Overview

Brief Summary

Biology

Takin are found in small family groups of around 20 individuals, although older males may lead a more solitary existence. In the summer months, herds of up to 300 individuals gather high up on the mountain slopes (4). Mating takes place between July and August and a single young is born after a gestation period of around eight months (4). Takin migrate from the upper pasture to lower, more forested areas in winter (4). When disturbed, individuals will give a 'cough' alarm call and the herd will retreat into thick bamboo thickets and lie on the ground for camouflage (2). Takin feed in the early morning and late afternoon (2), grazing on a variety of leaves and grasses (4). Salt is also an important part of their diet and groups may stay at a mineral deposit for several days (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The takin is one of the larger and stockier of the goat antelopes (5). Short, stocky legs are supported on large two-toed hooves, which have a highly developed spur (4). The large head is made more distinctive by the arched Roman nose, and both sexes bear stout horns that can reach 64 centimetres in length and are ridged at the base (4). The long shaggy coat is light in colour with a dark stripe along the back (4), and males (bulls) also have a dark face (5). Four subspecies of takin are currently recognised, and these tend to show a variation in coat colour. The legend of the 'golden fleece', searched for by Jason and the Argonauts (2), may have been inspired by the lustrous coat of the golden takin (B. t. bedfordi) (5). Rather than localised scent glands, the takin has an oily, stong-smelling substance secreted over the whole body (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in Bhutan, China (southeastern Gansu, Sichuan, Shaanxi, southeast Tibet, and northwestern Yunnan), and northeast India (Arunachal Pradesh and Sikkim; Singh 2002) and northern Myanmar (Salter 1997).

Budorcas taxicolor bedfordi
This golden takin is confined to the Qinling mountains in southern Shaanxi, China where distribution records of its occurrence have been collected throughout mountain ranges between elevations of 1,500 to 3,600 m. The area covers 17 counties of Shaanxi Province, west from Mount Ziboshan in Liuba County, as far east as Niubeiliang in Zashui County (Ge 1990; Schaller et al. 1986; Wu et al. 1991). The current distribution region covers 18 counties of Shaanxi province: Foping, Yangxian, Ningqiang, Liuba, Mianxian, Chenggu, Ningshan, Shiquan, Fengxian, Zashui, Zhen’an, Danfeng, Taibai, Meixian, Zhouzhi, Liantian, Chang’an, and Huxian (Forestry Bureau of Shaanxi Province 2001).

Budorcas taxicolor taxicolor
The Mishmi takin is found in the southeast of Tibet and northwestern Yunnan, but its distribution in China is split into two sections by the extreme northeast tip of India and northern Myanmar. In Tibet, the western boundary is formed by the great bend of the Yarlung Zangbo (Tsangpo) river, where it occurs south of Medog on the mountain slopes on the border with Arunachal Pradesh (India). It enters China again southeast of here in northern Yunnan, where it inhabits the Gaoligongshan range which lies between the west side of the Salween (Nu) river and the Sino-Myanmar border. This eastern section of its distribution extends from around Gongshan in the north, south to include Fugong, Lushui, Tengchong, Baoshan and at least as far as Longling (Feng et al. 1986; Wu et al, 1987). In Myanmar, it occupies the high mountain slopes above 2,750 m in Kachin State, northern Myanmar, to the border with China (Blower, 1985, Salter 1997). However, there is no recent distribution data. The geographic boundary between B. t. taxicolor and B. t. whitei is evidently uncertain.

Budorcas taxicolor tibetana
Sichuan takin is found along the eastern margin of the Tibetan plateau. Here, its distribution runs from the Min mountains along the Sichuan-Gansu provincial border, south through the Qionglai mountains west of Chengdu to the border with Yunnan Province. Records of this takin have been found from more than 50 counties in Minshan in the north, Xianling in the west, as well as in the Qionglai Shan in the centre, and the Liang Shan in the south.

