Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Description

Xenopus laevis varies in size; males (45.6 to 97.5 mm) tend to be be smaller than females (57 to 147 mm). Their heads and bodies are depressed and flattened and they have small round eyes on the top of their heads. The skin is smooth and the hind limbs are long and robust. The three inner toes of the large fully webbed feet have small black claws on them. The body color is usually dark-gray to greenish-brown dorsally, and pale ventrally (Trueb 2003).
  • Trueb, L. (2003). ''Common platanna, Xenopus laevis.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The range of this species is unclear following the removal from Xenopus victorianus from X. laevis. For the purposes of this assessment we have assumed that all animals from southern Angola, Zambia, Malawi and Mozambique southwards (including in almost all of Zimbabwe, Botswana, Namibia, South Africa, Lesotho and Swaziland) belong to X. laevis. In addition we treat all animals in Nigeria, Cameroon, Central African Republic, and the Democratic Republic of Congo west of 28ºE as belonging to X. l. sudanensis. Records from Tanzania, Kenya, Uganda, Rwanda, Burundi, Sudan and the Democratic Republic of Congo east of 28ºE refer to this X. victorianus. There is an isolated record from Gabon (M. Beier pers. comm. January 2006).

It is introduced in several places outside its native range, including the USA where it was first introduced in the 1930s and 1940s for laboratory use and later as an aquarium pet. It was introduced and established locally in California (San Diego, Orange, Riverside, Los Angeles, Ventura, and Imperial counties) and Arizona (Tucson area) (Stebbins 1985, Lafferty ad Page 1997). It has been recorded from, but it is not established in Colorado. It has also been introduced to Chile (introduced in the 1970s to central Chile, Valparaiso to Concepción Provinces), parts of the United Kingdom (extant in south Wales and presumed extirpated from the Isle of Wight [not mapped here], and a number of occasional records from other locations [not mapped], the Departments of Deux-Sèvres and Maine et Loire in France and Java (Indonesia) [not mapped here]. It is introduced also in the Lage stream, about 20 km W of Lisbon, Portugal (Rebelo et al. 2007) and there is a large invasive population in Sicily (Lillo et al. 2005, Faraone et al. 2008) [not mapped here]. It is presumed to occur in southwestern Sudan, but there do not appear to be confirmed records from this country (there is an uncertain record assigned to X. l. sudanensis from Jebel Marrah, Sudan (M. Beier pers. comm. January 2006) [not mapped here]). Records from Congo refer to X. petersii. Its range is also extending in parts of Africa, often by introduction because it is used for live bait, and it has spread extensively in South Africa. This species ranges from sea-level up to 3,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: Native to Africa. First brought to the U.S. in the 1930s and 1940s for laboratory use and later as an aquarium pet. Introduced and established locally in California (San Diego, Orange, Riverside, Los Angeles, Ventura, and Imperial counties) and Arizona (Tucson area) (Stebbins 1985, Lafferty ad Page 1997). Apparently established in Baja California (see Mahrdt et al. 2003). Recorded but not established in Colorado.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

Xenopus laevis occurs naturally in southern Africa. There are substantial introduced populations in California, Chile, Great Britain, and probably many other locations around the world. (Nieukoop and Faber, 1994)

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

This species occurs in savannas of the Republic of South Africa, Kenya, Uganda, Democratic Republic of Congo, and Cameroon. This frog has high tolerance to change in its environment and will survive in nearly any body of water. It can be found in water bodies ranging from ice-covered lakes to desert oases. Unlike most frogs, the African clawed frog can also survive in water with high salinity (Trueb 2003).
  • Trueb, L. (2003). ''Common platanna, Xenopus laevis.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

X. laevis is widely distributed in sub-Saharan Africa.

Within its southern distribution, it is a common and widespread species, occurring from sea level to nearly 3000 m in Lesotho. In the west, it is apparently absent in areas of extreme aridity, including much of the Kalahari and Bushmanland in Northern Cape Province. Its distribution extends eastward as far as the Great Escarpment, where it comes into contact with X. muelleri in the low-lying parts of Limpopo and Mpumalanga provinces (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Xenopus laevis has a unique morphology because it lacks a tongue and a visible ear. The body is flattened and head is wedge-shaped and smaller than the body. It has two small eyes found on the top of the head and no eyelids. Its front limbs are small and are not webbed, and its hind legs are large and webbed and the three inside toes on either foot have claws. It has smooth slippery skin which is multicolored on its back with blotches of olive gray or brown and gray, while the underside is creamy white with a yellow tinge. It has lateral lines along its back. Males weigh about 60 grams, are about 5 to 6 centimeters long, and lack a vocal sac, which most male frogs have. Females weigh about 200 grams, are about 10 to 12 centimeters long, and have cloacal extensions at the end of the abdomen.

