Overview

Brief Summary

Biology

Greater kudus are sociable animals with groups of up to 25 females and their offspring of both sexes mingling and separating frequently (2). The larger males roam more widely and form loose bachelor groups, generally only joining female herds during the mating season, which extends through April and May in South Africa (3). During this time the necks of the mature males swell to display their bulging muscles and aggression between males is common. When rival males meet, one stands with his mane erect in a posture that best exaggerates his size, while the other circles around. These displays can sometimes develop into fights with one male locking his strong, spiral horns around the body of his opponent. Occasionally, the horns of the two males may become intertwined, and unable to free themselves from this position, both competitors may die (3). Greater kudu are always alert to predators (5), such as lions and spotted hyenas (3), and will flee rapidly from any potential danger. Despite their bulky size, greater kudus are remarkably agile and are surprisingly adept at jumping, easily capable of clearing a two-metre fence (5). Calves are born in January and February after a nine month gestation, and for the first three to four weeks of life they lie hidden in vegetation, the mother visiting to nurse them (3) (4). Female calves remain with their mother's herd, whereas males disperse after two years of age (3). Greater kudus feed on a variety of foliage, herbs, vines, fruits, flowers and grass, the composition of their diet depending on the season (2). Their long legs and necks enable them to reach food at great heights, exceeded only by the giraffe (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This handsome antelope is easily distinguished by the male's spectacular spiral horns, which can reach astonishing lengths of over a metre, and the six to ten thin pale stripes against its tawny-brown to grey-brown body (2) (3). Female greater kudus are smaller than males, and lack the impressive horns. The coat colour of the females is also somewhat different, varying from sandy yellowish-grey to russet, against which the thin stripes are conspicuous (2) (4). Both sexes have a crest of hair that runs along the middle of the back and forms a mane (2), and there is a distinct white band across the face between the eyes. Their large, rounded ears give a slightly comical appearance (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Historically, the Greater Kudu occurred over much of eastern and southern Africa, from Chad nearly to the Red Sea, south to the Eastern Cape, west to Namibia and north to mid-Angola. While it has disappeared from substantial areas, mainly in the north of its range, it generally persists in a greater part of its former range than other large antelope species, as a result of its secretiveness and its ability to survive in settled areas with sufficient cover. As in the past, it is much more sparsely distributed and less numerous in the northern parts of its range (from northern Tanzania northwards) than further south. The species seems now to be extinct at least in Somalia; there is no recent information on their status in Sudan or Djibouti (East 1999; Owen-Smith in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Greater kudus are found in southern and eastern Africa. The population is the most dense in the south. In East Africa, the population is broken up and there are many isolated groups in the mountains (Estes, 1991).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The greater kudu's range extends from the mountains of south-east Chad to Sudan and Ethiopia and throughout the drier areas of East and southern Africa (2). In southern Africa the greater kudu occurs mainly in the northern and eastern parts, with isolated populations in the Cape Province (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Greater kudu are one of the tallest antelopes, with shoulder heights ranging from 100 cm to 150 cm. Greater kudus have the largest horns in the bushbuck tribe, averaging 120 cm in length. The body color of the greater kudu varies from reddish brown to blue-gray, with the darkest individuals found in the southern populations. The color of the males darkens with age. Along its back, the kudu has six to ten stripes. Its tail is black tipped with a white underside. Males possess a beard that females lack (Estes, 1991).

Range mass: 120 to 315 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Tragelaphus strepsiceros
Catalog Number: USNM 163247
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): K. Roosevelt
Year Collected: 1909
Locality: Donyo Gelsha, Escarpment E Of Lake Baringo, Baringo District, Rift Valley, Kenya, Africa
  • Type: Heller, E. 1913 Sep 16. Smithsonian Miscellaneous Collections. 61 (13): 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Preferred habitat includes mixed scrub woodland (it is one of the few large mammals that thrives in settled areas - in the scrub woodland and bush that reclaims abandoned fields and degraded pastures-), acacia, and mopane bush on lowlands, hills, and mountains. Recorded to 2,400 m in Ethiopia (Yalden et al. 1996). Kudu are browsers; they can exist for long periods without drinking, obtaining sufficient moisture from their food, but become water dependent at times when the vegetation is very dry (Owen-Smith in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greater kudu are found in a variety of habitats throughout Africa. As long as they have good cover, greater kudu are able to survive in the settled areas of Africa. Greater kudu can be found in habitats that provide bush and thicket cover. In the rains, greater kudu remain in the deciduous woodlands. During the dry season they can be found in along the banks of rivers where there is rich vegetation (Estes, 1991).

