), 169-183.
  • Duellman, W. E. (1963). ''Amphibians and reptiles of the rainforest of southern El Petén, Guatemala.'' University of Kansas Publications, Museum of Natural History, 15, 205-249.
  • Duellman, W. E. (2001). The Hylid Frogs of Middle America. Society for the Study of Amphibians and Reptiles, Ithaca, New York.
  • Duellman, W. E., and Cole, C. J. (1965). ''Studies of chromosomes of some anuran amphibians.'' Systematic Zoology, 14(2), 139-143.
  • Fouquette, M. J., Jr. (1968). ''Some hylid frogs of the Canal Zone, with special reference to call structure.'' Caribbean Journal of Science, 6(3-4), 167-172.
  • Gray, L. A., and Nishikawa, K.C. (1995). ''Feeding kinematics of phyllomedusine tree frogs.'' The Journal of Experimental Biology, 198, 457-463.
  • Gray, L. A., and Rand, A. S. (1997). ''A daybreak chorus in the frog, Agalychnis callidryas.'' Journal of Herpetology, 31(3), 440-441.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • McCranie, J. R., Wilson, L. D., and Townsend, J. H. (2003). ''Agalychnis callidryas (Red-eyed Treefrog). Reproduction.'' Herpetological Review, 34(1), 43.
  • Mignogna, G., Severina, C., Erspamer, G. F., Siciliano, R., Kreil, G., and Barra, D. (1997). ''Tachykinins and other biologically active peptides from the skin of the Costa Rican phyllomedusid frog Agalychnis callidryas.'' Peptides, 18(3), 367-372.
  • Pyburn, W. F. (1963). ''Observations on the life history of the treefrog, Phyllomedusa callidryas (Cope).'' Texas Journal of Science, 15, 155-170.
  • Pyburn, W. F. (1964). ''Breeding behavior of the leaf-frog, Phyllomedusa callidryas, in southern Veracruz.'' The American Philosophical Society Yearbook, 1964, 291-294.
  • Pyburn, W. F. (1970). ''Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico.'' Copeia, 2, 209-218.
  • Roberts, W. E. (1994). ''Explosive breeding aggregations and parachuting in a neotropical frog, Agalychnis saltator (Hylidae).'' Journal of Herpetology, 28(2), 193-199.
  • Ruiz-Carranza, P.M., Ardila-Robayo, M.C., and Lynch, J.D (1996). ''Lista actualizada de la fauna de Amphibia de Colombia.'' Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20(77), 365-415.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Shi, Y-B. (2000). Amphibian Metamorphosis: From Morphology to Molecular Biology. Wiley-Liss, Inc., New York.
  • Starrett, P. (1960). ''Descriptions of tadpoles of Middle American frogs.'' Miscellaneous Publications Museum of Zoology, University of Michigan, 110, 5-37.
  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Valerio, C.E. (1971). ''Ability of some tropical tadpoles to survive without water.'' Copeia, 1971(2), 364-365.
  • Vonesh, J. R., and Warkentin, K. M. (2006). ''Opposite shifts in size at metamorphosis in response to larval and metamorph predators.'' Ecology, 87(3), 556-562.
  • Warkentin, K. M. (1995). ''Adaptive plasticity in hatching age: A response to predation risk trade-offs.'' Proceedings of the National Academy of Sciences, 92, 3507-3510.
  • Warkentin, K. M. (2000). ''Environmental and developmental effects on external gill loss in the Red-Eyed Tree Frog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 73(5), 557-565.
  • Warkentin, K. M. (2000). ''Wasp predation and wasp-induced hatching of red-eyed treefrog eggs.'' Animal Behavior, 60, 503-510.
  • Warkentin, K. M. (2002). ''Hatching timing, O2 availability and external gill regression in the treefrog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 75, 155-164.
  • Warkentin, K. M. (2005). ''How do embryos assess risk? Vibrational cues in predator-induced hatching of red-eyed treefrogs.'' Animal Behavior, 70, 59-71.
  • Warkentin, K. M., Buckley, C. R., and Metcalf, K. A. (2006). ''Development of red-eyed treefrog eggs affects efficiency and choices of egg-foraging wasps.'' Animal Behavior, 71, 417-425.
  • Warkentin, K. M., Caldwell, M. S., Siok, T. D., D'Amato, A. T., and McDaniel, J. G. (2007). ''Flexible information sampling in vibrational assessment of predation risk by red-eyed treefrog embryos.'' The Journal of Experimental Biology, 210, 614-619.
  • Warkentin, K. M., Caldwell, M. S., and McDaniel, J. G. (2006). ''Temporal pattern cues in vibrational risk assessment by embryos of the red-eyed treefrog, Agalychnis callidryas.'' Journal of Experimental Biology, 209, 1376-1384.
  • Warkentin, K. M., Currie, C. R., and Rehner, S. A. (2001). ''Egg-killing fungus induces early hatching of red-eyed treefrog eggs.'' Ecology, 82(10), 2860-2869.
  • Warkentin, K. M., and Wassersug, R. J. (2001). ''Do prostaglandins regulate external gill regression in anurans?'' Journal of Experimental Zoology, 289, 366-373.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by many parks throughout its range. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Agalychnis callidryas are very popular in the pet trade. Their beautiful coloring makes these frogs very popular among frog and amphibian enthusiasts.

