Overview

Comprehensive Description

Dyspanopeus sayi is a member of the family Carpiliidae.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Introduced south-west of England (Swansea) (Clark, 1986)
  • d'Udekem d'Acoz, C. (1999). Inventaire et distribution des crustacés décapodes de l'Atlantique nord-oriental, de la Méditerranée et des eaux continentales adjacentes au nord de 25°N [Inventory and distribution of the decapod crustaceans from the northeastern Atlantic, the Mediterranean and the adjacent continental waters north of 25°N]. Collection Patrimoines Naturels, 40. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-86515-114-10. X, 383 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southern Gulf of St. Lawrence to the Florida Keys
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Say's mud crab is endemic in the Western Atlantic Ocean from Canada to Florida (Mistri 2004) and has also been found in along the Eastern Atlantic coast. Dyspanopeus sayi is found in the Indian River Lagoon.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Individuals of Say's mud crab can live to a maximum of 2 years. Adults have a maximum carapace width of 30 mm and males reach maturity at the approximate size of 16 mm (Strieb et al. 1995). In Long Island Sound, males are reported to be more abundant than females.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Neopanope texana nigrodigita Rathbun
Catalog Number: USNM 69344
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male; female;
Preparation: Alcohol (Ethanol)
Collector(s): G. Lunz
Year Collected: 1934
Locality: Isle Of Palms, South Carolina, United States, North Atlantic Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 464 specimens in 1 taxon.
Water temperature and chemistry ranges based on 44 samples.

Environmental ranges
  Depth range (m): 0 - 37
  Temperature range (°C): 11.710 - 25.634
  Nitrate (umol/L): 0.289 - 1.976
  Salinity (PPS): 32.426 - 36.091
  Oxygen (ml/l): 4.671 - 6.349
  Phosphate (umol/l): 0.100 - 0.515
  Silicate (umol/l): 0.756 - 2.362

Graphical representation

Depth range (m): 0 - 37

Temperature range (°C): 11.710 - 25.634

Nitrate (umol/L): 0.289 - 1.976

Salinity (PPS): 32.426 - 36.091

Oxygen (ml/l): 4.671 - 6.349

Phosphate (umol/l): 0.100 - 0.515

Silicate (umol/l): 0.756 - 2.362
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 37

Graphical representation

Depth range (m): 1 - 37
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Dyspanopeus sayi uses its large crusher claw to break open the shell of shallow water bivalves (Mistri 2004).
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Say's mud crab takes refuge in colonies of mud-burrowing polychaetes to avoid predation by blue crabs (Heck and Hambrook 2008).Fishery: Because Callinectes ornatus occupies the same habitats as the commercial species, C. sapidus, it is impacted by the crab fishery along western Atlantic coast (Hsueh et al. 1992).
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Neopanope texana sayi is prey of:
Callinectes sapidus

Based on studies in:
USA: New Jersey (Brackish water)

This list may not be complete but is based on published studies.
  • C. H. Peterson, The importance of predation and competition in organizing the intertidal epifaunal communities of Barnegat Inlet, New Jersey, Oecologia (Berlin) 39:1-24, from p. 8 (1979).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Neopanope texana sayi preys on:
Modiolus demissus
Molgula manhattensis

Based on studies in:
USA: New Jersey (Brackish water)

This list may not be complete but is based on published studies.
  • C. H. Peterson, The importance of predation and competition in organizing the intertidal epifaunal communities of Barnegat Inlet, New Jersey, Oecologia (Berlin) 39:1-24, from p. 8 (1979).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

In Long Island Sound, the density of Dyspanopeus sayi in eelgrass beds is up to 225 individuals per m2 but in open areas they are more scarce, with densities of only 0.5 m2 (Strieb et al. 1995). Recruitment of juveniles between late August and early October increases the density of Say's mud crab by 3- to 4-fold depending upon the site.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Dyspanopeus sayi has separate sexes.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