(Kaplan, 1995; Chang 1998)

Range mass: 60 to 200 g.

Range length: 5 to 12 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average basal metabolic rate: 0.012 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a water-dependent species occurring in a very wide range of habitats, including heavily modified anthropogenic habitats. It lives in all sorts of waterbodies, including streams, but tends to avoid large rivers, and waterbodies with predatory fish. It reaches its highest densities in eutrophic water. It breeds in water; there are no records of it breeding in flowing water. It has very high reproductive potential. It is a highly opportunistic species, and colonizes newly recreated, apparently isolated, waterbodies with ease. It can migrate in large numbers when breeding ponds start to dry up, and the weather is wet.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Xenopus laevis lives in warm, stagnant grassland ponds as well as in streams in arid and semi-arid regions. The ponds are usually devoid of any higher plant vegetation, and covered in green algae. Xenopus laevis can tolerate wide variation in water pH, but the presence of metal ions proves toxic. It thrives in temperatures from 60 to 80 degrees Fahrenheit. It is almost totally aquatic, only leaving the water when forced to migrate.

(Nieuwkoop and Faber, 1994; Beck, 1994; Kaplan, 1995, Jack Crayon, personal communication)

Habitat Regions: temperate ; tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In the U.S., found in slow streams, irrigation canals, ponds, and lakes. Eggs are attached to aquatic plants or other submerged vegatation, logs, or rocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Prior to the advent of modern agriculture, X. laevis probably occurred in low densities in natural water bodies, such as streams, rivers and their pools. Nowadays, however, the species is also found in a variety of man-made water bodies such as farm dams, ponds, sewage purification works and fish farms. Eutrophic waters seem to produce the highest densities (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Xenopus laevis is a scavenger and eats living, dead, or dying arthropods and other pieces of organic waste. It has a voracious appetite and attacks anything that passes in front of it. It uses extremely sensitive fingers, an acute sense of smell, and its lateral line systems to locate food. Lateral line systems, usually found in fish, detect vibrations in the water. It uses a hyobranchial pump to suck food into its mouth. The claws on its hind feet tear apart larger pieces of food. Tadpoles are exclusively filter feeders

(Avila and Frye, 1977; Beck, 1994)

Animal Foods: insects; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Highly opportunistic, feeds on invertebrates, amphibians and fish. Larvae filter protozoa, bacteria, and other small food particles from the water (Stebbins 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Associations

Adults are generalist predators and scavengers, and can hold food items in their toothed mouths while breaking it apart with their claws using an overhead kick (Avila and Frye 1978). These behaviours can be detected by other adults in the vicinity and sometimes lead to a feeding frenzy (Frye and Avila 1979). Most food items for post-metamorphic X. laevis are benthic macro-invertebrates, such as chironomid larvae. However, a wide variety of food sources are used from all microhabitats in water bodies, including carrion and terrestrial food items (Measey 1998a, b). Even the largest animals take very small prey items, such as zooplankton and ostracods . X. laevis plays an important role in the ecology of southern African wetlands because it is widespread and abundant, and it is a voracious predator as well as an important prey item for several mammalian, avian and reptilian predators (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Xenopus laevis tested positive for Batrachochytrium dendrobatidis in Botswana at the Kanye Youth Centre in April 1969 (Weldon 2005). It also tested positive in the South African cities of Zeekoeivlei in 1938, Moordenaarshoek and Harrismith in 1972, Natal in 1973, Rosendal and Touw River in 1974, Phillipi in 1982, Florisbad in 1987, Koffiefontein and Sannaspos in 1991, Mooi River in 1995, Kommissiepoort in 1996, Windsorton Road in 1998, Stellenbosch and Klapmuts in 2001, Strand, Wellington, and Botrivier in 2002 and Kammieskroon in 2004 (Weldon 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bergmann, Travis; Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
Balantidium endoparasitises rectum of Xenopus laevis