Agalychnis callidryas are also ecologically important. They and other amphibians are generally thought to suffer from environmental effects at an earlier time than other animals and can therefore be used as indicator species to alert humans to environmental changes in their habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

Red-eyed tree frogs are popular in the pet trade, and can be bred in captivity under suitable conditions.

  • Briggs, V. S. (2008). ''Mating patterns of red-eyed treefrogs, Agalychnis callidryas and A. moreletii.'' Ethology, 114, 489-498.
  • Caldwell, M. S., Johnston, G. R., McDaniel, J. G., and Warkentin, K. M. (2010). ''Vibrational signaling in the agonistic interactions of red-eyed treefrogs.'' Current Biology, doi:10.1016/j.cub.2010.03.069.
  • Cope, E. D. (1862). ''Catalogue of the reptiles obtained during the explorations of the Parana, Paraguay, Vermejo, and Uruguay Rivers, by Captain Thos. J. Page, U.S.N., and of those procured by Lieut. N. Michler, U.S. Top. Eng., Commander of the expedition conducting the survey.'' Proceedings of the Academy of Natural Sciences of Philadelphia, 14, 346-359.
  • D'Orgeix, C. A., and Turner, B. J. (1995). ''Multiple paternity in the red-eyed treefrog Agalychnis callidryas (Cope).'' Molecular Ecology, 4, 505-508.
  • Donnelly, M., and Guyer, C. (1994). ''Patterns of reproduction and habitat use in an assemblage of Neotropical hylid frogs.'' Oecologia, 98, 291-302.
  • Dudley, R., King, V. A., and Wassersug, R. J. (1991). ''The implications of shape and metamorphosis for drag forces on a generalized pond tadpole (Rana catesbeiana).'' Copeia, 1991, 252-257.
  • Duellman, W. E. (1967). ''Courtship isolating mechanisms in Costa Rican hylid frogs.'' Herpetologica, 23(3), 169-183.
  • Duellman, W. E. (1963). ''Amphibians and reptiles of the rainforest of southern El Petén, Guatemala.'' University of Kansas Publications, Museum of Natural History, 15, 205-249.
  • Duellman, W. E. (2001). The Hylid Frogs of Middle America. Society for the Study of Amphibians and Reptiles, Ithaca, New York.
  • Duellman, W. E., and Cole, C. J. (1965). ''Studies of chromosomes of some anuran amphibians.'' Systematic Zoology, 14(2), 139-143.
  • Fouquette, M. J., Jr. (1968). ''Some hylid frogs of the Canal Zone, with special reference to call structure.'' Caribbean Journal of Science, 6(3-4), 167-172.
  • Gray, L. A., and Nishikawa, K.C. (1995). ''Feeding kinematics of phyllomedusine tree frogs.'' The Journal of Experimental Biology, 198, 457-463.
  • Gray, L. A., and Rand, A. S. (1997). ''A daybreak chorus in the frog, Agalychnis callidryas.'' Journal of Herpetology, 31(3), 440-441.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • McCranie, J. R., Wilson, L. D., and Townsend, J. H. (2003). ''Agalychnis callidryas (Red-eyed Treefrog). Reproduction.'' Herpetological Review, 34(1), 43.
  • Mignogna, G., Severina, C., Erspamer, G. F., Siciliano, R., Kreil, G., and Barra, D. (1997). ''Tachykinins and other biologically active peptides from the skin of the Costa Rican phyllomedusid frog Agalychnis callidryas.'' Peptides, 18(3), 367-372.
  • Pyburn, W. F. (1963). ''Observations on the life history of the treefrog, Phyllomedusa callidryas (Cope).'' Texas Journal of Science, 15, 155-170.
