Overview

Distribution

Range Description

The Japanese serow (Capricornis crispus) is endemic to Japan on three of the main islands: Honshu, Shikoku and Kyushu. The species is widespread in appropriate habitat on Honshu, but is absent from lowland cultivated areas and areas around human settlements. On Shikoku and Kyushu, their distribution is more limited. It became extinct in western Honshu and greatly reduced in other areas before the early 20th century. Since the 1960s, its range has been expanding.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The distribution of Japanese serows is restricted to the Japanese islands of Honshu, Kyushu, and Shikoku.

Biogeographic Regions: palearctic (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Japanese serows are similar in appearance to goats. Their horns average 12 to 16 cm in length. Their body length is approximately 130 cm, and their shoulder height is about 65 cm. Adult serows weigh 30-45 kg, and they are not strongly sexually dimorphic. Their pelage is dark brown, but in the northern part of their range the color is lighter. They possess large infraorbital glands that are used in scent marking their territories. This gland can be seen easily.

Range mass: 30 to 45 kg.

Average mass: 37 kg.

Average length: 130 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is diurnal, though the animals actively feed only in the early morning and late afternoon. Their habitat includes various vegetation types such as broad-leaved evergreen forest, subalpine coniferous forest, alpine meadow and coniferous plantations, but temperate deciduous forest that is their preferred habitat. They eat fleshy leaves, evergreen leaves, plant shoots, and acorns (Jass and Mead 2004). This species is a monogamous, territorial browser, and sexual dimorphism is not developed. They are found solitarily, in pairs or small family groups. The population density is generally low (the average was 2.6/km² in the 1983 survey). Females mature sexually at 30 months. The gestation period is 7 months, and females give birth to single fawn. Life expectancy at birth and longevity are estimated to be 4.8-6.5 years and 25 years respectively (Tokida and Miura, 1988, Miura and Tokida, 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Japanese serows inhabit forested areas on mountains.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; mountains

  • Kishimoto, R., T. Kawamichi. 1996. Territoriality and monogamous pairs in a solitary ungulate, the Japanese serow, Capricornis crispus . Animal Behavior, 52: 673-682.
  • Ochiai, K. 1999. Diet of the Japanese serow (Capricornis crispus) on the Shimokita Peninsula, northern Japan, in reference to variations with a 16-year interval. Mammal study, 24: 91-102.
  • Ochiai, K., K. Susaki. 2002. Effects of territoriality on population density in the Japanese serow, (Capricornis crispus). Journal of Mammalogy, 83(4): 964-972.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Japanese serows are browsers that feed primarily on the buds and leaves of deciduous broad-leaved trees. They also feed on leaves of evergreen coniferous trees and fallen acorns. They sometimes eat flowers and fruits.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

  • Takatsuki, S., N. Ôsugi, T. Itô. 1988. A Note on the Food Habits of the Japanese Serow at the Western Foothill of Mt. Zao, northern Japan. Journal of the Mammalogical Society of Japan, 13(2): 139-142.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because Japanese serows are territorial and their density in any particular area is limited, their impact on vegetation is relatively low. However, some species of plants are affected by their browsing and consequently they have some influence over the vegetation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Japanese serows have no or very few predators other than humans. A potential predator is Ursus thibetanus, Asiatic black bears. However, Asiatic black bears are not highly predatory. Historically, wolves probably preyed on serows, but wolves were exterminated from the serow's range by the early 1900s. More significantly, humans hunted them for meat and hide in the past. They are currently protected as a Japanese natural heritage and hunting is prohibited. Recently, dog predation was found to be a leading source of mortality in some areas.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Japanese serows use scent marking to hold territories. Because they are solitary animals and have little occasion to encounter other individuals of the same species, they use scent marking as their primary method of communication. Females use sound to call their young.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum longevity is 20 to 21 years for males and 21 to 22 years for females. Life expectancies at birth are 5.3 to 5.5 years for males and 4.8 and 5.1 years for females. One study found that serows live in same territory for 11.7 to 12.4 years. Because serows disperse from their natal territories at 2 to 4 years of age to establish their own territories, they live most of their lives in the territory they established. Also, it is likely that successful establishment of a territory increases an individual's chances of survival greatly, those without territories have greater risk of mortality.

Range lifespan

Status: wild:
20 to 22 years.

Typical lifespan

Status: wild:
4.8 to 5.5 years.

Average lifespan

Status: captivity:
10.0 years.