Budorcas taxicolor whitei
In Tibet, China, this subspecies is known to occur south of the Yarlung Zangbo river, from Gyaca, Nangxian. Mainling, Myingchi, Cona and Lhunze, on the southern flank of the eastern Himalaya, to the west side of the big bend of the Yarlung Zangbo river. In Bhutan, no censuses have been carried out, but it is believed the species occurs in scattered populations throughout the forested and unforested mountain slopes along Bhutan’s northern border. One or two populations are known to occur on both sides of the upper catchment of the Mo Chu (Wollenhaupt, 1990). Within Bhutan, Jigme Dorji National Park is the main stronghold, but they are also found in northern Wangdue and Bumthang districts (Tshewang Wangchuk pers. comm., 2008); these populations appear to be separated from those in Tibet. Within India, takin is found in Arunachal Pradesh (both along its western border with Bhutan and its northeastern border with China and Myanmar), and in Sikkim. There it inhabits sub-tropical to subalpine forests, mainly between 2,000 and 3,500 m, but sometimes entering as low as 1,500 m, or up to areas above timberline (Fox and Johnsingh 1997, Singh 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The species Budorcas taxicolor is found in Eastern Tibet, Sikkim, Bhutan, northern Assam, northern Burma, and central and southern China. (Nowak 1999)

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the Himalayas and western China (2), their range extends from India, into China, Myanmar and Bhutan (1). The four subspecies differ in range; the golden and Sichuan takins (B. t. bedfordi and B. t. tibetana respectively) are found only in China, whist the Mishimi takin (B. t. taxicolor) is also in India and Myanmar, and the Bhutan takin (B. t. whitei) is found in China, Bhutan and India (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Also known as "cattle chamois" and "gnu goat," the takin has physical similarities to all of these animals. The body length of an adult male is between 210 and 220 cm, and a female is about 170 cm. The tail reaches about 15 cm, and is usually hidden under the thick, long, shaggy fur. The coat is whitish yellow to golden yellow to reddish brown, and has a dark stripe down the back. A male grows to stand about 120 cm at the shoulders, whereas a female is around 105 cm. The takin's head is large with an arched muzzle and a broad, naked nose. The horns, which appear in both sexes, can be as long as 64 cm. They are "transversely ribbed" and start "near the midline of the head, abruptly turn outward, and then sweep backward and upward" (Nowak 1999, p.1215). The legs are short and have large, strong two-toed hooves with a highly developed spur. (Parker 1989, Nowak 1999, Minelli and Minelli 1997)

Range mass: 150 to 400 kg.

Range length: 170 to 220 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in eastern Himalayan pine shrub, subtropical forest, and possibly temperate forest in Myanmar (Than Zaw pers. comm. 2006). Budorcas taxicolor whitei inhabits sub-tropical to subalpine forests, mainly between 2,000 and 3,500 m, but sometimes entering as low as 1,500 m, or moving up to areas above the timberline. In summer, Takin feed in alpine meadows up to 4,000 m. In winter they descend into the valleys and forests to as low as 1,000 m. They feed on a variety of grasses, bamboo shoots, forbs and leaves of shrubs and trees. Takin forage in early morning and late afternoon, and regularly visit salt-licks which renders them very vulnerable to poachers who lay in ambush. Takins seasonally migrate to preferred habitats. During spring and early summer months, they begin to gather in large herds of up to 100 animals at the uppermost limits of treeline. During cooler autumn months, when food is less plentiful at higher elevations, herds disband into smaller groups of up to 20 individuals, and move to forested valleys at lower elevations. Groups mainly comprise females, subadults, young and some adult males. Older males usually remain solitary throughout most of the year, but gather with females during the rutting season. Sexually mature at about 3.5 years of age. Rutting occurs in late summer, followed by a gestation of 200 to 220 days. Single young are born in March or April. Longevity is about 16-18 years.

Budorcas taxicolor bedfordi inhabits in temperate forest and coniferous forest from 1,300 to 2,800 m in the Foping Nature Reserve, and make seasonal vertical movement (Zeng et al. 2008). They feed on 163 species of plant, including grasses, bamboo shoots, forbs and leaves of shrubs and trees (Zeng and Song 2001). Breeding season starts in early June and lasts to the end of July with a peak from middle of June to middle of July (Wang et al. 2005). Newborn calves are observed in February and March. Mean group size was 10.84 (n=96), the male:female ratio was0.49:1 (Zeng et al. 2002). Solitary males were observed during the breeding season; most solitary, old males were seen during winter in lower elevation. Sexually maturity occurs at 4.5 years of age for female and 5.5 for males in wild populations of B.t. bedfordi.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species is found in elevations from 1000 to 4250 meters. The habitat ranges from rocky, grass covered alpine zones to forested valleys. (Parker 1989)

