Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

This species is found in northern Myanmar, China (southeast Tibet and Yunnan), and northeast India (Arunachal Pradesh) (Grubb, 2005, Singh, 2002, Mishra, 2006). This species is found at higher elevations than most gorals, between altitudes of 2,000-4,500 m (Zhang 1987; Rabinowitz 1999; Smith and Xie 2008).

According to Shackelton (1997), this species, sometimes referred to as N. cranbrooki, has a narrow distribution, and inhabits the largest remaining native coniferous forests up to 4,000 m in the eastern Himalayas of southeastern Tibet. According to summer surveys carried out in this region from 1987 to 1988 (Zhang 1987, Zhang, 1991) the distribution area is between about 27° to 29°30'N and 96° to 98°E, in four prefectures of Tibet (Bomi, Nying, Mainling and Medog; Zhang 1987). This current range in southeastern Tibet is believed to be reduced considerably and is now confined to an area of less than 8,000 km² in Tongmai (Bomi), Dongjiu, Pelung, and Bayu (Linzhi) and Medog, around the junction of the Pelung Zangbo and Yarlung Zangbo rivers (Feng et al. 1986; Zhang 1987; 1991). This goral is also known to occur in Gongshan county, southeastern Yunnan (Liu 1987; Wang 2003).

In Myanmar the species is confined to the northernmost part of the country, and in India it is restricted to Arunachal Pradesh, near the Chinese and Myanmar borders.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The red goral inhabits forest, ragged crags, scrub and meadows from 2,000 m up to 4,500 m in summer (Smith and Xie 2008). The elevation and range where red goral is found supports one of the largest tracts of primary coniferous woodland in Asia, which along with its rocky outcrops, form the species' primary habitat (Zhang, 1987; Wang 1998; Sheng et al., 1999). Red gorals migrate seasonally, moving in the winter (typically, November through to March) to lower-elevation mixed deciduous and coniferous forests or glades and thickets below the snow line (Zhang, 1987; Wang 1998; Sheng et al., 1999; Rabinowitz, 1999). Gorals are diurnal, and are most active in the early morning and late evening, but can be active throughout on overcast days (Sheng et al., 1999). Group home range size is typically around 40 hectares, with males occupying marked territories of 22-25 hectares during the mating season. This species is typically solitary, but occasionally the animals are seen in small groups of 2-3, typically a female and her offspring, sometimes accompanied with a male, or a female with her offspring from the previous two years (Zhang, 1987; Sheng et al., 1999). Mates in December, and young are born in June after a six month pregnancy (Smith and Xie 2008). The diet consists primarily of lichens; however, it also feeds on grasses and weeds as well as tender stems, leaves, and twigs from shrubs, although no long term studies on diet have been done (Zhang, 1987; Sheng et al., 1999). The gestation length is 170-218 days, with single births. Males and females reach sexual maturity at approximately three years, with a lifespan of up to 15 years or so.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: One wild born specimen was about 19 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Naemorhedus baileyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCACCAACCGCTGATTATTTTCAACTAACCATAAAGACATTGGTACCCTTTACCTTCTATTTGGCGCCTGAGCTGGCATAGTAGGAACTGCCCTGAGCCTACTAATTCGCGCTGAACTAGGCCAACCCGGAACTCTACTTGGAGATGACCAAATCTACAATGTAGTCGTAACCGCACATGCATTCGTAATAATTTTTTTCATAGTAATACCTATTATGATCGGAGGCTTTGGTAACTGACTAGTTCCTTTAATAATTGGGGCCCCTGATATAGCATTCCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCCCCTTCTTTCCTATTACTGCTAGCATCCTCTATGGTCGAAGCCGGAGCAGGGACAGGTTGAACCGTATATCCTCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTTGACCTAACCATCTTCTCTCTACACCTAGCAGGTGTCTCCTCAATTTTAGGGGCCATCAATTTTATTACAACTATCATTAATATAAAACCCCCTGCAATATCACAATACCAAACCCCCCTATTCGTGTGATCTGTACTAATCACTGCCGTACTACTCCTCCTCTCACTTCCTGTATTAGCAGCTGGCATTACAATACTGTTAACAGACCGAAACCTGAACACAACCTTCTTCGACCCGGCAGGAGGGGGAGACCCTATTCTGTACCAACACTTATTTTGATTCTTTGGACACCCTGAAGTATATATTCTTATTTTACCCGGATTTGGGATAATTTCCCACATTGTAACTTATTATTCAGGAAAAAAAGAACCATTTGGGTATATGGGAATAGTGTGAGCTATAATATCAATCGGGTTCTTGGGGTTTATTGTATGAGCCCACCACATATTTACAGTCGGAATAGACGTCGATACACGGGCCTACTTCACATCAGCTACTATAATTATTGCCATCCCAACAGGGGTAAAAGTCTTCAGTTGATTAGCAACACTCCACGGAGGCAATATTAAATGATCCCCCGCTATAATATGAGCCCTAGGCTTTATTTTCCTTTTTACAGTTGGAGGCCTAACTGGAATCGTCCTAGCTAATTCCTCCCTCGACATCGTCCTCCATGATACATATTATGTAGTCGCACATTTCCACTATGTACTGTCAATAGGAGCTGTATTCGCTATCATGGGAGGGTTCGTACACTGATTTCCCCTATTCTCAGGCTATACTCTTAACGACACATGAGCCAAAATCCACTTTGCAATTATATTCGTAGGCGTTAACATAACTTTCTTCCCACAACATTTCTTAGGACTATCCGGCATACCACGACGATATTCTGATTATCCAGATGCATATACAATATGAAACACCATTTCATCTATAGGCTCATTTATCTCACTAACAGCAGTAATACTAATAATTTTTATCATCTGAGAAGCATTCGCATCCAAACGAGAAGTCCTAACTGTAGACCTAACCACAACGAATCTAGAGTGATTAAACGGATGCCCTCCACCATATCACACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Naemorhedus baileyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W. & MacKinnon, J.