  • Tokida, K., S. Miura. 1988. Mortality and Life Table of a Japanese Serow (Capricornis crispus) Population in Iwate Prefecture, Japan. Journal of the Mammalogical Society of Japan, 13(2): 119-126.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (captivity) Observations: One captive specimen lived 24 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Japanese serows usually form monogamous pairs. However, some males mate with two and occasionally three females in the same breeding season. Two field studies at different locations found a similar proportion of polygynous males (20-30%), suggesting that the proportion of animals that mate polygynously is perhaps fixed in the species. Both sexes form territories that they defend against other individuals of the same sex. Usually male territories almost completely overlap those of a female, but sometimes male territories include territories of more than one female. In these cases, those males are polygynous. Mated pairs remain together every year, perhaps because they hold consistent territories. When a mate is displaced from their territory, their mate remains in the same territory and mates with the individual that takes over the territory of the displaced animal.

Mating System: monogamous ; polygynous

Japanese serows rut in September to November. The young are born in May and June, and they remain with their mother for about a year. Young reach sexual maturity at 2.5 to 3 years of age. Although serows become independent as yearlings, they remain in their natal territory. They disperse between 2 to 4 years of age, but females may inherit their mothers' territories.

Breeding interval: Japanese serows breed once yearly.

Breeding season: Breeding occurs from Septermber to November.

Range number of offspring: 1 to 3.

Average number of offspring: 1.01.

Range gestation period: 6.67 to 7.67 months.

Average weaning age: 5 months.

Average time to independence: 1 years.

Range age at sexual or reproductive maturity (female): 2.5 to 3 years.

Range age at sexual or reproductive maturity (male): 2.5 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Most of the parental investment is provided by the mother. Young serows follow their mothers for a year, and remain in the mother’s territory for 2 to 4 years. Lactation continues until November. Males provide no parental care to the young, although they permit young within their territories.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; inherits maternal/paternal territory

  • Kishimoto, R. 1989. Early Mother and Kid Behavior of a Typical "Follower", Japanese Serow Capricornis crispus . Mammalia, 53(2): 165-176.
  • Kishimoto, R., T. Kawamichi. 1996. Territoriality and monogamous pairs in a solitary ungulate, the Japanese serow, Capricornis crispus . Animal Behavior, 52: 673-682.
  • Ochiai, K., K. Susaki. 2002. Effects of territoriality on population density in the Japanese serow, (Capricornis crispus). Journal of Mammalogy, 83(4): 964-972.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capricornis crispus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2255-09|NC_012096|Capricornis crispus| AACCGCTGATTATTTTCAACTAACCACAAAGATATTGGCACTCTTTACCTCCTATTTGGTGCCTGAGCTGGCATAGTAGGAACTGCCCTA---AGCCTGCTAATTCGCGCTGAACTAGGCCAACCCGGAACTCTACTTGGAGAC---GACCAAATCTACAATGTAGTTGTAACCGCACACGCATTCGTAATAATCTTTTTCATAGTAATACCTATTATAATTGGAGGCTTTGGCAACTGACTAGTTCCCTTAATA---ATTGGAGCCCCCGATATAGCATTTCCCCGGATAAACAACATAAGTTTTTTACTCCTCCCCCCTTCCTTCCTATTACTCCTAGCATCCTCTATGGTTGAAGCCGGAGCAGGAACAGGTTGAACCGTATACCCCCCCTTAGCAGGCAATTTAGCCCATGCAGGAGCCTCAGTAGACCTA---ACCATTTTCTCTTTACACCTGGCTGGTGTCTCCTCAATTTTAGGAGCCATCAATTTTATTACAACTATTATCAACATAAAACCTCCTGCAATATCACAATATCAAACTCCCCTATTCGTGTGATCCGTACTAATCACTGCCGTATTACTCCTACTCTCACTCCCTGTATTAGCAGCT---GGCATTACAATACTGTTGACAGACCGAAACCTGAACACGACCTTCTTCGACCCGGCAGGAGGGGGAGACCCTATTTTATATCAACACCTATTTTGATTCTTTGGACACCCCGAAGTATACATTCTCATTTTACCTGGATTTGGAATAATCTCCCACATTGTAACCTACTATTCAGGAAAAAAA---GAACCATTCGGATATATAGGAATAGTATGAGCCATAATATCAATCGGATTCTTGGGATTTATTGTATGAGCCCATCACATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Capricornis crispus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Tokida, K.