There are three zoeal stages before the megalopa.
  • Heck KL, Jr and JA Hambrook. 2008. Intraspecific interactions and risk predation for Dyspanopeus sayi (Decapoda: Xanthidae) living on polychaete (Filograna implexa, Serpulidae) colonies. Marine Ecology 12:243-250.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Mistri M. 2004. Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of Experimental Marine Biology and Ecology 312:385-398.
  • Strieb MD, Bricelli VM, and SI Bauer. 1995. Population biology of the mud crab, Dyspanopeus sayi, an important predator of juvenile bay scallops in Long Island (USA) eelgrass beds. Journal of Shellfish Research 14:347-357.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dyspanopeus sayi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATCTTTGGAGCATGAGCCGGCATAGTTGGTACCTCATTAAGTTTAATTATTCGAGCTGAACTAGGTCAACCTGGAACCCTTATTGGTAATGACCAAATCTATAATGTTGTAGTCACAGCCCACGCTTTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCACTAATATTAGGAGCACCTGATATAGCATTTCCTCGTATAAACAATATAAGATTTTGACTTCTTCCTCCATCTCTTACACTCCTTTTAATAAGAGGGATAGTCGAAAGAGGAGTTGGTACAGGATGAACTGTTTACCCTCCTTTAGCAGCGGCTATCGCCCACGCAGGAGCTTCCGTTGATATAGGAATCTTCTCCTTGCATTTAGCAGGTGTCTCCTCCATTTTAGGCGCCGTTAATTTTATAACAACTGTGATCAATATACGATCCTTCGGTATAACTATGGATCAAATGCCTTTATTTGTTTGAGCAGTATTCATTACTGCCATCCTATTACTTTTATCATTACCTGTACTAGCTGGCGCTATTACTATGCTCTTAACTGATCGTAATTTAAATACCTCATTTTTTGATCCTGCTGGAGGAGGTGACCCTGTATTATATCAGCACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dyspanopeus sayi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dyspanopeus sayi

Dyspanopeus sayi is a species of mud crab that is native to the Atlantic coast of North America. It has also become established outside its native range, living in Swansea Docks since 1960, the Mediterranean Sea since the 1970s, the North Sea since 2007 and the Black Sea since 2010. It can reach a carapace width of 20 mm (0.8 in), and has black tips to its unequal claws. It feeds on bivalves and barnacles, and is in turn eaten by predators including the Atlantic blue crab, Callinectes sapidus. Eggs are produced from spring to autumn, the offspring reach sexual maturity the following summer, and individuals can live for up to two years. The closest relative of D. sayi is D. texanus, which lives in the Gulf of Mexico; the two species differ in subtle features of the genitalia and the last pair of walking legs.

Description[edit]

Dyspanopeus sayi is a small crab, similar in appearance to Eurypanopeus depressus.[2] It reaches a maximum carapace width of 20 millimetres (0.8 in), with sexually mature females having a carapace 6.1 millimetres (0.24 in) or more across.[3] The carapace is roughly hexagonal, about 1.3–1.4 times as wide as long and strongly convex.[2] It has a finely granular surface,[4] and has a light covering of hair, especially towards the front and sides.[2] The chelae (claws) are unequal: the right claw is stouter, and the left claw is narrower.[4] The carapace is olive-green to brown, but the tips of the claws are black.[4]

Distribution[edit]

The natural range of D. sayi extends from the Baie des Chaleurs (eastern Canada) to the Florida Keys (south-eastern United States),[5] where it lives from the intertidal zone down to depths of 46 metres (151 ft).[6] It tolerates a wide range of temperatures and salinities.[6]

D. sayi has also been recorded from a number of locations in Europe.[7] The first sighting was in Swansea Docks, South Wales (United Kingdom) in 1960,[7] and the scientist who reported it, E. Naylor, believed there was "no doubt" that the species had arrived through trans-Atlantic shipping.[8] The first record from the Mediterranean Sea was made in 1993, when the species was discovered in the Venetian Lagoon (north-eastern Italy),[5] although it is thought to have been living there since the late 1970s.[4] In 2007, D. sayi was recorded from the North Sea coast of the Netherlands.[9] It was discovered in the Black Sea in 2010, living in Constanța harbour (Romania),[10] and in the Ebro delta of the Balearic Sea (western Mediterranean Sea) in 2012.[6]

Ecology[edit]

The bivalve mollusc Chamelea gallina is a food item for D. sayi in the Adriatic Sea.

