Overview

Comprehensive Description

Description

Tympanic membrane absent. Transversal processes of the vertebra sacralis notably widened. Pupil of the eye triangular. No male resonators. Skin tuberculate. Dorsal skin with very high, quite acute tubercles. The tubercles are the highest among the three species of Bombina in the former USSR. The tops of the tubercles are sometimes so rough that they feel like short needles. Belly is smooth, with small tubercles present only near the cloaca. Dorsal surface brown gray to gray-greenish or bright green with dark spots. Belly red or red-orange to yellow with dark spots. Bright spots fused forming an irregular pattern. The bright coloration exceeds the dark coloration in area on the belly. The male differs from the female by having nuptial pads on the first and second fingers.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Stejneger, L. H. (1907). Herpetology of Japan and Adjacent Territory, United States National Museum Bulletin 58. Smithsonian Institution, Washington, D. C..
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Won, H.-K. (1971). Choson Ryangso Pyachyungryuchji [Amphibian and Reptilian Fauna of Korea]. Korean Academy of Sciences, Pyongyang.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. and Adler, K. (1993). Herpetology of China. Society for the Study of Amphibians and Reptiles, Oxford, Ohio.
  • Zhao, E. and Zhao, H. (1994). Chinese Herpetological Literature: Catalogue and Indices. Chengdu University of Science and Technology, Chengdu.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Bombina orientalis is found in northeast China (the provinces of Heilongjiang, Hebei, Shandong, Anhui, and Lianoning). These toads can also be found in Korea, Thailand, and southern Japan (the islands of Kiushiu and Tsushima). Bombina orientalis also occurs in the Primorye and Khabarovsk regions of Russia.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found in northeastern China, throughout the Democratic People's Republic of Korea and the Republic of Korea and in the Khabarovsk and Primorye regions in Russia. Records of this species from southern Japan (Tsushima and Kiushiu islands) are now believed to be in error (M. Matsui pers. comm.). There is a small-introduced population of this species close to Beijing. It is a lowland species present to 500m asl (Russia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Bombina orientalis inhabits Northeastern China (provinces of Anhui, Shandong, Hebei, Liaoning, Jilin and Heilongjiang), Korea, Southern Japan (Tsushima and Kiushiu islands), and the Khabarovsk and Primorye regions in Russia. Part of the range in the Lianoning Province, China, seems to be isolated from the other parts. The northernmost locality is Arsenievo Village, Nanai District, Khabarovsk Region in Russia (ca. 48o40'N, 137o12'E).

The species lives in various landscapes, as a rule, in mixed coniferous - broad-leaved forests. However, it often occurs in other habitats, including spruce, pine or leafed forests, open meadows, river valleys, swampy bushlands, etc. Bombina orientalis uses different types of bodies of water with stagnant (sometimes running) water: lakes, ponds, swamps, streams, springs, ditches, puddles etc. At the end of summer, the species can be found on land at distances up to few hundred meters from water.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Stejneger, L. H. (1907). Herpetology of Japan and Adjacent Territory, United States National Museum Bulletin 58. Smithsonian Institution, Washington, D. C..
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Won, H.-K. (1971). Choson Ryangso Pyachyungryuchji [Amphibian and Reptilian Fauna of Korea]. Korean Academy of Sciences, Pyongyang.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. and Adler, K. (1993). Herpetology of China. Society for the Study of Amphibians and Reptiles, Oxford, Ohio.
  • Zhao, E. and Zhao, H. (1994). Chinese Herpetological Literature: Catalogue and Indices. Chengdu University of Science and Technology, Chengdu.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Oriental fire-bellied toads are dark-colored dorsally, ranging from brownish-gray to bright green. When the dorsal surface is colored more vividly, dark spots are typically also present. The ventral surface is brightly colored, usually with dark spots over brilliant red-orange or yellow reticulated patterns (hence the name "fire-bellied"). The pupils are triangular. The skin is covered in tubercles (warts), except on the ventral surface, where tubercles are only present near the cloaca (the terminal part of the gut). Of the three species in the genus Bombina, Oriental fire-bellied toads have the most pronounced tubercles. Tubercles on the ventral side of the animal are elevated and acute, sometimes feeling like sharp needles. These toads have no tympanic membrane.

Females are generally larger than males. During the breeding season, males develop nuptial pads on their first and second fingers, have more tuberculate skin, and have thicker forearms.