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found from forested valleys to rocky, grass covered alpine zones; at altitudes of between 1,000 and 4,500 metres above sea level (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The takin is a generalist herbivore, mostly a browser. It feeds in the early morning or late afternoon and eats primarily deciduous leaves found on trees or shrubs, but also grasses and herbs. During the winter, the food of choice is twigs or evergreen leaves. This species has been known to topple saplings up to 10 cm in diameter, or even stand on it hind legs in order to reach leaves. Takins also require great mineral intake, and sometimes travel great distances to reach salt deposits, where they may stay for several days. (Minelli and Minelli 1997, Parker 1989)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
15.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.9 years (captivity) Observations: One captive specimen was alive at 21.9 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating in this species occurs in July and August. Gestation lasts around 7 or 8 months. Only one young is conceived during each pregnancy, and it usually weighs between 5 and 7 kg at birth. The young are able to follow their mother around within 3 days of birth, and they start to eat solid food after the first one or two months of life. Sexual maturity is attained after 30 months. (Nowak 1999)

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 6.67 to 7.33 months.

Average birth mass: 6000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Parental Investment: post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Budorcas taxicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2456-09|FJ006534|Budorcas taxicolor| AACCGCTGATTATTTTCAACTAATCATAAAGATATCGGTACCCTTTATCTTCTATTTGGTGCCTGAGCCGGCATAGTAGGAACCGCCCTG---AGCTTACTAATTCGTGCTGAGCTAGGCCAACCCGGAACTCTACTTGGAGAT---GACCAGATCTACAACGTAATTGTAACTGCACACGCATTCGTAATAATCTTCTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGCAACTGGCTAGTTCCTCTAATG---ATTGGAGCCCCTGATATAGCATTCCCTCGGATGAATAATATAAGTTTTTGACTCCTCCCCCCTTCTTTCCTATTACTCCTAGCATCCTCTATAGTCGAAGCCGGAGCAGGGACGGGTTGAACCGTATATCCCCCTCTAGCAGGTAATCTAGCCCACGCAGGAGCCTCAGTAGACCTG---ACCATTTTCTCCCTACACCTAGCAGGTGTTTCCTCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAACATAAAACCTCCCGCAATATCACAATACCAAACCCCCCTGTTCGTGTGATCTGTACTGATCACTGCCGTACTACTCCTCCTCTCACTTCCTGTATTAGCAGCT---GGCATCACAATATTACTAACAGACCGAAACCTGAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGACCCTATCTTATATCAACACTTATTCTGATTTTTTGGACACCCCGAAGTATATATTCTAATTTTACCTGGCTTTGGAATAATCTCCCACATCGTAACCTACTATTCAGGAAAAAAA---GAGCCATTTGGGTATATAGGAATAGTATGAGCCATAATATCAATTGGATTTCTAGGATTTATTGTATGAGCCCATCATATATTCACAGTCGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Budorcas taxicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Song, Y.-L., Smith, A.T. & MacKinnon, J.

Reviewer/s
Harris, R. & Festa-Bianchet, M. (Caprinae Red List Authority)

Contributor/s

Justification
The species is listed as Vulnerable A2cd based on a probable decline of at least 30% over the last three generations (estimated at 24 years) due to over-hunting and habitat loss.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The takin is endangered because of overhunting and habitat destruction. It is also prey to bears and wolves. (Nowak 1999)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) by the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3). Subspecies: Golden takin (Budorcas taxicolor bedfordi) and Mishmi takin (B. t. taxicolor) are classified as Endangered (EN); Sichuan takin (B. t. tibetana) and Bhutan takin (B. t. whitei) are classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Budorcas taxicolor bedfordi
The total population size in China was estimated as 21,200 individuals by Ge (1990), but a later effort by provincial officials in Shaanxi estimated 5,069 (range: 4,418-5,720; Forestry Bureau of Shaanxi Province 2001). Three centers of relatively high population density occur in Taibai, Ningshan and Zhouzhi, where they are restricted to the upper catchments areas of several rivers (Wu et al., 1987). In 1974, a field survey of five areas gave the following numbers of takin: Fuping - 104; Taibai - 191; Yangxian - 225; Zhouzhi - 587; and Ningshan - 135 (Total 1,242) (Wu et al., 1987). A census by counting individuals in Foping Nature Reserve from April to July 1996, there were 435-527 individuals there with a ratio of adult females: subadults: calves of 1:0.99: 0.35 (Zeng et al. 1998).