Reviewer/s
Harris, R. & Festa-Bianchet, M. (Caprinae Red List Authority)

Justification
Listed as Endangered because its population size is estimated to number fewer than 10,000 mature individuals, there is probably continuing decline in the number of mature individuals due to over hunting, and no subpopulation is likely to contain more than 1,000 mature individuals.

History
  • 1996
    Vulnerable
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Random sampling during summer field studies from 1987 to 1988 provided some information on the red goral population in Xizang (Zhang, 1991). Total numbers were estimated to be 810 to 1,370 individuals, distributed as follows: 120 to 180 for Linzhi, 60 to 220 for Bomi, 320 to 380 for Zayu, 220 to 450 Medog, and 90 to 140 for Manling (Zhang, 1991). Wang (1998) suggested that total numbers in China were less than 1,500. The species is rare in Myanmar because of a naturally restricted range, compounded by the effects of trade-driven hunting (Than Zaw and W. Duckworth pers. comm., 2006). There is little information on its status in India. Given its small range, the total population size is probably less than 10,000 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hunting and habitat loss caused by rapid forestry expansion are the major threats. Since the opening up of and the economic reforms in Tibet, hunting has had a major negative impact on the population of red goral. This is due primarily to the increasing number of immigrants and modern hunting weapons. It was said that in the three provinces of Pelung, Dingjiu and Bayu in the Linzhi county, only about 150 individuals of this species had been hunted annually before the early 1980s. Although a hunting ban was in effect over the last five years, poaching is still common and takes place most often when animals move down to their winter ranges (Zhang, 1991). Hunting is the major threat to the species in Myanmar, reflecting the same factors as listed above for China (Than Zaw pers. comm. 2006). It is valued when found (W. Duckworth pers. comm. 2006). Horns are valued medicinally in China (Than Zaw pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The red goral is listed on Appendix I of CITES, and as a Class I Protected Species in China. Legally it received total protection in 1987 (Zhang, 1991). It is known in at least four protected areas, all in Tibet: Gangxiang, Muotuo, Xiaca and Medoq. A small herd has been breeding successfully in Shang Hai Zoo. Conservation measures proposed for China: 1) Enforce the existing protection laws for this species. 2) Establish the proposed protected areas for this species that have not yet been acted on by the government of Tibet Autonomous Region (TAR). These are: a) an area of 200 km diameter, with its centre at “big turning point of Yarlung Zangbo Jiang” (Zhang, 1987); and b) an “International Mountain Research Centre” in Yegon county with eight nature reserves in the area surrounding Nanjabarva Peak (Mountaineering and Scientific Expedition, Chinese Academy of Sciences, 1985). These reserves would include parts of the four counties mentioned above, and contain the core range of red goral, an area that is relatively pristine and has a widespread, complex mountain ecosystem plus a diverse fauna and flora. Obviously efforts should be made to encourage the Government of TAR to make a decision and then to organize the necessary surveys for these proposals.