Range length: 3.5 to 8 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Oriental fire-bellied toads occupy a variety of different habitats. They live at high elevations in spruce, pine or deciduous forests, river valleys, swampy bushlands, and open meadows. Bombina orientalis lives in or around various water types, including stagnant and running water in lakes, ponds, swamps, streams, springs, even puddles and ditches. Typically, this species stays relatively close to water, but in late summer they occur up to a few hundred meters from water.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It inhabits mixed coniferous and broad-leaved forests, open meadows, river valleys and swampy bush lands. It breeds in streams, pools, paddy fields, ditches and other waterbodies. This species can adapt to modified habitats.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oriental fire-bellied toads, like most frogs and toads, primarily perceive prey through movement. They wait patiently for their prey to draw near and then pounce quickly to capture the prey. As larvae, Oriental fire-bellied toads consume algae, fungi, detritus, plants, and protozoans. As adults, their diet consists of terrestrial invertebrates, including worms, molluscs, and insects.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Plant Foods: algae

Other Foods: fungus; detritus ; microbes

Primary Diet: carnivore (Insectivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Oriental fire-bellied toads prey upon terrestrial invertebrates and are also preyed on by bird species and larger aquatic animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main predators of Bombina orientalis are birds and larger aquatic animals. Oriental fire-bellied toads are poisonous to eat and, when threatened, they exhibit a posture known as unkenreflex. They flip on their backs and arch their spines. The brilliant warning spots on their underside warn potential predators of their toxicity and may deter predation. Their dull-colored back provides perfect camouflage to blend in with the muddy waters they inhabit.

Known Predators:

  • larger, predatory birds (Aves)

Anti-predator Adaptations: aposematic ; cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Vocalizations are the primary form of communication and are mostly used during the mating season. Oriental fire-bellied toads have a soft, musical call that sounds like a tapering "oop...oop...ooop." Males croak to attract females, and to warn other males of mistaken identity.

Like most frogs and toads, Oriental fire-bellied toads use vision primarily to detect prey.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oriental fire-bellied toad females lay eggs in clusters of 3 to 45. These clusters are deposited every 7 to 10 days. with a total clutch size of 38 to 257 eggs. Typically, eggs are laid on submerged plants near water's edge. Eggs hatch after a period of 3 to 10 days. In the first week following hatching, the tiny larvae absorb their yolk sacs. Oriental fire-bellied toad tadpoles have a gill slit on the ventral surface that projects outward, this gill slit is called a spiracle. After about 6 to 8 weeks, the hind legs and the lungs start to take shape. After 10 to 14 weeks, tadpoles reach about 3.5 cm in length and begin to metamorphose. After the 12th week, they start to emerge from the water and lose their tails. The transformation process into an adult toad takes approximately 5 months.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Bombina orientalis can live up to a maximum of 30 years in captivity. Maximum longevity in the wild is estimated at 20 years.

Range lifespan

Status: wild:
20 (high) years.

Range lifespan

Status: captivity:
30 (high) years.

Average lifespan

Status: captivity:
2.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (captivity) Observations: In the wild, these animals may live up to 13 years (Smirina 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males court females by continuously calling while floating in shallow water. The mating call sounds like a bark and lasts about twelve seconds. Males sit and croak until a female approaches for mating.

In the wild, there are often more males than females at breeding sites, sometimes as many as ten males for every female. Waiting males jumps onto the back of passing toads, hoping it to be a female. Inevitably, males sometimes jump on other males. The target male lets out a loud croak to indicate a mistake has been made. When a female is encountered, the male and female enters amplexus. Females swim around with the male hanging on, fertilizing the eggs as she lays them.

Mating System: polygynandrous (promiscuous)

After fertilization, the jelly layers of the eggs absorb water and swell. The eggs remain in this "jelly" state until hatching. Breeding begins with warming weather in the spring and continues throughout the summer. Breeding occurs from May through mid-August eggs hatch after 3 to 10 days. Most hatching occurs in June and July. Females are capable of laying more than one clutch per season. They deposit from 38 to 257 eggs in portions from 3 to 45 eggs every 7 to 10 days. In captivity, the breeding season begins after a cooling winter period with simulated rain.

Breeding interval: Breeding may occur multiple times during a year.

Breeding season: Breeding occurs throughout the warm season, from May to mid-August.

Range number of offspring: 38 to 257.