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits savanna woodland, especially in hilly, broken ground, and woods along watercourses, avoiding open grassland and forest (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Greater kudu are herbivores. They eat a wide variety of leaves, herbs, fruits, vines, flowers, and some new grass. They may water in the dry season but are capable of surviving in a waterless region (Estes, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
23.0 years.

Average lifespan

Status: captivity:
20.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.5 years (captivity) Observations: These animals can live up to 23.5 years in zoos (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Greater kudu are seasonal breeders in southern Africa. At the equator, they calve in the rainy season, which is from February to June, and mate near or after the end of the rains (Kingdon, 1982). Females, if well nourished, can breed in two years. Most females, however, do not reach maturity until three years of age. Males are mature in five years. There is a nine month gestation period, and calves are born when the grass is high. Calves remain hidden for two weeks before joining the herd. Greater kudu calves are weaned at six months. Male calves remain in the maternity herd for 1 and 1/2 to 2 years while the females remain in it longer (Estes, 1991).

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 7 to 8.7 months.

Average weaning age: 6 months.

Average birth mass: 15000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
517 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus strepsiceros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACCCTATATTTATTATTTGGTGCTTGAGCCGGTATGGTGGGAACAGCCCTAAGCTTACTAATCCGCGCTGAATTAGGTCAACCCGGAACATTACTCGGAGACGACCAAATCTACAACGTAATTGTAACCGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCCATTATGATCGGAGGCTTTGGTAATTGGCTCGTTCCTTTAATAATTGGAGCCCCTGATATAGCATTCCCCCGAATGAATAATATAAGCTTCTGACTTCTTCCCCCTTCCTTTCTCCTACTCTTAGCCTCATCCATAGTCGAAGCCGGAGCGGGAACCGGTTGAACTGTATATCCCCCTTTAGCAGGCAACCTAGCTCACGCAGGAGCCTCAGTAGACCTAACCATTTTCTCCCTTCACTTAGCAGGTGTTTCCTCAATTTTAGGGGCTATTAACTTTATCACAACAATTATCAATATAAAACCCCCTGCAATATCACAATACCAAACTCCCTTATTCGTATGATCCGTGATAATCACCGCCGTACTGTTACTCCTCTCACTTCCTGTACTAGCAGCTGGCATCACAATATTATTAACAGACCGAAATTTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCTATCTTATACCAACACCTGTTCTGATTCTTTGGACATCCAGAAGTCTATATTCTTATCCTACCCGGATTTGGAATAATTTCTCATATTGTGACTTATTATTCAGGAAAAAAAGAACCATTTGGATATATAGGAATAGTTTGGGCTATGATGTCAATTGGATTTTTAGGATTTATCGTATGAGCCCACCATATATTCACAGTTGGAATAGACGTCGATACACGAGCCTATTTCACATCAGCCACCATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGCTGACTAGCAACACTTCATGGAGGAAATATCAAATGATCACCAGCCATAATGTGAGCCCTAGGATTCATTTTCCTCTTCACAGTAGGAGGTTTAACCGGAATTGTTTTAGCTAACTCCTCCTTAGACATTGTTCTCCATGATACATATTATGTAGTCGCACACTTCCACTACGTATTATCAATAGGGGCTGTATTTGCCATTATAGGAGGCTTCGTACATTGATTCCCACTATTTTCAGGTTACACCCTTAATGACACGTGAGCTAAAATCCACTTTGCAGTCATATTTGTAGGGGTTAACATAACCTTTTTCCCACAACACTTCCTAGGATTATCAGGCATGCCACGACGATATTCTGATTATCCAGACGCATACACGACATGAAATACTATCTCATCAATAGGCTCATTTATCTCCCTAACAGCTGTAATATTAATAGTCTTTATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTATCAACCGTAGACTTAACTACAACAAACCTAGAGTGATTAAACGGATGTCCCCCACCATATCACACATTTGAAGAACCCGTGTACGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus strepsiceros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Total population numbers have been estimated at c. 482,000, with about 15% in protected areas and 61% on private land. Population trends are generally increasing in protected areas and on private land and decreasing elsewhere (24%). It therefore does not currently meet the criteria for threatened status or for Near Threatened. The species’ overall status will remain satisfactory as long as it continues to be represented by large, stable or increasing populations on private land and in protected areas in southern and south-central Africa. The high numbers of this species on private land reflect its value as one of Africa’s major trophy animals. The safari hunting industry is therefore very important for ensuring the continued existence of large numbers of Greater Kudu on private land. The status of the northern populations is precarious, and their survival will depend on more effective protection and management.