Animal / parasite / endoparasite
attached worm of Camallanus kaapstaadi endoparasitises stomach of Xenopus laevis

Animal / parasite / endoparasite
tapeworm of Cephalochlamys namaquensis endoparasitises ilium of Xenopus laevis

Animal / parasite / endoparasite
cercarium of Diplostomulum xenopi endoparasitises pericardial sac of Xenopus laevis

Animal / parasite / endoparasite
Nyctotherus cordiformis endoparasitises rectum of Xenopus laevis

Animal / parasite / endoparasite
trophozoite of Opalina endoparasitises rectum of Xenopus laevis

Animal / parasite / endoparasite
attached worm of Procamallanus xenopodis endoparasitises stomach of Xenopus laevis

Animal / parasite / endoparasite
larva of Protopolystoma xenopi endoparasitises kidney of Xenopus laevis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Activity and Special Behaviors

Toward the peak of the dry season, X. laevis will either move from drying water bodies or burrow into the wet mud to aestivate (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Forages at night; rests on the bottom, or hides under rocks during the day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Metamorphosis

Wassersug (1996) recorded that larvae hatch within two to three days and, after finishing the yolk supply, begin to feed on algae suspended in the water column. Tadpoles display coordinated schooling behaviour, and maintain their position in the water column by means of a characteristic undulating motion of the tail (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Tinsley et al. (1996) found that the time to metamorphosis varies with temperature and the abundance of food. In optimal conditions, metamorphosis is possible within two months (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

African clawed frogs can reach 15 to 16 years old in wild and feral populations. Captive animals have been known to live as long as 20 years.

Range lifespan

Status: wild:
16 (high) years.

Range lifespan

Status: captivity:
20 (high) years.

Average lifespan

Status: captivity:
8.8 years.

Average lifespan

Status: captivity:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.3 years (captivity) Observations: Despite its short longevity, this animal does not show explicit signs of ageing (Brocas and Verzar 1961). Reproductive senescence has not been demonstrated, but growth rates appear to slow down with age. An increased tensile strength in tendon collagen with age, a frequent marker of ageing in mammals, as been reported (Kara 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Xenopus laevis is sexually mature in 10 to 12 months. Mating can take place during any time of the year, but is most common in the spring, and can take place up to four times per year. Males vocalize during the evening to attract females. Although the male lacks a vocal sac, it produces a mating call by rapid contractions of the intrinsic laryngeal muscles. This mating call sounds like alternating long and short trills. After the female hears this, she responds with either an acceptance call (a rapping sound) or a rejection call (slow ticking sound). This is a nearly unique behavior in the animal world; rarely does a female answer the males call. Mating often takes place at night, when there are few disturbances. The male develops mating pads on the underside of his forearms and hands. The mating embrace, amplexus, is pelvic, whereas most frogs have axillary (front limb) amplexus. The female can release hundreds of sticky eggs during the 3 to 4 hour event, which are typically attached to plants or other anchors, one or more at a time. The eggs grow into tadpoles, which filter feed. The tadpole metamorphoses into a small froglet, with the tail being absorbed into the body and sustaining its nutritional requirements during this period, which lasts about 4 to 5 days. The total change from egg to small frog takes about 6 to 8 weeks.

(Kaplan, 1995; Beck, 1994; Chang, 1998; Kelley, 1998, Jack Crayon, personal communication)

Breeding interval: African clawed frogs can breed up to 4 times each year.

Breeding season: Mating can take place during any time of the year, but is most common in the spring.

Range age at sexual or reproductive maturity (female): 10 to 12 months.

Range age at sexual or reproductive maturity (male): 10 to 12 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

After heavy rains, X. laevis sometimes leave water bodies en masse, and single individuals are also encountered on the surface in damp weather. These appearances may be associated with movement to and from breeding sites (Du Plessis 1966). Breeding begins at the onset of the rains, thus at different times in the summer and winter rainfall areas (Berk 1938; Kalk 1960). Hey (1949) reported that there are prolonged breeding period throughout the rainy season, and both females and males are able to breed more than once per season (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

McCoid (1985) found that spawning takes place during the night when couples, in inguinal amplexus, swim around the pond depositing single eggs on any hard substrate (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

May during all but the coolest periods of the year in southern California (McCoid and Fritts 1989). Female lays several hundred eggs; eggs laid singly or in small clusters (Behler and King 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Peptides protect from bacterial infection: African clawed frog
 

Peptides on the skin of African clawed frog protect from bacterial infection by having a semiselective binding nature to bacterial pathogen cells affording each peptide the ability to bind a variety of pathogens.