Range time to hatching: 3 to 10 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Bombina orientalis larvae hatch 3 to 10 days after egg laying. There is no direct parental care. The young are left to fend for themselves following hatching. Indirectly, females can influence development of their young by varying the environment the eggs are placed in and energy investment in the eggs. Egg size and water temperature are two such factors. In cold water, larvae that developed from larger eggs had greater fitness than those that developed from small eggs. In warmer environments, larvae that developed from small eggs had greater fitness than those that developed from large eggs.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Lungs help detect sound: fire-bellied toad
 

The lungs of the fire-bellied toad allow the toad to hear in the absence of a tympanic middle ear, because sound waves permeate through the mouth and skin, then resonate in the lungs before passing to the inner ears.

   
  "How is it possible for a land vertebrate to hear if it has neither external nor middle ears to transmit sounds from the outside world to its inner ears? One species that can do so is the fire-bellied toad (Bombina orientalis). It is responsive to a wide range of airborne noises, and is also a versatile vocalist -- but how can it detect sound waves? In 1999, Ohio State University researchers Dr. Erik Lindquist and Dr. Thomas Hetherington unmasked its remarkable secret.

"Sound waves travel through its mouth and skin, entering its lungs, where they resonate before passing through the soft tissue around the lungs and into the inner ears. This auditory system should function underwater, too. Indeed, since sound waves travel faster through water than air, it should be more efficient there." (Shuker 2001:39)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombina orientalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGACTCTTTTCGACAAATCACAAAGATATCGGCACCCTATATTTAGTCTTTGGTGCCTGAGCCGGAATGGTTGGAACTGCTCTCAGCTTGCTAATTCGAGCAGAGCTAAGCCAGCCTGGAACCTTGCTTGGAGACGACCAGATTTATAATGTAATCGTTACCGCCCACGCCTTCGTAATAATCTTCTTTATAGTTATACCCATCATGATCGGCGGATTTGGTAACTGACTAGTTCCACTAATAATTGGAGCCCCAGACATAGCCTTCCCTCGAATAAACAACATAAGCTTTTGACTTCTTCCCCCCTCGTTCCTACTACTTTTAGCATCATCAGGTGTGGAGGCGGGAGCCGGGACGGGTTGAACTGTCTATCCGCCATTGGCAGGAAACTTGGCCCACGCCGGAGCATCAGTAGACTTAACCATTTTTTCTTTACACCTTGCCGGAGTGTCCTCAATTCTAGGCGCTATTAATTTTATTACAACAACAATCAACATAAAACCACCAGCAATATCACAATACCAAACGCCATTATTTGTGTGATCCGTGCTAATTACAGCTATTCTCTTACTCCTCTCGCTTCCCGTTCTTGCTGCAGGAATCACCATACTTCTCACGGACCGCAATTTAAATACAACCTTTTTCGACCCTGCCGGGGGAGGAGACCCTGTACTGTATCAACACTTATTCTGATTCTTTGGTCACCCAGAGGTTTATATTCTCATTTTACCCGGCTTTGGCATGATTTCACATATTGTAACATACTATTCTGGCAAAAAAGAGCCATTTGGCTATATGGGCATAGTCTGAGCCATGATATCTATCGGCCTACTAGGTTTTATTGTCTGAGCCCACCACATATTTACAGTAGACCTAAATGTAGACACTCGAGCCTACTTTACCTCAGCAACAATAATTATTGCAATTCCAACAGGCGTGAAAGTTTTCAGTTGATTAGCCACAATGCACGGAGGCACAATTAAATGAGACGCAGCCATATTATGGGCATTAGGCTTCATTTTCCTGTTCACAGTTGGGGGTTTAACCGGCATTGTTCTTGCCAACTCCTCATTAGACATTGTTCTTCATGATACTTACTACGTCGTAGCCCACTTCCACTATGTCTTATCAATGGGGGCCGTATTCGCTATCATGGGCGGATTTGTCCACTGATTCCCCCTATTCACCGGGTACACCCTCCACGAGACTTGAACAAAAATCCACTTCGGCGTAATATTTGCAGGAGTAAACTTAACATTCTTCCCCCAACACTTCCTAGGGTTAGCCGGAATACCTCGACGTTACTCTGACTACCCTGATGCATACACCCTTTGAAACACAGTCTCGTCAGTGGGCTCTCTAATTTCTCTTGTAGCCGTAATTATGATAATATTTATCATCTGAGAAGCATTCTCAACAAAACGGGAGGTCCTTCTCACCGAACTAACTTCAACTAATATTGAGTGACTTCACGGCTGCCCTCCCCCCTACCACACATTTGAAGAACCAGCATTTGTTCAAACACCATACCGGGCTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombina orientalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Bombina orientalis is not currently considered a threatened species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Sergius Kuzmin, Li Pipeng, Masafumi Matsui, Vladimir Ishchenko, Irina Maslova