  • Pyburn, W. F. (1964). ''Breeding behavior of the leaf-frog, Phyllomedusa callidryas, in southern Veracruz.'' The American Philosophical Society Yearbook, 1964, 291-294.
  • Pyburn, W. F. (1970). ''Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico.'' Copeia, 2, 209-218.
  • Roberts, W. E. (1994). ''Explosive breeding aggregations and parachuting in a neotropical frog, Agalychnis saltator (Hylidae).'' Journal of Herpetology, 28(2), 193-199.
  • Ruiz-Carranza, P.M., Ardila-Robayo, M.C., and Lynch, J.D (1996). ''Lista actualizada de la fauna de Amphibia de Colombia.'' Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20(77), 365-415.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Shi, Y-B. (2000). Amphibian Metamorphosis: From Morphology to Molecular Biology. Wiley-Liss, Inc., New York.
  • Starrett, P. (1960). ''Descriptions of tadpoles of Middle American frogs.'' Miscellaneous Publications Museum of Zoology, University of Michigan, 110, 5-37.
  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Valerio, C.E. (1971). ''Ability of some tropical tadpoles to survive without water.'' Copeia, 1971(2), 364-365.
  • Vonesh, J. R., and Warkentin, K. M. (2006). ''Opposite shifts in size at metamorphosis in response to larval and metamorph predators.'' Ecology, 87(3), 556-562.
  • Warkentin, K. M. (1995). ''Adaptive plasticity in hatching age: A response to predation risk trade-offs.'' Proceedings of the National Academy of Sciences, 92, 3507-3510.
  • Warkentin, K. M. (2000). ''Environmental and developmental effects on external gill loss in the Red-Eyed Tree Frog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 73(5), 557-565.
  • Warkentin, K. M. (2000). ''Wasp predation and wasp-induced hatching of red-eyed treefrog eggs.'' Animal Behavior, 60, 503-510.
  • Warkentin, K. M. (2002). ''Hatching timing, O2 availability and external gill regression in the treefrog, Agalychnis callidryas.'' Physiological and Biochemical Zoology, 75, 155-164.
  • Warkentin, K. M. (2005). ''How do embryos assess risk? Vibrational cues in predator-induced hatching of red-eyed treefrogs.'' Animal Behavior, 70, 59-71.
  • Warkentin, K. M., Buckley, C. R., and Metcalf, K. A. (2006). ''Development of red-eyed treefrog eggs affects efficiency and choices of egg-foraging wasps.'' Animal Behavior, 71, 417-425.
  • Warkentin, K. M., Caldwell, M. S., Siok, T. D., D'Amato, A. T., and McDaniel, J. G. (2007). ''Flexible information sampling in vibrational assessment of predation risk by red-eyed treefrog embryos.'' The Journal of Experimental Biology, 210, 614-619.
  • Warkentin, K. M., Caldwell, M. S., and McDaniel, J. G. (2006). ''Temporal pattern cues in vibrational risk assessment by embryos of the red-eyed treefrog, Agalychnis callidryas.'' Journal of Experimental Biology, 209, 1376-1384.
  • Warkentin, K. M., Currie, C. R., and Rehner, S. A. (2001). ''Egg-killing fungus induces early hatching of red-eyed treefrog eggs.'' Ecology, 82(10), 2860-2869.
  • Warkentin, K. M., and Wassersug, R. J. (2001). ''Do prostaglandins regulate external gill regression in anurans?'' Journal of Experimental Zoology, 289, 366-373.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Agalychnis callidryas

For another species commonly known as the red-eyed tree frog, see Litoria chloris

The red-eyed tree frog (Agalychnis callidryas) is an arboreal hylid native to Neotropical rainforests in Central America.