     
  "AMPs [antimicrobial peptides] appear in multiple niches in nature including the skin of higher organisms and the extracellular milieu of bacteria as the primary line of defense against bacteria and fungi. AMPs are much more stable than typical globular proteins—explaining how they can be continually exposed to the natural environment—and are exceptionally efficient at fending off bacterial infection. Indeed, some cationic antimicrobial peptides have shown activity toward pathogenic bacteria under harsh environmental conditions such as thermal (boiling/autoclaving) and chemical denaturants." (Mannoor et al. 2010:19207)
  Learn more about this functional adaptation.
  • Mannoor MS; Zhang S; Link AJ; McAlpine MC. 2010. Electrical detection of pathogenic bacteria via immobilized antimicrobial peptides. PNAS. 107(45): 19207–19212.
  • Emery C. 2010. New sensor derived from frogs may help fight bacteria and save wildlife. EurekAlert [Internet], Accessed 19-Oct-2010.
  • Bowman HG. 1995. Peptide antibiotics and their role in innate immunity. Annual Review of Immunology. 13: 61-92.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Pigments cells respond to hormones: African clawed frog
 

Pigments in frog skin change color in response to hormones by moving melanin grains around cells.

           
  "Some frogs, such as the African clawed frog (Xenopus laevis), change colour to cope with sunlight and heat and also to improve their camouflage. They do this by activating cells in their skin that contain granules of melanin, the dark brown pigment. These colour-changing cells, called melanophores, are normally dark but can be triggered by a particular hormone released in the frog. When the hormone binds to the cell wall, it sets off a reaction that moves the pigment granules to the centre of the cell, making it look colourless. Once the hormone detaches, the melanin grains disperse throughout the cell, making it appear dark again." (Sample 2002:21)
  Learn more about this functional adaptation.
  • Sample, I. 2002. Amphibian detectives. New Scientist. 173(2332): 21.
  • Karlsson AM; Bjuhr K; Testorf M; ÷berg Pk; Lerner E; Lundström I; Svensson SPS. 2002. Biosensing of opioids using frog melanophores. Biosensors and Bioelectronics. 17(4): 331-335.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xenopus laevis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0397-06|NC_001573|Xenopus laevis| ACTCGTTGATTATTCTCAACAAATCACAAAGACATTGGCACCCTTTACTTAGTTTTTGGTGCTTGAGCAGGGCTCGTCGGAACCGCTCTT---AGCTTATTAATTCGAGCTGAACTTAGCCAGCCCGGAACACTACTTGGAGAT---GACCAAATTTATAATGTTATCGTTACAGCACATGCTTTTATTATAATTTTCTTCATAGTGATGCCTATTATAATCGGTGGATTTGGGAACTGATTAGTTCCATTAATA---ATTGGAGCCCCAGATATAGCATTTCCGCGAATAAATAATATAAGCTTTTGACTTCTTCCCCCATCATTTCTTTTATTACTAGCATCATCTGGGGTTGAAGCAGGAGCCGGCACAGGTTGAACTGTGTACCCGCCTTTAGCTGGAAACCTAGCACATGCTGGAGCATCAGTTGACCTA---ACAATTTTCTCCCTTCACTTAGCTGGTATTTCATCTATTTTAGGAGCAATTAACTTCATCACAACAACAATTAACATAAAACCACCAGCTATATCTCAATACCAAACCCCACTATTTGTTTGATCAGTATTAATCACAGCTGTACTTTTACTTCTTTCTCTTCCTGTCTTAGCCGCA---GGAATCACAATGTTATTAACAGATCGTAATCTGAATACAACTTTCTTTGACCCTGCCGGAGGAGGTGACCCAGTACTTTACCAACACCTGTTCTGATTCTTTGGGCACCCAGAAGTGTACATTCTTATCTTACCAGGGTTTGGCATGATCTCCCATATCGTAACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGGGCAATAATATCAATTGGACTTCTAGGCTTTATTGTCTGAGCCCATCACATATTTACGGTTGATCTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xenopus laevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Species: 35
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Tinsley, R., Minter, L., Measey, J., Howell, K., Veloso, A., Núñez, H. & Romano, A.