History
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

---

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Citing various authors, East (1999) indicates that population estimates are available for many parts of the Greater Kudu’s range, but many of these are based on aerial counts which tend to substantially underestimate this species’ actual numbers. The sum of the available estimates (352,000) is therefore likely to be considerably less than the true total numbers of the species. Population densities estimated from aerial surveys are frequently less than 0.1/km², even in areas where this species is known to be at least reasonably common. Higher densities of 0.2-0.4/km² have been estimated by aerial surveys in some other areas. Ground counts in areas where the Greater Kudu is common have produced population density estimates from 0.3/m² to 4.1/km² (East 1999).

East (1999) estimated a total population of around 482,000 Greater Kudu, with the largest populations found in Namibia, where the species remains widely abundant on private farmland, and South Africa. Population trends are generally stable or increasing on private land and in protected areas in southern and south-central Africa and Tanzania, but show a tendency to decline in other regions.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Greater Kudu’s status is less satisfactory in the northern parts of its range, due to overhunting and habitat loss. However, this does not seem to be affecting the species' overall long-term survival as they remain abundant and well managed in other parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The greater kudu is fairly abundant in parts of southern and south Central Africa, but becomes increasingly uncommon northward into East Africa (5). They are believed to be endangered in Somalia and Uganda and vulnerable in Chad and Kenya (2). Hunting poses a threat as the greater kudu is prized for its beautiful horns and meat, and human encroachment and habitat destruction may also have a detrimental impact (6). Populations of greater kudu are susceptible to outbreaks of disease, such as anthrax and rabies, but luckily, kudu populations appear to recover rapidly from disease-caused mortality (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Greater Kudu are well represented in protected areas, rom southern Tanzania to South Africa, with major populations in parks and reserves such as Ruaha-Rungwa- Kisigo and Selous (Tanzania), Luangwa Valley and Kafue (Zambia), Etosha (Namibia), Moremi, Chobe and Central Kgalagadi (Botswana), Hwange, Chizarira, Mana Pools and Gonarezhou (Zimbabwe) and Kruger and Hluhluwe-Umfolozi (South Africa). It also occurs widely outside protected areas, including large numbers on private farms and conservancies in southern Africa (Namibia, Zimbabwe and South Africa) where it is a mainstay of the trophy hunting industry (East 1999).

In the northern parts of its range, key areas where some of the northern populations appear to have reasonable prospects for long-term survival include Zakouma N.P. (Chad), Awash N.P. (Ethiopia), Baringo, northern Laikipia and Tsavo (Kenya), and Tarangire (Tanzania) (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Greater kudus are well represented in national parks and reserves (2), for example, the Selous Game Reserve, Tanzania (7), and the Kruger National Park and Bavianskloof Protected Area, South Africa, which forms part of an important World Heritage Site, the Cape Floral Kingdom (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Greater kudus destroy farmers' crops in Africa (Kingdon, 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In southern Africa, greater kudus have been hunted for many years. The meat from the greater kudus is very good and the horns of the male kudus are a trophy for many African hunters (Kingdon, 1982). Greater kudu can also be found in zoos throughout the world (Estes, 1991).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater kudu

The greater kudu (Tragelaphus strepsiceros) is a woodland antelope found throughout eastern and southern Africa. Despite occupying such widespread territory, they are sparsely populated in most areas, due to a declining habitat, deforestation and poaching.[2] The greater kudu is one of two species commonly known as kudu, the other being the lesser kudu, Tragelaphus imberbis.