Budorcas taxicolor taxicolor
No rigorous estimate has been made of the total population in China, but Wang (1998) estimated about 3,500, mostly in Tibet. In Myanmar populations are decreasing because of hunting for bushmeat (by trapping and crossbow), and is now rare (Than Zaw pers comm. 2006).

Budorcas taxicolor tibetana
No total population estimate in China has been made, but several thousand animals are believed to inhabit the Qionglai and Min mountains. A survey of Sichuan takin populations carried out in 1975 in the Wolong and Tangjiahe Nature Reserves (Qingchuan county), estimated 191 (Wu et al., 1987) and 370 to 410 (Ge et al., 1989) animals, respectively. Large herds numbering as many as 45 to 100 individuals have been seen occasionally in Tianguan, Baoxing, Pingwu and Qingchuan. Other population observations estimate the young to account for 17.8%, the sub-adults for 13.3% and the adults 68.9%, while the adult male to female sex ratio is 2:1 (Wu et al., 1990; see also Schaller et al., 1986).

Budorcas taxicolor whitei
There is no known estimate of population size or trend for B. taxicolor whitei within China, Bhutan, or India.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Budorcas taxicolor bedfordi
Deforestation, hunting, disturbance, and habitat fragmentation are continuing concerns (Wang 1998).

Budorcas taxicolor taxicolor
In Tibet, China, hunting is the main threat, but habitat destruction caused by deforestation is also serious (Wang et al. 1997, Wang 1998). In Myanmar populations are threatened by for bushmeat (by trapping and crossbow; Salter 1997).

Budorcas taxicolor tibetana
Overhunting has resulted in local extirpation of this takin in some areas of its range, and recovery has been slow despite legal protection measures. Habitat loss and disturbance from tourism are also significant threats.

Budorcas taxicolor whitei
With almost no management or protection in the remote border areas of China, over-hunting by local people is hard to control, and hunting of large herds in winter is reported to be a serious problem (Feng et al., 1986). In Bhutan, threats include competition and disease transmission from domestic livestock, habitat loss (pasture burning), and loss or disruption of migration routes. In India, major threats come primarily from habitat loss resulting from activities such as timber harvesting, cane and bamboo cutting and road construction, all associated with human populations that continue to encroach on areas occupied by takin. Local people are also known to hunt takin regularly, both within and outside protected areas. Recent surveys of takin found evidence of hunting in the Siang Valley and Kamlang Wildlife Sanctuary but only limited sign of the animals themselves, whereas in Mehao Wildlife Sanctuary, considerable numbers of takin tracks and droppings, and evidence of hunting were found (Katti et al., 1990). Current levels of hunting by local residents may not represent a significant influence on takin populations (Katti et al., 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Very little data on the distribution and size of takin populations exists, partly as a consequence of the inaccessibility of their habitat (6). Factors such as habitat loss, competition with other species and disease are all thought to be threatening takin populations today but further research is urgently required (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In China, all subspecies are protected from direct exploitation by their inclusion under Category I of the National Wildlife Law of 1988, although a small number are taken yearly in trophy hunts. They are not legally hunted in India or Bhutan. Their legal status in Myanmar is uncertain. The species is listed on Appendix II of CITES.

Budorcas taxicolor bedfordi
The subspecies is currently protected by legal statute (the National Wildlife Protection Law of 1988) and nature reserves in Shaanxi, and both distribution and number seem to have increased in recent years. As of 2003, fourteen nature reserves, occupying about 3,250 km² have been established for protection of takin and their habitat. Logging bans established in the late 1990s greatly improved the habitat conditions and security for B. t. bedfordi.

