Overview

Brief Summary

Biology

This elegant antelope is fairly solitary; females are usually found in groups of two or three, or with calves, and males are often found alone. Young males will stay with their mothers for up to two years, but will not acquire enough social status to mate until four to five years old. When large enough, males fight by locking horns and pushing each other backwards. Males and females will also fight each other for superiority, by standing up on hind legs to try to knock each other down, but the larger males normally win. Females are pregnant for seven to eight months, and will separate from their small group to give birth to a single calf (2). The calf has just a one in four chance of surviving to three years old due to disease and predation by leopards, hunting dogs and spotted hyenas (2) (4). The lesser kudu is mainly nocturnal and camouflages well when hiding in dense thickets after sunrise. It feeds at dusk and dawn, eating leaves, shoots, twigs, fruits, grasses and herbs (2). When startled, the lesser kudu will bark and runs in bounding leaps (2), holding the tail upright to reveal the white underside (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Often thought of as the most beautiful antelope, the lesser kudu has a single white stripe running down the back and white stripes running off this central stripe down the sides. These stripes contrast with a red-brown background in females and a grey background in males. Young are even redder than females, but males will turn grey between 1.5 to 2 years. The face is distinctive with a black stripe from each eye to the nose, and a white stripe from each eye to the centre. The legs are fawn, with white patches above the hooves. White patches are also seen on the throat and chest, together with a central black stripe. The belly is pure white, the ears are large and the horns are long and spiralled (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser kudu (Ammelaphus or Tragelaphus imberbis)

The lesser kudu is elegant. It has a white stripe running down the back and 11-14 white stripes run off this central stripe down the sides. These stripes contrast with a reddish-brown background in females, with lighter undersides, and a grey background in males. Young are redder than females, but males turn grey at 1.5-2 years. The face has has a black stripe from each eye to the nose and a white stripe from each eye to the centre of the face. The lip area is white and there are four white spots on the lower jaw (two per side). There are white patches on the throat and chest, with a central black stripe spanning the chest area, and Both have about ten white stripes on their backs and two white tufts on the underside of the neck. The belly is white, the ears are large. The legs are fawn, with white patches above the hooves. The tail is brown above and white beneath with a black tip. Only males have horns, which measure about 70 cm (28 in) and have one twist.