Physical characteristics[edit]

Anterior view of a male

Greater kudus have a narrow body with long legs, and their coats can range from brown/bluish-grey to reddish-brown. They possess between 4–12 vertical white stripes along their torso. The head tends to be darker in colour than the rest of the body, and exhibits a small white chevron which runs between the eyes.[2]

Male greater kudus tend to be much larger than the females, and vocalize much more, utilizing low grunts, clucks, humming, and gasping.[citation needed] The males also have large manes running along their throats, and large horns with two and a half twists, which, were they to be straightened, would reach an average length of 120 cm (47 in), with the record being 187.64 cm (73.87 in).[citation needed] They diverge slightly as they slant back from the head. The horns do not begin to grow until the male is between the age of 6–12 months, twisting once at around 2 years of age, and not reaching the full two and a half twists until they are 6 years old; occasionally they may even have 3 full turns.[2]

This is one of the largest species of antelope. Males weigh 190–270 kg (420–600 lb), with a maximum of 315 kg (694 lb), and stand up to 160 cm (63 in) tall at the shoulder. The ears of the greater kudu are large and round. Females weigh 120–210 kg (260–460 lb) and stand as little as 100 cm (39 in) tall at the shoulder; they are hornless, without a beard or nose markings. The head-and-body length is 185–245 cm (6.07–8.04 ft), to which the tail may add a further 30–55 cm (12–22 in).[3]

Subspecies[edit]

Formerly four subspecies have been described, but recently only one to three subspecies have been accepted based on colour, number of stripes and horn length:[4]

  • T. s. strepsiceros, southern parts of the range from southern Kenya to Namibia, Botswana and South Africa
  • T. s. chora, northeastern Africa from northern Kenya through Ethiopia to eastern Sudan, western Somalia and Eritrea
  • T. s. cottoni, Chad and western Sudan

This classification was supported by the genetic difference of one specimen of northern Kenya (T. s. chora) in comparison with several samples from the southern part of the range between Tanzania and Zimbabwe (T. s. strepsiceros). No specimen of the northwestern population, which may represent a third subspecies (T. s. cottoni) was tested within this study.[4]

In Groves and Grubbs book Ungulate Taxonomy, a recent taxonomic revision was made which evaluated all species and subspecies of Kudu and other ungulates. This review split the genus Tragelaphus into 4 separate genera, Tragelaphus (Bushbuck, Sitatunga, Bongo, and the Gedemsa or Mountain Nyala), Nyala (the Nyala), Ammelaphus (Lesser Kudu), and Strepsiceros (Greater Kudu) and there close relative Taurotragus (Elands). The Greater Kudu was split into four species based on genetic evidence and morphological features (ex horn structure and coat color). Each species was based on a different subspecies, Strepsiceros strepsiceros (Cape Kudu), Strepsiceros chora (Northern Kudu), Strepsiceros cottoni (Western Kudu), and Strepsiceros zambesiensis (Zambezi Kudu) which is not commonly accepted even as a subspecies. The Cape Kudu is found in South Central South Africa, the Zambezi Kudu (closely related to the Cape Kudu) is found from Tanzania South to North and West South Africa, Namibia, and Angola through Zambia, Mozambique, and East DR Congo, the Northern Kudu is found in East Sudan South through Ethiopia and Kenya to the Tanzanian border, and the Western Kudu found in Southeastern Chad, West Sudan, and North Central African Republic. Although this alternative taxonomy is not commonly accepted, it was accepted in the Handbook of the Mammals of the World.