As its name suggests, the red-eyed tree frog has red eyes with vertically narrowed pupils. It has a vibrant green body with yellow and blue vertically striped sides. Its webbed feet and toes are orange or red. The skin on the red-eyed tree frog's stomach is soft and fragile skin, whereas the back is thicker and rougher.

The red-eyed tree frog has three eyelids, and sticky pads on its toes. Phyllomedusid tree frogs are arboreal animals, meaning they spend a majority of their lives in trees; they are excellent jumpers.

Specimen in camouflage mode
A. callidryas at night

Red-eyed tree frogs are not poisonous and rely on camouflage to protect themselves. During the day, they remain motionless, cover their blue sides with their back legs, tuck their bright feet under their stomachs, and shut their red eyes. Thus, they appear almost completely green, and well hidden among the foliage.

Diet[edit]

Red-eyed tree frogs are insectivores that eat crickets, moths, flies, and other insects.

Threats[edit]

The following have been listed as threats to the survival of the species on the IUCN Red List:[1]

  • Residential and commercial development
    • Housing and urban areas
  • Agriculture and aquaculture
    • Annual and perennial nontimber crops
      • Shifting agriculture
      • Small-holder farming
      • Agroindustrial farming
    • Livestock farming and ranching
      • Small-holder grazing, ranching or farming
      • Agroindustrial grazing, ranching or farming
  • Biological resource use
    • Logging and wood harvesting
  • Pollution
    • Agricultural and forestry effluents

Reproduction[edit]

Red-eyed tree frogs in axillary amplexus

During mating season, the male frogs shake the branches where they are sitting to improve their chances of finding a mate by keeping rivals at bay. This is the first evidence that tree-dwelling vertebrates use vibration to communicate.[2] When rainfall is at its highest, a male red-eyed tree frog calls "chack" to get the attention of the female. During amplexis, the female carries the male on her back for up to several hours during the oviposition process. The female chooses a leaf above a pond or large puddle, on which to lay her clutch of eggs. The eggs develop into small tadpoles, which hatch after six to seven days and fall into the water below.[3] Red-eyed tree frog eggs exhibit phenotypic plasticity and will hatch earlier if a change in the environment, such as a predator or environmental change signals a danger to their survival.[4] Dragonflies, fish, and water beetles prey on the tadpoles. The tadpoles remain in the water from three weeks to several months, until they metamorphose into frogs. Snakes, spiders, bats, and birds of the rainforest prey on this frog. The young frogs that survive the first few weeks after metamorphosis move into the undergrowth and security of plants near their natal pools, often into the hollows of tubular plants such as bromeliads. Young frogs prey on very small flies and other insects during the first months of their lives. The young mature after two years and begin mating at the age of 3–4 years. These tree frogs are known to live up to five years (data from captive breeding programs), depending on the health and conditions of their habitat (i.e. abundant plant growth, plenty of fresh water, and an abundance of small and larger insects on which to prey).

They sometimes breed successfully in captivity if kept under adequate conditions in high-humidity vivaria (e.g. by using misting equipment), tropical plants such as Bromelia and other epiphyte plants, together with well-aerated water pools. Their captive habitat should have a light cycle with 11–12 hours of daylight and an average day temperature of 26–28 °C (and night-time averages of 22–35 °C). Simulating a rainy season once a year in November/December will encourage reproduction.

Distribution and habitat[edit]

Red-eyed tree frogs inhabit areas near rivers and ponds in rainforests from southern Mexico, through Central America, to northern Colombia.

See also[edit]

References[edit]

  1. ^ a b Frank Solís, Roberto Ibáñez, Georgina Santos-Barrera, Karl-Heinz Jungfer, Juan Manuel Renjifo & Federico Bolaños (2008). "Agalychnis callidryas". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved October 7, 2013. 
  2. ^ Caldwell, Michael S.; Johnston, Gregory R.; McDaniel, J. Gregory; Warkentin, Karen M. "Vibrational Signaling in the Agonistic Interactions of Red-Eyed Treefrogs". Current Biology 20 (11): 1012–1017. doi:10.1016/j.cub.2010.03.069. 
  3. ^ William F. Pyburn (1970). "Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllomedusa dacnicolor in Mexico". Copeia 1970 (2): 209–218. JSTOR 1441643. 
  4. ^ Fields, Helen. (2013 January). The frog that roared. Smithsonian, 54–61.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!