In India, the red goral is legally protected under Schedule TIT (revised March 1987) of the Wildlife (Protection) Act (1972). It occurrence in protected areas in India is not known, and more surveys are needed to determine its conservation needs in this country.

This species is largely or perhaps entirely within protected areas in Myanmar (Than Zaw pers. comm. 2006), notably the Hponkanrazi Wildlife Sanctuary and the Hkakaborazi National Park.

The taxonomic validity of this species, and its relationship to other species in the genus Naemorhedus needs to be assessed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red goral

The red goral (Naemorhedus baileyi) is a species of even-toed ungulate in the Bovidae family. It is found in India, Tibet and Myanmar. Its natural habitats are subtropical or tropical dry forests and subtropical or tropical dry lowland grassland. It is threatened by habitat loss.

The red goral is a bright foxy-red animal with long, soft, shaggy hair. A thin, dark stripe runs along the back from the head to the tip of the tail. The legs are the same rich red as the body, while the undersides are a lighter buff color. The black-colored tail is very short for a goral, but a long tuft of dark hair at the end may double its apparent length.

The red goral is easily distinguished from other members of the genus Naemorhedus by its reddish coat - all other gorals are greyish-brown with grizzled hairs. The red goral is also the smallest goral, and has a greater curvature to its horns. Both males and females have a pair of short, arcing horns. The horns of males tend to be longer and thicker than those of females, but lengths of 7.5–16 cm are typical for both sexes.

Red gorals are most active during the day, and tend to retreat to inaccessible cliffs at night, where they sleep on sheltered ledges. They are strong climbers and jumpers, and seek safety from predators by fleeing up cliffs. They can clear obstacles over 1.8 m high from a standing start. Although generally quiet, males make a call which sounds like "zer - zer" during the breeding season; female red gorals also whistle as males approach. Red gorals typically inhabit a home range of around 40 hectares. Males are territorial during the breeding season. Their diets consist of lichens, grasses, stems, and leaves.

Fewer than 10,000 red gorals are believed to survive today. The actual number may be quite less; fewer than 1,500 red gorals were thought to live in Tibet - the largest part of the species' range - in 1998. However, in Mishmi Hills, Arunachal Pradesh in northeastern India, it is among the relatively more abundant ungulates.[2]

Their range is centered around the region where the borders of India, Tibet and Myanmar meet.

The red goral is geographically isolated, and the smallest of the presently recognized species. [3] Body weights range from 20–30 kg, while the length of the head and body is around 100 cm. Records of captive animals show the females tend to be slightly larger than males, with otherwise very little difference between the sexes. [4]

The generic name Naemorhedus is derived from the Latin words nemus (genitive nemoris), meaning "forest", and haedus, meaning a young goat.