Dyspanopeus sayi lives predominantly on muddy bottoms,[2] where it is a predator of bivalve molluscs.[6] In its native environment, it hides among colonies of polychaetes to avoid being preyed on by the Atlantic blue crab, Callinectes sapidus.[3] It is an important predator of the quahog, Mercenaria mercenaria, in Narragansett Bay, and of the barnacle Balanus improvisus in Delaware Bay.[2] In the Adriatic Sea, it has been observed to feed on the striped venus clam, Chamelea gallina, and the introduced Asian date mussel, Musculista senhousia.[11]

Life cycle[edit]

The life cycle of D. sayi begins with copulation, which normally takes place shortly after the female has moulted, while her exoskeleton is still soft.[12] Spawning occurs within hours or days of copulation, and the eggs are brooded on the female's pleopods (swimmerets) until they are ready to hatch. Females have been found carrying eggs from April to October;[2] in a study of crabs caught at Gloucester Point, Virginia in 1978, females were observed to carry between 686 and 14,735 eggs. The number of eggs increases with carapace width according to a power law; extrapolation of the power law suggests that the largest D. sayi females are capable of carrying over 32,000 eggs each.[12]

At 29 °C (84 °F), the eggs can take only 9 or 10 days to develop, and this increases to 16 days at temperatures of 20 °C (68 °F).[12] The young crabs hatch as zoea larvae, and pass through three further zoeal stages and one megalopa before becoming juveniles.[6] Juveniles are thought to reach maturity in the summer after they hatch.[2] The total lifespan of an individual can be up to 2 years.[3]

Taxonomy[edit]

The species had been noticed by the American zoologist Thomas Say, and formed part of the species he called "Cancer panope" – a junior homonym of "Cancer panope" Herbst, 1801,[13] which is itself a junior synonym of Sphaerozius scaber (Fabricius, 1798).[14] In 1869, Sidney Irving Smith described seven new species in the genus Panopeus, including "P. sayi", in addition to the twelve species already placed in the genus at that time.[13] Common names for the species include "Say's mud crab" and "Say mud crab".

Smith noted the similarity of the species to "Panopeus texanus", which had been described ten years earlier by William Stimpson, and Smith considered that the two might be the same species.[13] In 1880, John Sterling Kingsley and Alphonse Milne-Edwards independently synonymised "P. sayi" with "P. texana", which remained until Mary J. Rathbun moved both taxa to the genus Neopanope and re-established Smith's taxon as a subspecies of "N. texana".[15] She argued that the two taxa should be considered subspecies, as hybrids between them occurred, although the specimens she saw are now thought to be D. sayi.[15]

In 1972, Lawrence G. Abele re-examined "N. texanus texanus", "N. texanus sayi" and N. packardi, and concluded that they were all good species, and so re-elevated "N. sayi" to the rank of species.[15] In 1986, Joel W. Martin and Abele placed N. texanus and N. sayi in a separate genus, Dyspanopeus, reaffirming their close relationship.[16] However, P. texana only occurs in the Gulf of Mexico, and can be distinguished from P. sayi by the form of the fifth pereiopod (last walking leg) and that of the male gonopod.[17]

References[edit]