Reviewer/s
Harris, R. & Festa-Bianchet, M. (Caprinae Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, large population, and stable or increasing population. It is dependent on continued protection, including from hunting and persecution by forestry operations.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Japanese serows were hunted to near extinction by people in the past. They are currently protected as a natural heritage and hunting has been prohibited. They are listed as Lower Risk in IUCN.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Japanese serow is common in the mountain ranges of northern and central Honshu, and eastern Shikoku, but is restricted to small, fragmented areas in Kyushu. By 1978 the total range occupied by serow was estimated at 34,500 km², with total number estimated by the block count method (Maruyama and Nakama, 1983) of 70,000 to 100,000 animals. In 1983, the total population was estimated by the Environmental Agency at ca. 100,000 animals with a distribution area of more than 39,000 km². In 2003, the distribution had expanded to 170% of that in 1978. On the other hand, the population density has slightly decreased in many areas. Currently the population is assumed to be stable or slowly increasing.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The serow had been threatened due to over-hunting until the 1950s. It is considered that the poaching pressure was exceedingly high before the 1950’s. However, poacher’s syndicates were eliminated by anti-poaching campaign in 1959, and after that serow population began to increase. Furthermore, the increase of young conifer plantations, which occurred from 1950s to 1970s and supplied a large quantity of food for serow, might affect the population growth. From middle of 1970s to early 1990s, damage on young conifer plantations and agricultural crops by serow increased and the high level had been maintained. The management measures of this species became a matter of controversy between conservationists, and forest owners and/or farmers, then the government agencies decided to start serow control in 1978. In 1990s, damage by serow had declined with decrease of young plantations. On the other hand, damage on forestry and agriculture by sika deer (Cervus nippon), wild boar (Sus scrofa), and Japanese monkey (Macaca fuscata) has remarkably increased, and accordingly social demands to control serow had decreased.

The sika deer population is conspicuously increasing throughout Japan in recent years, and undergrowth of forest is decreasing by the grazing and browsing, and the interspecific competition with sika deer might affect serow population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Due to a severe decline in the early 20th century, serow was designated a ‘Non Game Species’ by the Hunting Law in 1925, and hunting of this species was prohibited. In 1934, this species was designated to ‘’Natural Monument Species’’ under the Law for Protection of Cultural Properties (LPCP). In 1955, its status was raised to ‘’Special Natural Monument Species’’. Although serow hunting has been prohibited by laws since 1925, poaching pressure was high before the 1950s. As a result of the anti-poaching campaign conducted throughout the country in 1959, poacher’s syndicates were eliminated, and the serow population began to increase. The population increase was probably also due to an increase in suitable habitat in the form of young coniferous plantations created from 1950s to 1970s. By the 1970s these artificial plantation accounted for more than 40% of forest cover in Japan, and the serow range had expanded to around 40,000 km² ,and population increased to 100,000. However, with this increase, damage to forestry and agricultural production had also drastically increased and conflicts arose between serow conservation and primary industries. Nevertheless, any capture of serows, including nuisance animal control, was not permitted until 1978 (with the exception of scientific research).

The Japanese serow is legally managed under two laws, LPCP and the Wildlife Protection and Hunting Law (WPHL). The competent authority of LPCP is the Agency for Cultural Affairs, and that of WPHL is the Environmental Agency (currently Ministry of the Environment). The Forestry Agency has jurisdiction over forest management policy, which concerns damage prevention and habitat treatment. In 1979, these three Agencies reached an agreement to change serow management measures. The essential points of new management policy were as follows.
1) To establish serow protection areas. This decision meant the designation of ‘Special Natural Monument Species’ would be repealed and instead ‘Serow Protection Areas’ would be designated based on LPCP in the future.
2) To allow serow cull as pest control outside the serow protection areas in cases of necessity.
3) The Agency for Cultural Affairs would bear responsibility for conservation in the protection areas, the Environmental Agency would bear responsibility for management of serow outside the protection areas, and the Forestry Agency for avoiding serow damage on young conifer plantations by non-fatal methods such as fencing and netting.
Conservationists, nature conservation NGOs, and some biologists opposed to this policy change.