Reviewer/s
Cox, N. & Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its very wide distribution, its tolerance of a broad range of habitats, its presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2008
    Least Concern
    (IUCN 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

It is an invasive species all over world because it was used in human pregnancy tests in the 1940's. When more effective means of pregnancy tests were made available, many X. laevis were released all over the world.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category and Justification of Conservation Status

X. laevis does not seem to be threatened in any part of its range. X. laevis is a highly invasive species, as is evidenced by the feral populations that have become established in many parts of the world (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is an extremely abundant, and often increasing, species.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

These frogs spend most of their life-cycle in the water, only to leave when there is a drought. When a drought occurs, they will burrow into the drying mud. They can survive up to a year without food. Their diet consists of a wide range of animals including fish, crustaceans, insects, and other frogs. They will also scavenge on dead frogs, fish, birds, and small mammals (Trueb 2003).
  • Trueb, L. (2003). ''Common platanna, Xenopus laevis.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is very successful and adaptable, and is an invasive species in many areas. Recent studies show that it is not impacted by the herbicide atrazine. Chytridiomycosis was detected in museum specimens of this species dating back to 1938, and it is hypothesized that the international trade in this species might have introduced this fungal disease to other regions of the world. The disease does not appear to have any detrimental affect on populations of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: May have declined recently in southern California, due possibly to drought and fish predation (McCoid et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Not threatened.
  • Trueb, L. (2003). ''Common platanna, Xenopus laevis.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Rotenone is not an effective control; introduced predatory fishes might be detrimental as a control because of negative impacts on native species; trapping might be a safe method for reducing frog densities (see Lafferty and Page 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Human activities have transplanted this African frog all over the globe, where some claim it is pushing native species out of their niche (Beck 1994). Others argue that there is no documented case of this occurring (Jack Crayon, pers. comm.)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Xenopus laevis has been used extensively as a laboratory research animal, mostly in the field of vertebrate embryology because females are prolific egg layers and embryos are transparent, making it easy to observe the development of the embryo. During the 1940's, female X. laevis were injected with the urine of a woman. If the human was pregnant, then the injected frog would start to produce eggs. Xenopus laevis was the first vertebrate cloned in the laboratory. Magainins are a family of antibiotics found in the skin of X. laevis, which heals wounded skin rapidly. Magainin is an antibiotic, antifungal, antiparasitic, and antiviral, probably useful to the frog because of the stagnant, microbe filled waters in which it lives in. These magainins have been tested as an antibiotic cream, which works just as well as an oral antibiotic, but without the side effects. Xenopus laevis is also used in lab because it is very easy to care for, breed, and observe.

Positive Impacts: source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: This species is a threat to a number of native U.S. amphibians and fishes (e.g., tidewater goby, Lafferty and Page 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relation to Humans

This is one of the most-studied species of frogs, considered one of the model systems of developmental biology. It is hardy and breeding can be easily induced in the laboratory. Xenopus laevis early development has been studied by developmental biologists for decades and its genome has been fully sequenced. Because it makes a hardy and popular pet, it can also be found in aquariums worldwide. This species has been used as food in African countries (Trueb 2003).
  • Trueb, L. (2003). ''Common platanna, Xenopus laevis.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

African clawed frog

The African clawed frog (Xenopus laevis, also known as the African clawed toad or the platanna) is a species of South African aquatic frog of the genus Xenopus. Its name is derived from the three short claws on each hind foot, which it uses to tear apart its food. The word Xenopus means "strange foot" and laevis means "smooth".

African clawed frogs can grow up to a length of 5 in (12 cm). They have a flattened head and body, but no tongue or external ears.

The species is found throughout most of Africa, and in isolated, introduced populations in North America, South America, and Europe.[1] All species of the Pipidae family are tongueless, toothless and completely aquatic. They use their hands to shove food in their mouths and down their throats and a hyobranchial pump to draw or suck food in their mouth. Pipidae have powerful legs for swimming and lunging after food. They also use the claws on their feet to tear pieces of large food. They lack true ears but have lateral lines running down the length of the body and underside, which is how they can sense movements and vibrations in the water. They use their sensitive fingers, sense of smell, and lateral line system to find food. Pipidae are scavengers and will eat almost anything living, dying or dead and any type of organic waste.