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is regarded as common in both China and Russia.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Bombina orientalis is one of the most common amphibians in the central part of the range, comprising a large proportion (to 29%) of their total number. The population density at breeding sites reaches 8.0 specimens per square meter. However, the toad becomes rarer northwards. In Khabarovsk Region, at the northern margin of its range, the toad is a rare species, known by only a few individuals.

The toad hibernates from late September - October to late April - May, on land: in rotten trees, heaps of stones, leaves, in groups of 1-6 individuals. Sometimes hibernation occurs in streams. Reproduction occurs in May - mid-August. The reproductive period is very long within each population because different females deposit eggs at a different time. The process of egg deposition is gradual: there are no peaks in spawning intensity. The male mating call resembles that of the Fire-Bellied Toad (Bombina bombina). Breeding pairs are formed randomly. Amplexus is pelvic. The clutch contains 38-257 eggs deposited in portions of 3-45 eggs. The interval between deposition of subsequent portions is 7-10 days. Probably, females are capable of depositing multiple clutches. Embryonic and larval development take about 2 months, and hatching takes place usually from early June to late July. Tadpoles complete metamorphosis usually by the end of August - late September. Maximum longevity is estimated as 20 years.

Larvae consume detritus, various algae, fungi, higher plants, protozoans and, in smaller amounts, Oligochaeta, Naiadomorpha, Rotatoria and Microcrustacea(Daphniidae, Sididae, Chydoridae, Ostracoda). The tadpole diet widens during ontogeny because of an increase in plant and animal diversity. Preying upon of terrestrial invertebrates (Acarina, Collembola) starts before the completion of metamorphosis while the toadlets still have a small tail rudiment. Adult food consists of terrestrial invertebrates including worms, molluscs and insects. The proportion of aquatic invertebrates (Gastropoda, Notonectidae, Dytiscidae, etc.) varies among populations.

Some predatory birds and mammals are known as natural enemies of this species. The defensive posture of adult individuals is similar to that of the European Fire-Bellied Toad (B. bombina).

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Stejneger, L. H. (1907). Herpetology of Japan and Adjacent Territory, United States National Museum Bulletin 58. Smithsonian Institution, Washington, D. C..
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Won, H.-K. (1971). Choson Ryangso Pyachyungryuchji [Amphibian and Reptilian Fauna of Korea]. Korean Academy of Sciences, Pyongyang.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. and Adler, K. (1993). Herpetology of China. Society for the Study of Amphibians and Reptiles, Oxford, Ohio.
  • Zhao, E. and Zhao, H. (1994). Chinese Herpetological Literature: Catalogue and Indices. Chengdu University of Science and Technology, Chengdu.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is generally threatened by habitat loss and degradation. In Russia, the collection of animals for traditional Chinese medicine might be a potential threat. Moderate numbers are exported, mainly to western Europe and North America in the international pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present within a number of protected areas in China and the Korean Peninsula and six nature reserves in Russia. It is listed on the Red Data Book of Khabarovskii Region, Russia. There is a need to monitor the relatively small Russian population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bombina orientalis is a poisonous species, although are popular as pets. Their skin toxin is not poisonous to human skin, but is harmful when rubbed in the eyes, mouth, or on broken skin. Hands should be washed thoroughly before and after handling. Handling oriental fire-bellied toads can result in itchy eyes and a runny nose.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bombina orientalis is a popular toad species in the exotic pet trade. They are hardy animals with long lifespans.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

This toad is an opportunistic species; it is common in agricultural landscapes and often occurs in villages.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Stejneger, L. H. (1907). Herpetology of Japan and Adjacent Territory, United States National Museum Bulletin 58. Smithsonian Institution, Washington, D. C..
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Won, H.-K. (1971). Choson Ryangso Pyachyungryuchji [Amphibian and Reptilian Fauna of Korea]. Korean Academy of Sciences, Pyongyang.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. and Adler, K. (1993). Herpetology of China. Society for the Study of Amphibians and Reptiles, Oxford, Ohio.
  • Zhao, E. and Zhao, H. (1994). Chinese Herpetological Literature: Catalogue and Indices. Chengdu University of Science and Technology, Chengdu.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oriental fire-bellied toad

The Oriental fire-bellied toad (Bombina orientalis) is a small (4 cm, 2") semiaquatic frog species found in Korea, northeastern China, and adjacent parts of Russia. An introduced population exists near Beijing. They are commonly kept as pets in land and water vivaria. B. orientalis is also known as the 'tuti toad'.