Three primary functions were expected from the protection areas were 1) to maintain stable and viable local populations; 2) to preserve the geographical genetic diversity of serow populations; and 3) to establish a management system for serow and its habitat. Fifteen protection areas were nominated and 13 of them had been established by 1989, ranging in size from 143 km² to 2,180 km². The total area is 11,800 km², which covers about 20% of the current serow range over 23 prefectures. However, in many cases, the protection areas avoid commercial forests, and are situated at relatively high elevations including unsuitable habitats for serow. Therefore, some protection areas do not have enough suitable habitat quality and/or area size for the effecitve protection of local populations.

The Agency of Cultural Affairs initiated a systematic survey of serow management in 1985, composed of main and supplemental survey programs. The purpose of main survey program is to monitor population trends and habitat conditions once every 6 or 7 years for each protection area. This program is carried out by specialists. The supplemental survey program is carried out annually, except in the main survey’s year, by local inhabitants to monitor population indices, habitat changes and damage, by simple and easy methods. The data from both programs are used to develop the management plan for each protection area. Protection areas are not yet established in Kyushu and Shikoku due to disagreements with land owners. Therefore, the Japanese serow still retains the status of ‘Special Natural Monument Species’.

In 1978, a control cull began in the restricted small areas of Gifu and Nagano Prefectures, and the culling area has expanded to large part of central Honshu. As a matter of course, control cull is conducted outside the protection areas. The total number of serow removed was over 20,000 by 2005. The damage to conifer plantations in central Honshu markedly decreased in 1990s, because population density of serow in this area and also the area of young conifer plantations have reduced. Two kinds of permissions, based on LPCP and WPHL, are required for control culls of serow. The areas and periods of the control, the upper limit of the harvest number, and the capture methods are specified in the permits. Biological investigation of killed serow has been continued since the beginning of the control. Place and date of capture, sex, age, and reproductive condition are recorded for almost all individuals. These data are used for serow management.

In 1999, the WPHL was amended and the ‘Specified Wildlife Management Plan System’ was established. This is a legal management system and each prefecture can make a plan to properly manage wildlife populations. This plan must state specific goals for the target species, and prescribe concrete measure for properly controlled hunting, preventing negative influences on the population, and conserving habitats. This adaptive management system is considered to be useful and practical for management of serow outside the protection areas, and seven such plans for serow had been established by 2007.

The management system for serow has significantly developed during the last 25 years. Serow populations are stable and/or increasing in most areas, but following problems might affect negatively some populations:
1) Growth of conifer plantations planted for the period from late 1950s to 1980s and over-grazing and/or browsing by sika deer reduce food supply for serow and deteriorate habitat quality.
2) Interspecific competition with sika deer may reduce serow populations.

The serow population has recently decreased in Kyushu. It is considered this decrease is probably caused by interspecific competition with sika deer. Also, the influence of deer control operations, such as disturbance of home ranges and accidental killing by hunting dogs and deer-fencing, might be having an impact. Surveys and countermeasures are needed for these problems.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because they browse on trees, Japanese serows sometimes become pests to the forestry industry as they damage planted trees. They are sometimes killed as a management practice to control damage to forestry plantations.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Traditionally Japanese serows were an important source of meat and hide for people. Currently they are recognized as unique species endemic to Japan and classified as a natural heritage.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese serow

Japanese Serow outside of Wakinosawa, Aomori

The Japanese serow (Capricornis crispus or Naemorhedus crispus), known in Japanese as the Nihon kamoshika (ニホンカモシカ?), is a goat-antelope found in dense woodland on Honshū, Japan.

Japanese serow stand 60 to 90 centimetres at the shoulder and weigh 30 to 130 kilograms. Japanese serow are mottled brown and white and black underneath. Their fur is very bushy, especially their tails. Both sexes have short 10 centimetre horns, which curve backwards.

Japanese serow are found in dense hillside forests where they eat leaves, and acorns. They are diurnal, feeding in the mornings and evenings and resting under rock ledges for the remainder of the day. The serow are solitary, or gather in couples, sometimes with kids as well. Generally they live in small ranges, around 20,000 square metres for individuals and up to 200,000 square metres for larger groups. Ranges are marked with a substance similar to vinegar that is secreted from the serow's preorbital gland, which is just in front of the eye. (This can be seen in the picture)

They have lived up to 10 years in captivity. Lifespan in the wild is unknown. The captive population is around 35.

Japanese serow

See also

References

  1. ^ Wilson, Don E.; Reeder, DeeAnn M., eds. (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200789. 
  2. ^ Tokida, K. (2008). Capricornis crispus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!