Contents

Description

These frogs are plentiful in ponds and rivers within the south-eastern portion of Sub-Saharan Africa. They are aquatic and are often greenish-grey in color. Albino varieties are commonly sold as pets. “Wild-type” African Clawed Frogs are also frequently sold as pets, and often incorrectly labeled as a Congo Frog or African Dwarf Frog because of similar colorings. They are easily distinguished from African Dwarf Frogs because African Clawed Frogs have webbing only on their hind feet while African Dwarf Frogs have webbing on all four feet. They reproduce by laying eggs (see frog reproduction). Also, the clawed frogs are the only amphibians to have actual (though small) claws.[2]

The average life-span of these frogs ranges from 5 to 15 years with some individuals recorded to have lived for 20–25 years.[3] They shed their skin every season, and eat their own shedded skin.

Although lacking a vocal sac, the males make a mating call of alternating long and short trills, by contracting the intrinsic laryngeal muscles. Females also answer vocally, signaling either acceptance (a rapping sound) or rejection (slow ticking) of the male.[4][5] This frog has smooth slippery skin which is multicolored on its back with blotches of olive gray or brown. The underside is creamy white with a yellow tinge.

Male and female frogs can be easily distinguished through the following differences. Male frogs are usually about 20% smaller than females, with slim bodies and legs. Males make mating calls to attract females, sounding very much like a cricket calling underwater. Females are larger than the males, appearing far more plump with hip-like bulges above their rear legs (where their eggs are internally located). While they do not sing or call out like males do, they do answer back (an extremely rare phenomenon in the animal world).[citation needed]

Both males and females have a cloaca, which is a chamber through which digestive and urinary wastes pass and through which the reproductive systems also empty. The cloaca empties by way of the vent which in reptiles and amphibians is a single opening for all three systems.[6]

In the wild

In the wild, Xenopus laevis are native to wetlands, ponds and lakes across arid/semiarid regions of southern Africa.[7] Xenopus laevis and Xenopus muelleri occur along the western boundary of the Great African Rift. The people of the sub-Saharan are generally very familiar with this frog, and some cultures use it as a source of protein, an aphrodisiac, or as fertility medicine. Wild Xenopus are much larger than their captive bred counterparts.[citation needed]

Use in research

Although X. laevis does not have the short generation time and genetic simplicity generally desired in genetic model organisms, it is an important model organism in developmental biology. X. laevis takes 1 to 2 years to reach sexual maturity and, like most of its genus, it is tetraploid. It does have a large and easily manipulated embryo, however. The ease of manipulation in amphibian embryos has given them an important place in historical and modern developmental biology. A related species, Xenopus tropicalis, is now being promoted as a more viable model for genetics. Roger Wolcott Sperry used X. laevis for his famous experiments describing the development of the visual system. These experiments led to the formulation of the Chemoaffinity hypothesis.

African Clawed Frog bw.jpg

Xenopus oocytes provide an important expression system for molecular biology. By injecting DNA or mRNA into the oocyte or developing embryo, scientists can study the protein products in a controlled system. This allows rapid functional expression of manipulated DNAs (or mRNA). This is particularly useful in electrophysiology, where the ease of recording from the oocyte makes expression of membrane channels attractive. One challenge of oocyte work is eliminating native proteins that might confound results, such as membrane channels native to the oocyte. Translation of proteins can be blocked or splicing of pre-mRNA can be modified by injection of Morpholino antisense oligos into the oocyte (for distribution throughout the embryo) or early embryo (for distribution only into daughter cells of the injected cell).[8]

Extracts from the eggs of X. laevis frogs are also commonly used for biochemical studies of DNA replication and repair, as these extracts fully support DNA replication and other related processes in a cell-free environment which allows easier manipulation.[9]

The first vertebrate ever to be cloned was an African clawed frog.

