Overview

Distribution

Range Description

The Bushbuck ranges very widely in sub-Saharan Africa, occurring in 40 African countries, more than any other antelope species (East 1999). They range from Mauritania, Senegal and Guinea Bissau through West Africa, south of the Sahara, to north-east Africa then southwards throughout East Africa and the more mesic areas of southern Africa to the Western Cape of South Africa (East 1999; Plumptre and Wronski in press). The only sub-Saharan country from which they have not recently been recorded, and where they may formerly have occurred, is Lesotho (Lynch 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Throughout central Africa, from south of the Sahara to north of the Kalahari deserts.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male bushbucks are bigger than females, with weights ranging from 40 to 80 kg and shoulder heights from 70 to 100 cm. Females weigh about 25 to 60 kg and are 65 to 85 cm tall. Only males have horns, which usually spiral once and are fairly straight, parallel to one another, and up to a half meter long. Females are usually a lighter brown than males. Both sexes have white spots and stripes, the patterns of which vary geographically.

Range mass: 25 to 80 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Tragelaphus scriptus
Catalog Number: USNM 182267
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): E. Heller
Year Collected: 1911
Locality: Maji-Ya-Chumvi, Coast Province, Kenya, Africa
  • Type: Heller, E. 1913 Sep 16. Smithsonian Miscellaneous Collections. 61 (13): 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bushbuck occur widely in sub-Saharan Africa wherever there is cover to conceal it, from sea level to 4,000 m, from rainforest edge to patches of gallery forest and bush near water in the subdesert. It is naturally absent from arid and semi-arid regions and from extensive areas of closed-canopy forest. Its ability to survive in human-dominated landscapes and to withstand heavy hunting pressure have enabled it to persist over much of its former range (East 1999). Bushbuck are primarily browsers; in some areas, they enter agricultural fields to eat crops and may be considered a pest (Plumptre and Wronski in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bushbucks can be found throughout their broad distribution wherever there is adequate cover for concealment, nearly irrespective of altitude or aridity. They live in forest edges or brushy cover associated with rivers and streams. During the night they move out of their home thicket to somewhat more open areas to feed.

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bushbucks are browsers. They eat herbs and the leaves, twigs, and flowers of a large number of plant species. Although they will eat a wide variety of plant species when hungry, they are somewhat selective when possible, prefering knobbly creeper and sausage tree. They will also occasionally eat fresh grass.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
15.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.3 years (captivity) Observations: One captive specimen lived 15.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Young can be born at any time of year, but in arid regions there is a peak in birth rates during the rainy season. Gestation requires only 180 days, allowing a female to produce more than one calf per year. A single calf weighing about 4 kg is born. The calf does not follow its mother out into the open to forage until it is four months old. It remains hidden in the dense underbrush in the mean time, and its mother returns periodically to let it nurse. Sexual maturity is reached at one year, but males' horns do not reach full size until three years of age.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 5.93 to 6.23 months.

Average gestation period: 5.99 months.

Average birth mass: 3800 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
496 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus scriptus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTTTCAACTAACCATAAAGATATTGGCACCCTATATTTACTATTCGGTGCTTGAGCCGGTATAGTAGGAACAGCCCTTAGCCTACTAATCCGGGCCGAACTAGGTCAACCCGGAACATTACTCGGAGATGACCAAATTTACAACGTAATTGTAACCGCACACGCATTTGTAATAATTTTCTTCATAGTAATGCCCATTATAATTGGGGGGTTTGGTAACTGACTCGTTCCTCTGATAATTGGAGCCCCTGACATAGCATTTCCCCGGATAAACAACATAAGTTTCTGACTTCTTCCCCCTTCTTTCCTCCTACTCTTAGCCTCATCCATAGTTGAAGCCGGAGCAGGAACCGGTTGAACCGTATACCCTCCTTTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTGGATCTAACCATTTTCTCCCTGCACTTAGCAGGTGTTTCCTCAATTCTAGGAGCCATTAATTTTATCACAACAATTATTAACATAAAACCCCCCGCAATATCGCAGTACCAAACCCCACTATTTGTATGGTCTGTAATAATTACAGCCGTACTACTACTCCTCTCGCTTCCTGTACTTGCAGCCGGCATCACAATACTACTAACAGACCGAAATCTAAACACAACTTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACACTTATTTTGATTCTTTGGACACCCAGAAGTTTATATTCTTATTTTACCTGGGTTTGGAATAATTTCTCATATTGTAACTTATTACTCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTCTGAGCTATGATATCAATCGGATTTCTAGGGTTTATTGTATGAGCCCACCATATATTCACAGTCGGAATAGACGTTGACACACGAGCCTATTTCACATCAGCCACCATAATTATCGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCAACACTTCATGGAGGCAACATTAAATGATCACCAGCCATGATGTGGGCCCTAGGTTTCATCTTCCTTTTTACAGTAGGAGGTTTAACTGGAATTGTTCTAGCCAACTCCTCCCTTGACATTGTCCTCCACGACACATATTATGTAGTCGCACATTTCCACTATGTACTATCAATAGGAGCTGTATTTGCCATTATAGGAGGCTTCGTACATTGATTTCCACTGTTTTCGGGCTATACCCTTAATGACACATGAGCCAAAATTCACTTTGCAATCATATTTGTAGGAGTTAACATGACCTTTTTCCCACAACACTTCCTAGGATTATCAGGCATACCACGACGATACTCTGACTACCCAGACGCATACACGATATGAAATACCATCTCATCAATAGGTTCTTTCATCTCACTAACAGCCGTTATACTTATAGTTTTTATTATCTGAGAAGCATTTGCATCTAAGCGAGAAGTCTTGACCGTAGACCTAACCACAACAAACCTAGAATGATTAAACGGATGCCCTCCTCCATATCACACATTTGAAGAACCCACGTATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus scriptus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Total population numbers are estimated at ca. 1,340,000, and this is probably a conservative estimate. Numbers are generally stable over considerable parts of the range, but decreasing near densely settled areas. It therefore does not currently meet the criteria for threatened status or Near Threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are no special conservation efforts for this species. They are able to coexist with human habitation to a greater extent than many other species, and in some areas they are considered a pest and their population is controlled.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Bushbuck reaches high densities in localized areas of favourabe habitat, e.g., 78 resident individuals were identified within a 2.6 km² area of open forest within Nairobi National Park (Kenya) giving a population density of 30/km², and faecal counts gave population density estimates of 11 - 44/km² in montane forest and adjoining habitats within Volcanoes National Park (Rwanda). Aerial surveys undoubtedly grossly underestimate the Bushbuck’s population density because of its preference for cover and its secretive habits. Ground surveys have produced density estimates of 0.08-1.0/m², but again the Bushbuck’s tendency to remain concealed probably results in significant undercounting in some ground surveys (East 1999; Plumpre and Wronski in press; and references therein).