  1. ^ Michael Türkay (2012). "Dyspanopeus sayi (Smith, 1869)". World Register of Marine Species. Retrieved February 9, 2012. 
  2. ^ a b c d e f g Austin B. Williams (1965). "Marine decapod crustaceans of the Carolinas". Fishery Bulletin of the Fish and Wildlife Service 65 (1): 1–298. 
  3. ^ a b c Melany P. Puglisi (October 1, 2008). "Dyspanopeus sayi". Indian River Lagoon Species Directory. Smithsonian Institution. Retrieved February 9, 2012. 
  4. ^ a b c d "Dyspanopeus sayi (Smith, 1869) (Crustacea, Decapoda, Panopeidae)" (in Italian). Museo di Storia Naturale di Venezia. Retrieved February 9, 2012. 
  5. ^ a b Carlo Froglia & Simonetta Speranza (1993). "First record of Dyspanopeus sayi (Smith, 1869) in the Mediterranean Sea (Crustacea: Decapoda: Xanthidae)" (PDF). Quaderni dell'Istituto Ricerche Pesca Marittima 5 (2): 163–166. 
  6. ^ a b c d e Christoph D. Schubart, Guillermo Guerao & Pere Abelló (2012). "First record and evidence of an established population of the North American mud crab Dyspanopeus sayi (Brachyura: Heterotremata: Panopeidae) in the western Mediterranean" (PDF). Scientia Marina 76 (1): 79–85. doi:10.3989/scimar.03361.16A. 
  7. ^ a b Ana-Maria Petrescu, Ana-Maria Krapal, Oana Paula Popa, Elena Iulia Iorgu & Luis Ovidiu Popa (2010). "Xenodiversity of decapod species (Crustacea: Decapoda: Reptantia) from the Romanian waters" (PDF). Travaux du Muséum National d'Histoire Naturelle "Grigore Antipa" 53: 91–101. doi:10.2478/v10191-010-0006-7. 
  8. ^ E. Naylor (1960). "A North American xanthoid crab new to Britain". Nature 187 (4733): 256–257. Bibcode:1960Natur.187..256N. doi:10.1038/187256a0. 
  9. ^ S. Vaz, R. ter Hofstede, J. Martin, J.-M. Dewarumez, Y. Verin, D. Le Roy, H. Heessen & N. Daan (2007). "Benthic invertebrates community structure inferred from bottom trawl hauls observations and its relationships to abiotic conditions in the southern North Sea" (PDF). Structure and dynamics of the benthos in ICES waters. ICES Technical Report CM 2007/A: 03. 
  10. ^ Dragoș Micu, Victor Nițǎ & Valentina Todorova (2010). "First record of Say's mud crab Dyspanopeus sayi (Brachyura: Xanthoidea: Panopeidae) from the Black Sea" (PDF). Marine Biodiversity Records 3: e36. doi:10.1017/S1755267210000308. 
  11. ^ Michele Mistri (2004). "Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey". Journal of Experimental Marine Biology and Ecology 312 (2): 385–398. doi:10.1016/j.jembe.2004.07.012. 
  12. ^ a b c Richard C. Swartz (1978). "Reproductive and molt cycles in the xanthid crab, Neopanope sayi (Smith, 1869)". Crustaceana 34 (1): 15–32. doi:10.1163/156854078x00529. JSTOR 20103245. 
  13. ^ a b c Sidney Irving Smith (1869). "Notes on new of little known species of American cancroid Crustacea". Proceedings of the Boston Society of Natural History 12: 274–289. 
  14. ^ Peter Davie (2010). "Cancer panope Herbst, 1801". World Register of Marine Species. Retrieved February 9, 2012. 
  15. ^ a b c Lawrence G. Abele (1972). "A reevaluation of the Neopanope texanasayi complex with notes on N. packardii (Crustacea: Decapoda: Xanthidae) in the Northwestern Atlantic". Chesapeake Science 13 (4): 263–271. JSTOR 1351110. 
  16. ^ Joel W. Martin & Lawrence G. Abele (1986). "Notes on male pleopod morphology in the brachyuran crab family Panopeidae Ortmann, 1893, sensu Guinot (1978) (Decapoda)" (PDF). Crustaceana 50 (2): 182–198. doi:10.1163/156854086x00205. JSTOR 20104136. 
  17. ^ Harriet Perry & Kirsten Larsen (April 24, 2004). "Dyspanopeus texana (Stimpson, 1859) = Neopanope texana, Gulf grassflat crab" (PDF). Picture Guide to Shelf Invertebrates of the Northern Gulf of Mexico. Gulf States Marine Fisheries Commission. Retrieved February 9, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!