Budorcas taxicolor taxicolor
In the remote areas where this subspecies lives in China, local people may not be aware of its legal status. It occurs in Nujiang Nature Reserve, located in the northern mountains of Yunnan, which was established in 1981 to protect this takin along with other endangered species. Herds of greater than 100 animals have been seen in this nature reserve (Lu, 1987). It also occurs in Gaoligongshan in Yunnan. It ocurrs in Cibagou Nature Reserve (Wu and Zhang 2006) and Dong Jiu Nature Reserve (MacKinnon et al. 1996) in Tibet. It occurs mainly within protected areas in Myanmar, (Than Zaw pers comm. 2006). In Arunachel Pradesh, India, it occurs in Namdapha National Park, Mouling National Park, Dibang Willdife Sanctuary, Kamlang Wildlife Sanctuary, and the Dihang-Dibang Biosphere Reserve (Singh 2002). Conservation measures proposed are: 1) complete a population census of the Mishmi takin, beginning in the Nujiang Nature Reserve, before moving to other parts of its range; 2) develop a co-operative program between Chinese and Myanmar authorities to strictly forbid hunting of this animal; and 3) locate potential protected areas.

Budorcas taxicolor tibetana
Between 1963 and 1978, a total of 10 nature reserves were established in Sichuan to protect endangered animals such as the giant panda and golden monkey, but most also provided protection for Sichuan takin. Protected areas with this subspecies include: Baishuijiang (Gansu); Baihe, Fengtongzhai, Jiuzhaigou, Labahe, Mabian Dafending, Tangjiahe, Wanglong, Wolong and Xiaozhaizigou (Sichuan). Since that time, the nature reserve system with habitat for the taxon has continued to expand, including Huanglongsi and Meigudanfengding (Sichuan), and Jianshan and Tou’ersantan (Gansu; MacKinnon et al. 1996), Captive breeding has been successful in Chengdu Zoo since 1978 (Hu et al. 1984). The primary conservation measure proposed is further scientific study on the ecology and management of this subspecies is necessary for its long term conservation.

Budorcas taxicolor whitei
This taxon is currently listed in Schedule I of Bhutan’s Forest and Nature Conservation Act (1995). In China, it is found in Nujiang (Yunnan) and Muotua (Feng et al., 1986) Nature Reserves. In Bhutan, the species is known to inhabit Jigme Dorji National Park. Conservation measures proposed include: 1) educate local people to make them aware of conservation legislation; 2) develop co-operative conservation measures between countries; 3) undertake a survey to census numbers and delineate distributions; 4) special emphasis should be given to determining and preserving its migration routes between seasonal ranges to protect takin habitat (Wollenhaupt, 1990); 5) in India, establish the proposed biosphere reserve that encompasses the Namdapha National Park and several additional protected areas in northeastern Arunachal Pradesh (if adequately protected, these areas would significantly increase the number and size of effective conservation areas for takin); and 6) continually reassess human populations and their increased access in the takin distribution area since the species is commonly hunted by locals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The takin is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), and an export permit is thus required for international trade (3). A captive population exists and is managed by the studbook held at Minnesota Zoo in the United States (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None found

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Native peoples commonly hunt the takin for its meat. (Nowak 1999)

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Takin

The takin (play /ˈtɑːkɪn/; Budorcas taxicolor; Tibetan: ར་རྒྱ་Wylie: ra rgya), also called cattle chamois or gnu goat,[2] is a goat-antelope found in the Eastern Himalayas. There are four subspecies: B. taxicolor taxicolor, the Mishmi takin; B. taxicolor bedfordi, the Shanxi or golden takin; B. taxicolor tibetana, the Tibetan or Sichuan takin; and B. taxicolor whitei, the Bhutan Takin. Mitochondrial research shows that takin are related to sheep, its similarity to the muskox being an example of convergent evolution.[3] The takin is the national animal of Bhutan.[4] In Kung Fu Panda: Legends of Awesomeness, a villain, Jong Sung Jai Kai Chow is a takin.

Contents

Appearance

The takin is one of the larger and stockier of the goat antelopes. Short legs are supported on large, two-toed hooves, which have a highly developed spur.[2][5] The large head is made more distinctive by the long, arched nose, and stout horns that are ridged at the base and can reach 64 centimetres in length.[2] The long shaggy coat is light in color, with a dark stripe along the back,[2] and males (bulls) also have a dark face.[5] Four subspecies of takin are currently recognised, and these tend to show a variation in coat color. The legend of the 'golden fleece', searched for by Jason and the Argonauts,[6] may have been inspired by the lustrous coat of the golden takin (B. t. bedfordi).[5] Rather than localised scent glands, the takin has an oily, strong-smelling substance secreted over the whole body.[5]

Takin stand 100 to 130 cm (39 to 51 in) at the shoulder and weigh up to 350 kg (770 lb).[7] Biologist George Schaller likened the takin to a "bee-stung moose",[4] because of the swollen appearance of the face. They are covered in a thick golden wool which turns black on the under-belly. Both sexes have small horns which run parallel to the skull and then turn upwards in a short point, these are around 30 cm (12 in) long.