East (1999) estimated the total population of Bushbuck at 1,340,000, likely an underestimate. Its numbers are stable over considerable parts of its range, but are decreasing in densely settled regions (various authors in East 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Bushbuck have disappeared from some areas in the drier parts of its former range because of habitat destruction and increasing aridity, but it is expanding its distribution within the equatorial forest zone as this is opened up by human activities. There do not seem to be any major threats to its long-term conservation, although numbers may be gradually decreasing locally as hunting pressures increase in parts of its range (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bushbuck is present in numerous protected areas across its range. Its ability to survive widely in settled areas and successfully utilize habitats modified by human activities should ensure that it survives in substantial numbers outside protected areas for the foreseeable future (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Bushbucks cause or are involved in a number of problems. Perhaps most seriously, their populations are controlled in areas near domestic cattle. Since bushbuck live among the trees and shrubs associated with rivers, they are frequently bitten by tsetse flies, which could then infect the cattle with nagana (sleeping sickness). Bushbuck cause damage in pine forestry areas by nibbling the tops of the young trees, resulting in excessive branching. Also, they frequently live on the outskirts of towns and cities, and in these areas they damage peoples' gardens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These antelopes have been hunted as a food source.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kéwel

The kéwel (Tragelaphus scriptus) is a small to medium sized antelope widespread in west and central Africa. Formerly and alongside the imbabala it was generically known as the bushbuck, however, it has since been found to be a species in its own right, with a separate geographic distribution. Of all the other tragelaphine antelopes, the kéwel is most closely related to the nyala (Tragelaphus angasi).[1]

Distribution[edit]

The kéwel is distributed from Senegal and southern Mauritania across the Sahel, east to Ethiopia and Eritrea and south to Angola and the southern DRC. It is common across this broad geographic distribution and is found in wooded savannas, forest-savanna mosaics, penetrating into some of the rain forest zones of the southern Central African Republic, Gabon, DRC and the Congo, in montane forests of the Bamenda Highlands and Mt. Cameroon and in the semi-arid zones of the Ethiopian lowlands and Eritrea. It does not occur in the deep rain forests of the central Congo Basin.

Description and Genetics[edit]

The kéwel is in general smaller than other tragelaphines, with a mainly red or yellow-brown ground colour. It is conspicuously striped with several vertical and at least one horizontal stripe and there is little to no sexual dimorphism with respect to patterning and ground colouration. It has been referred to as the harnessed antelope or guib harnaché. The conspicuousness of its patterning tends to attenuate sightly in a west to east cline along the species range, being least striking in the decula population of Ethiopia and Eritrea. Seven other genetically-based population groupings exist,[2] some do not correspond to previously described subspecies. The nominate scriptus population occurs in west Africa including Senegal, Gambia, Guinea and Sierra Leone, while two populations occur along the upper and lower Volta valley, respectively, one in the Niger Basin in Nigeria as far east as the Cross River, phaleratus south of the Bamenda Highlands through Cameroon, Gabon, Congo, DRC to northern Angola, bor from Lake Chad and the Schari across the CAR to the Nile, and lastly dodingae east of the Nile in lowland areas of southern Sudan and northern Uganda.

As the first of the bushbucks to be described by Pallas in 1766 as Antilope scripta from Senegal, it retains the original species name for the bushbuck. Its common name, Kéwel,[3] is taken from the Wolof language spoken in Senegal. As most studies of the bushbucks have focused on the imbabala (Tragelaphus sylvaticus), very little is known about the biology of the kéwel, except for what can be gleaned from museum specimens and hunting trophies.

References[edit]

  1. ^ Moodley Y, Bruford MW, Bleidorn C, Wronski T, Apio A, Plath M (2008) Analysis of mitochondrial DNA data reveals non-monophyly in the bushbuck (Tragelaphus scriptus) complex. Mammalian Biology, doi:10.1016/j.mambio.2008.05.003
  2. ^ Moodley Y, Bruford MW. (2007) Molecular biogeography: Towards an integrated framework for conserving pan-African biodiversity. PLoS ONE. 2:e454.
  3. ^ Wronski T, Moodley Y. (2009) Bushbuck, harnessed antelope or both? Gnusletter, 28(1):18-19.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!