This species is named after Lt Col F. M. Bailey, who explorer the "frontier region" extensively prior to the first World War. While he collected the brown type specimen for N. b. baileyi, he also made note of bright red goral-skin coats made by locals in the Mishmi Hills. [5] The first "red" specimen was collected by the Earl of Cranbrook in upper Burma along with Captain F. Kingdon Ward in 1931. Although an unusual specimen, no formal description or name was given to this new red goral until 1961.

N. baileyi is primarily diurnal, with most activity occurring in the early morning and evening. [6] During the day, red gorals graze on sunny slopes, retreating to rocky cliffs at night, where they bed down on sheltered ledges. [7] As with most members of the Caprinae, red gorals are very agile and move with easy speed amongst rough terrain. [8] A captive female in Rangoon Zoo was observed jumping over a 1.8-meter-high fence from a standing start. [9] This species retreats up cliffs when threatened. [10]

Red gorals are primarily solitary, although females tend to be accompanied by their latest youngster. [11] N. baileyi is occasionally seen in small groups, typically with three animals. The composition of these groups is usually a male, a female, and her offspring, or a female with her offspring from the previous two years. [12]

This species breeds from September to November.[13] During the rut, males will follow females closely, being in frequent nasogenital contact (often accompanied by smelling and licking) to determine the onset of estrus. Nonreceptive females will either flee from the advances of males or threaten them by butting the bodies of the males with their heads. Receptive females tend to stand still as the male approaches, signalling their estrus by raising their tails. The Flehmen response (lip curl) was observed during the majority of encounters between a male and a receptive female.

This species is listed on Appendix I of CITES (2009). Their world population is estimated to be less than 10,000 animals, and is likely considerably less. [14] From data collected in 1987 and 1988, the Tibetan population of this species was estimated to number between 810 and 1,370 animals. [15] Numbers in India and Myanmar are unknown, but due to the restricted range of this species, they are unlikely to be common. [16] Hunting is a major threat to the continued survival of this species; it is the most heavily harvested ungulate in its range.[17] Habitat loss due to forestry practices and clearing for agriculture also poses a major threat. [18] Red gorals inhabit several protected regions, including Hkakabo-Razi National Park in Myanmar, and Gangxiang, Muotuo, Xiaca, and Medoq in Tibet. [19] A small captive-breeding group is kept in the Shanghai Zoo. [20]

Source

  1. ^ Duckworth, J.W. & MacKinnon, J. (2008). Naemorhedus baileyi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 5 April 2009. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ Choudhury, A.U. (2010) Mammals and birds of Dihang – Dibang Biosphere Reserve, North-east India. Lambert Academic Publishing, Saarbrücken, Germany. 104pp.
  3. ^ (Hayman, 1961; Rabinowitz, 1999).
  4. ^ (Zhang, 1987).
  5. ^ (Hayman, 1961).
  6. ^ (Sheng Helin et al., 1999).
  7. ^ (Zhang, 1987; Sheng Helin et al., 1999).
  8. ^ (Hla Aung, 1967; Zhang, 1987).
  9. ^ (Hla Aung, 1967).
  10. ^ (Zhang, 1987).
  11. ^ (Zhang, 1987; Sheng Helin et al., 1999).
  12. ^ (Zhang, 1987).
  13. ^ Xie (2006).
  14. ^ (Duckworth and MacKinnon, 2008).
  15. ^ (Wang Sung et al., 1997).
  16. ^ (Duckworth and MacKinnon, 2008).
  17. ^ Rabinowitz (1999)
  18. ^ (Wang Sung et al., 1997; Duckworth and MacKinnon, 2008).
  19. ^ (Rabinowitz, 1999; Wang Sung et al., 1997).
  20. ^ (Wang Sung et al., 1997).

http://en.wikipedia.org/wiki/Frederick_Marshman_Bailey

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!