Habitat

Takin are found from forested valleys to rocky, grass covered alpine zones, at altitudes of between 1,000 and 4,500 metres above sea level.[2] The Mishmi takin occurs in eastern Arunachal Pradesh while the Bhutan takin in western Arunachal Pradesh and Bhutan.[8] There are also records from Sikkim.[citation needed] Dihang-Dibang Biosphere Reserve in Arunachal Pradesh is a stronghold of both Mishmi, Upper Siang (Kopu) <ref= 10>Dasgupta et al. (2010) and Bhutan takins.[9] A captive population exists and is managed by the studbook held at Minnesota Zoo in the United States.[10]

Biology

Takin are found in small family groups of around 20 individuals, although older males may lead a more solitary existence. In the summer months, herds of up to 300 individuals gather high up on the mountain slopes.[2] Mating takes place between July and August and a single young is born after a gestation period of around eight months.[2] Takin migrate from the upper pasture to lower, more forested areas in winter.[2] When disturbed, individuals will give a 'cough' alarm call and the herd will retreat into thick bamboo thickets and lie on the ground for camouflage.[6]

Takin feed in the early morning and late afternoon, grazing on a variety of leaves and grasses.[6] Salt is also an important part of their diet and groups may stay at a mineral deposit for several days.[2]

Photos

References

This article incorporates text from the ARKive fact-file "Takin" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ Yanling, S., Smith, A.T. & MacKinnon, J. (2008). Budorcas taxicolor. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 31 March 2009. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ a b c d e f g h i Animal Diversity Web (November, 2002)  "Budorcas taxicolor" (University of Michigan Museum of Zoology) via arkive.org
  3. ^ Pamela Groves, Gerald F. Shields, CytochromeBSequences Suggest Convergent Evolution of the Asian Takin and Arctic Muskox, Molecular Phylogenetics and Evolution, Volume 8, Issue 3, December 1997, Pages 363-374, ISSN 1055-7903, DOI: 10.1006/mpev.1997.0423.
  4. ^ a b Tashi Wangchuk (2007). "The Takin - Bhutan's National Animal". In Lindsay Brown, Stan Armington. Bhutan. Lonely Planet. p. 87. ISBN 978-1-74059-529-2. http://books.google.com/books?id=s-L8NUlW_QgC&pg=PA87. Retrieved 15 September 2011. 
  5. ^ a b c d Macdonald, D. (2001) The New Encyclopedia of Mammals. Oxford University Press, Oxford. via arkive.org
  6. ^ a b c Huffman, Brent. "Budorcas taxicolor" Ultimate Ungulate via arkive.org
  7. ^ WWF: Takin
  8. ^ Choudhury, A.U. (2003). The mammals of Arunachal Pradesh. Regency Publications, New Delhi. 140pp
  9. ^ Choudhury, A.U. (2010). Mammals and birds of Dihang – Dibang Biosphere Reserve, North-east India. Lambert Academic Publishing, Saarbrücken, Germany. 104pp.
  10. ^ Minnesota Zoo (March, 2008) "Takin" mnzoo.com Retrieved 2011-09-15

11. ^Dasgupta, S., Sarkar, P., Deori, D., Kyarong, S., Kaul, R., Ranjitsinh, M. K. & Menon, V. 2010 Distribution and Status of Takin (Budarcos taxicolor)along the Tibet, Myanmar and Bhutan border in India. A report of Wildlife Trust of India submitted to CEPF. 47 pages.

Further reading

Maurice Burton; Robert Burton (January 2002). The international wildlife encyclopedia. Marshall Cavendish. pp. 2623–4. ISBN 978-0-7614-7285-8. http://books.google.com/books?id=EBl7y_MX0xoC&pg=PA2622. Retrieved 15 September 2011. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!