Range and ecology[edit]

Range of the subspecies of the greater kudu
Kudu in dense brush (Addo National Park)

The range of the greater kudu extends from the east in Ethiopia, Tanzania, Eritrea and Kenya into the south where they are found in Zambia, Angola, Namibia, Botswana, Zimbabwe and South Africa. They have also been introduced in small numbers into New Mexico, but were never released into the wild. Their habitat includes thick bushveld, rocky hillsides, dry riverbeds and anywhere with a constant supply of water.[citation needed] They will occasionally venture onto plains only if there is a large abundance of bushes, but normally avoid such open areas to avoid becoming an easy target for their predators. Their diet consists of leaves, grass, shoots and occasionally tubers, roots and fruit (they are especially fond of oranges and tangerines).[2]

Kudus at waterhole

During the day, Greater kudus normally cease to be active and instead seek cover under woodland, especially during hot days. They feed and drink in the early morning and late afternoon, acquiring water from waterholes or roots and bulbs which have a high water content. Although they tend to stay in one area, the greater kudu may search over a large distance for water in times of drought, in southern Namibia where water is relatively scarce they have been known to travel extremely long distances in very short periods of time.[2]

Predators of the greater kudu generally consist of lions, leopards, hyenas, and hunting dogs. Although cheetahs also prey on greater kudus, they are unable to bring down a mature male, so usually go for the more vulnerable females and offspring. When a herd is threatened by predators, an adult (usually female) will issue a bark to alert the rest of the herd. Despite being very nimble over rocky hillsides and mountains, the greater kudu is not fast enough (and nor does it have enough stamina) to escape its main predators over open terrain, so instead relies on leaping over shrubs and small trees to shake off pursuers.[2]

Life history[edit]

Herd of kudu

Female greater kudus live in small herds of six to twenty individuals along with their calves, though males tend to be mainly solitary, they sometimes form bachelor herds that consist of 4 to 8 young males (sometimes with an older bull as well). Rarely will a herd reach a size of forty individuals, partly because of the selective nature of their diet which would make foraging for food difficult in large groups.[2] A herd's area can encompass 800 to 1,500 acres (6.1 km2), and spend an average of 54% of the day foraging for food.[citation needed].

Fully mature males will often fight other males by interlocking their horns with the other until one of them admits defeat and gives in. In rare circumstances this can sometimes result in both males being unable to free themselves from the other's horns, usually resulting in the death of both animals. Females may sometimes ward off males by biting them, due to their lack of horns.[2]

Kudu calf

Greater kudus reach sexual maturity between 1–3 years of age. The mating season occurs at the end of the rainy season, which can fluctuate slightly according to the region and climate. Before mating, there is a courtship ritual which consists of the male standing in front of the female and often engaging in a neck wrestle. The male then trails the female while issuing a low pitched call until the female allows him to copulate with her. Gestation takes around 240 days (or eight months).[2] Calving generally starts between February and March, when the grass tends to be at its highest.[citation needed]

Greater kudus tend to bear one calf, although occasionally there may be two. To begin with, the calf will wait for the mother to feed it, but later it will become more demanding in its search for milk, and after a few months even aggressive.[2] For the first two weeks of a calf's life they hide where predators cannot find them. For four to five weeks after that they roam with the herd only during day. Males will become self-sufficient at 6 months old. Females become self-sufficient at around 1 to 2 years old.[citation needed] Greater kudus may live up to 20 years of age when kept in captivity.[2]

Human interaction[edit]

Greater kudus have both benefited and suffered from interaction with humans; they are a target for poachers. They also are very evasive, using tactics of running short distances and hiding instead of simply running away which other African antelope commonly do. Humans have also destroyed woodland cover which they use for their habitat. However, wells and irrigation set up by humans has also allowed the greater kudus to occupy territory which would have been too devoid of water for them previously.[2]

The horns of greater kudus are commonly used to make Shofars, a Jewish ritual horn blown at Rosh Hashanah.

See also[edit]

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Tragelaphus strepsiceros. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b c d e f g h i j k l Oddie, Bill (1994). Wildlife Fact File. IMP Publishing Ltd. Group 1, Card 110. ISBN 0951856634. 
  3. ^ Greater kudu. Ultimateungulate.com. Retrieved on 2013-10-17.
  4. ^ a b Nersting, L. G.; Arctander, P. (2001). "Phylogeography and conservation of impala and greater kudu". Molecular ecology 10 (3): 711–719. doi:10.1046/j.1365-294x.2001.01205.x. PMID 11298982.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!