It may properly be referred to as a frog, despite its common name, because of the tubercles on its back.[2]

Description[edit]

Oriental fire-bellied toads, species of Bombina, are typically a bright green with black mottling on their dorsal regions, but their complexion may also darken to brown and even black depending on their background scenery.[citation needed] Like other Bombina species, B. orientalis has a bright yellow to red (generally bright reddish-orange) ventral region mottled with dark brown to black. The skin on its dorsal side is covered in small tubercles, and although it is typically referred to as a toad, the fire-bellied toad is not a true toad - family Bufonidae.

They are noted for the bright green and black coloration on their backs, and orange and black on their undersides. In the wild, B. orientalis eats various small aquatic arthropods (among other things) from which they obtain beta-carotene, which aids in the coloration in the ventral region. These bright colors serve as a warning to predators of toxicity. The toxin is secreted through the skin mostly from the hind legs, and sometimes the belly, in a milky-like substance when the frog is disturbed or frightened. Not only will this frog emit this toxin, it will also lie on its back to show the color of its belly, indicating its toxicity to any predators.

Habitat[edit]

Like other Bombina species, B. orientalis is semiaquatic, inhabiting warm, humid forested regions. It spends most of its time on land.

Reproduction[edit]

Breeding takes place in the spring with the warming of the weather and increase in rain. Males call to the females with a light barking croak. They jump onto the back of any other fire-bellied toad that happens to pass by, often leading to male-male confusion, but rarely any sort of fighting. Females lay 40 to 100 eggs in a large cluster, usually around submerged plants, near the water's edge. Tadpoles hatch from the eggs in three to 10 days depending on the temperature of the water. The tadpoles begin to develop legs in 6–8 weeks, and are fully metamorphosed and begin venturing on land in 12–14 weeks.

In captivity[edit]

In the United States, B. orientalis is commonly kept as a pet. They are generally a hardy species that do well in captivity if given enough food and good water quality. They are commonly fed with small crickets dusted with a calcium powder. They can also be fed with other small invertebrates such as earthworms. They should not be fed mealworms, as these larvae possess hard shells which fire-bellied toads have a hard time digesting or passing.[3]

While not the most toxic of amphibians, regular handling is not recommended and hands should always be washed thoroughly immediately after touching the frog or cleaning the tank. Although harmless to the skin, if ingested, the mucus can cause discomfort. Because of their mild toxicity, Oriental fire-bellied toads should not be kept with most other types of frog or amphibian.

In captivity, oriental fire-bellied toads have lived for more than a dozen years, with 15 years being common. Some older reports document them as living up to 30 years. In captivity, providing a source of beta-carotene (such as carrots) to the prey insects (crickets) early in a frog's adult stage allows it to develop brighter coloration.[4]

Oriental fire-bellied toads should be kept in water, with some kind of land or island to allow them to periodically climb out of the water. These frogs are not strong swimmers and may (but rarely) drown in water that is too deep. An ideal enclosure has plenty of land and water-based hiding places, as well as a land-based location suitable for depositing live food. Fire-bellied toads have a sensitivity to chlorine and chloramine - tap water should be treated or allowed to stand for several days, to allow chlorine to dissipate, before adding it to their environment. Chloramine will not dissipate in this manner, so tap water treated with chloramine must be treated with a dechloramine agent (and then allowed to stand) before being added.

References[edit]

  1. ^ Sergius Kuzmin, Li Pipeng, Masafumi Matsui, Vladimir Ishchenko, Irina Maslova (2004). "Bombina orientalis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 3 November 2012.  Database entry includes a range map and a brief justification of why this species is of least concern
  2. ^ Zoo Med Laboratory, Inc. (2012). "Bombina orientalis". Zoo Med. Retrieved 15 October 2013.
  3. ^ http://www.wikihow.com/Care-for-Fire-Belly-Toads Care For Fire Belly Toads on WikiHow.
  4. ^ Care and Raising of Oriental Firebellied Toads

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!