Additionally, several African clawed frogs were present on the space shuttle Endeavour (which was launched into space on September 12, 1992) so that scientists could test whether reproduction and development could occur normally in zero gravity.[10][11]

X. laevis is also notable for its use in the first well-documented method of pregnancy testing when it was discovered that the urine from pregnant women induced X. laevis oocyte production. Human chorionic gonadotropin (HCG) is a hormone found in substantial quantities in the urine of pregnant women. Today, commercially available HCG is injected into Xenopus males and females to induce mating behavior and to breed these frogs in captivity at any time of the year.[12]

As pets

Xenopus laevis have been kept as pets and research subjects since as early as the 1950s. They are extremely hardy and long lived, having been known to live up to 20 or even 30 years in captivity.[13]

African Clawed Frogs are frequently mislabeled as African Dwarf Frogs in pet stores. The astute pet owner will recognize the difference, however, because of the following characteristics:

  • Dwarf frogs have four webbed feet. African Clawed Frogs have webbed hind feet while their front feet have autonomous digits.
  • African Dwarf Frogs have eyes positioned on the side of their head, while African Clawed Frogs have eyes on the top of their heads
  • African Clawed Frogs have curved, flat snouts. The snout of an African Dwarf Frog is pointed.

As a pest

African Clawed Frogs are voracious predators and easily adapt to many habitats.[14] For this reason, they can easily become harmful invasive species. They can travel short distances to other bodies of water, and some have even been documented to survive mild freezes. They have been shown to devastate native populations of frogs and other creatures by eating their young.

In 2003, Xenopus frogs were discovered in a pond at San Francisco's Golden Gate Park. Much debate now exists in the area on how to exterminate these creatures and keep them from spreading.[15][16] It is unknown if these frogs entered the San Francisco ecosystem through intentional release or escape into the wild.

Due to incidences in which these frogs were released and allowed to escape into the wild, African Clawed Frogs are illegal to own, transport or sell without a permit in the following US states: Arizona, California, Kentucky, Louisiana, New Jersey, North Carolina, Oregon, Virginia, Hawaii,[17] Nevada, and Washington state. However, it is legal to own Xenopus laevis in Canada.[18][19]

Known feral colonies of Xenopus do also exist in South Wales, UK.[20]

See also

References

  1. ^ Tinsley et al. (2004). Xenopus laevis. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006. Database entry includes a range map and justification for why this species is of least concern
  2. ^ Maddin & al. (2009): The anatomy and development of the claws ofXenopus laevis (Lissamphibia: Anura) reveal alternate pathways of structural evolution in the integument of tetrapods. Journal of Anatomy, no 214 (4): pp 607-19 Abstract
  3. ^ http://animaldiversity.ummz.umich.edu/site/accounts/information/Xenopus_laevis.html
  4. ^ ADW: Xenopus Laevis: Information
  5. ^ ADW: NPR: Listening To Love Songs of African Clawed Frogs
  6. ^ Reference: National Audubon Society. Field Guide To Reptiles & Amphibians, pp: 701 & 704; Alfred A. Knopf, 24th Printing 2008.
  7. ^ Ecology of Xenopus Laevis
  8. ^ Comparison of morpholino based translational inhib...[Genesis. 2001] - PubMed Result
  9. ^ Blow JJ, Laskey RA (November 1986). "Initiation of DNA replication in nuclei and purified DNA by a cell-free extract of Xenopus eggs..". Cell 47 (4): 577–87. doi:10.1016/0092-8674(86)90622-7. PMID 3779837. 
  10. ^ Ludington Daily News - Sep 14, 1992, p. 7
  11. ^ Reading Eagle - Sep 11, 1992, p. A8
  12. ^ Green, SL. The Laboratory Xenopus sp: The Laboratory Animal Pocket Reference Series. Editor: M. Suckow. Taylor and Francis Group, LLC, Boca Raton, Fla., 2010
  13. ^ NPR December 22, 2007
  14. ^ ADW: Columbia: Introduced Species Summary Project
  15. ^ "Killer Meat-Eating Frogs Terrorize San Francisco". FoxNews. 2007-03-14. http://www.foxnews.com/story/0,2933,258519,00.html. 
  16. ^ "The Killer Frogs of Lily Pond:San Francisco poised to checkmate amphibious African predators of Golden Gate Park". San Francisco Chronicle. http://sfgate.com/cgi-bin/article.cgi?f=/c/a/2007/03/12/BAGLUOJLDE1.dlkhgidofyugDTL. [dead link]
  17. ^ ADW: Honolulu Star-Bulletin Wednesday, July 3, 2002
  18. ^ ADW: New Brunswick Regulation 92-74
  19. ^ ADW: New Brunswick Acts and regulations
  20. ^ Feral Xenopus laevis in South Wales, UK
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!