The kudu is 1.10-1.75 m from the tip of the snout to the base of the tail and stands 0.9-1.1 m (35-43 in) tall at the shoulder. The tail ranges from 26-30 cm with up to 90 cm of additional hair length. range Females weigh 50-70 kg (110-150 lb) and males weigh 60-105 kg (130–230 lb). Males have horns ranging from 48-91 cm, have two longitudinal keels, twist 2.5 times, and a basal circumference of 15.6-17.1 cm. At the base, they span 6-12 mm; at their ends, they span 25-35 cm. The skull is long with a short cranium. The long nasal bones are narrowed in the center and form a 'V' shaped suture where they meet the frontals. The supraorbital foramina are within indentations and are elongated horizontally. The paraoccipital proccess are flat and wide and the teeth are hypsodont. The kudu occupies semi-arid areas, such as dry, flat, and densely thicketed areas of subtropical and tropical dry shrubland as well as woodlands and hilly land. It is rarely seen in open or cleared areas or long grass (6). It lives in eastern and north-eastern Africa - the Somali-Masai Arid Zone of Ethiopia, Somalia, Kenya, Uganda and Tanzania. Its range extends from ca. 12°N in the Awash area of Ethiopia southward through southern Ethiopia, much of Somalia except the north and northeast (east of 46° E and north of 08°N), most of Kenya except the southwest, extreme southeast Sudan, extreme northeast Uganda to northeast and central Tanzania. It is extinct in Djibouti (6) and its purported former occurrence in Saudi Arabia (7) is based on two sets of horns said to have originated from Saudi Arabia and one from southern Yemen. No live animals have been reported from the area and the true origin of those specimens remains in doubt; they may have been introduced or released from a collection. The kudu is closely associated with Acacia-Commiphora thornbush in north-eastern Africa (6). It has been recorded at about 1,740 m near Mt Kilimanjaro (8). The kudu is fairly solitary and shy. Females usually live in groups of two to five, ranging up to 24; males are often found alone. The kudu is mainly nocturnal and crepuscular and camouflages well when hiding in dense thickets and dry bush after sunrise. Its large ears aid in a well developed sense of hearing that warns it of potential predators. When startled, it will bark and runs in bounding leaps, holding the tail upright to reveal the white underside. It can jump more than 6 m (20 ft) and 2 m (6.6 ft) high and can reach running speeds of around 70 km/h (43 mph). It feeds at dusk and dawn. It is mainly a browser and eats a diverse variety of bush and tree leaves, shoots, twigs, fruits, grasses and herbs. It obtains most of its water requirements from its food plants. When males are large enough, they fight by locking horns and pressing their heads and horns together and try to force their horns down onto the nape of their opponent. Males and females fight each other for superiority, by standing up on hind legs to try to knock each other down, but the larger males normally win. Males show restraint and are never aggressive towards females, but females may butt their heads against the males. When males mount, they lay their neck and head down and onto the females back (11). Each female has her own, independent estrus cycle and is anestrus for only a couple of weeks (9). She is pregnant for 7.4-8.5 months and separates from her small group to give birth to one calf, weighing 4.0-7.5 kg. 50% of the calves die within the first 6 months, from disease and predation by leopards, hunting dogs and spotted hyenas, and only 25% survive to reach 3 years of age. Males begin horn growth after the first 6-9 months and reach full length after 3 years. Young males stay with their mothers for 1.5-2 years, before they leave and travel alone or in small sporadic male groups (10). Young females form small groups with their mother or siblings. The kudu becomes sexually mature at 1.25-1.50 years, but males do not gain social status to reproduce until they reach the age of 4-5 years (11). The average life span is 10-15 years in the wild and 15 years in captive, with one captive reaching 19.8 years (9). IUCN list the kudu as conservation dependent (9), but Lower Risk (1). The total population is estimated to be at least 118,000 (6), about 33% being in protected areas. Numbers are considered to be in decline overall, due to hunting for sport and its meat and horns, habitat loss, overgrazing, increase in pastoralism and outbreaks of rinderpest, which led to a decline in the mid 1990s (6). The horns are hollowed out and used as wind instruments, honey containers and in spiritual rituals as they are thought to house powerful spirits as well as being a symbol of male virility (2,4). In Tsavo National Park, elephant populations have altered the vegetative landscape.The level of decline is predicted to reach at least 25% over a period of three generations (21-24 years), so approaching the threshold for Vulnerable. The kudu will probably persist in the arid scrublands of northeastern Africa, if human and livestock densities stay relatively low in extensive parts of its range such as northern Kenya and southern Ethiopia. Its status may eventually decline to threatened. Its shyness and preference for thick cover help it withstand considerable hunting pressure (6). Lesser kudu are also vulnerable to the rinderpest virus which periodically breaks out and reduces populations (5). The kudu’s long-term survival prospects would be enhanced by improved protection and management of the protected areas that support substantial populations. Its value as a trophy animal gives it high potential for increased revenue generation in extensive bushlands (6).The lesser kudu is part of the American Zoo and Aquarium Association's studbook program which ensures the most possible genetic diversity within the captive breeding population (6). The lesser kudu was placed in the genus Tragelaphus. It was described by Edward Blyth in 1869. It was thought to be a smaller version of the greater kudu, but is now is considered to be a more primitive species, being the most primitive spiral-horned antelope. Its evolutionary line diverged in the late Miocene, possibly 10 million years ago. There may have been an early hybridization between the proto-lesser kudu and proto-nyala, but these lines have been separate for most of the evolutionary history. The lesser kudu being the most basal member of the 'Tragelaphus' group. In 1912, Edmund Heller established the genus Ammelaphus for the Lesser Kudu, the type species being A. strepsiceros (2). The lesser kudu was raised to a genus level by Peter Grubb and Colin Groves in 2011 (3), as it represents an evolutionary line that has remained separate since the end of the Miocene (5.8 million years ago). Grubb and Groves state that Ammelaphus has two species, the northern (A. imberbis from Ethiopia and Somalia) and southern (A. australis from Kenya, Tanzania, Sudan and southern Somalia). The lesser kudu has 38 chromosomes, in both sexes. Unlike other tragelaphids, the X chromosome and Y chromosome are compound and fused with autosomes from ancestors having a greater chromosome number (5).
  • 1. IUCN SSC Antelope Specialist Group (2008). "Tragelaphus imberbis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 23 July 2012.
  • 2. Heller, Edmund (November 2, 1912). New Genera and Races of African Ungulates. Washington D. C.: Smitsonian Institution. p. 15.
  • 3. Groves, Colin, Peter Grubb (2011). Ungulate Taxonomy. Baltimore, Md.: Johns Hopkins University Press. p. 139. ISBN 1-4214-0093-6.
  • 4. Miller, Melissa, Tim Wild, Steve Shurter. "Lesser kudu".
  • 5. Benirschke, K.; Rüedi, D.; Müller, H.; Kumamoto, A.T.; Wagner, K.L.; Downes, H.S. (1 January 1980). "The unusual karyotype of the lesser kudu, Tragelaphus imberbi's". Cytogenetic and Genome Research 26 (2-4): 85–92. doi:10.1159/000131429.
  • 6. East, R. (1999). African Antelope Database 1998. IUCN, Gland, Switzerland.
  • 7. Harrison, D., P. Bates (1991). The Mammals of Arabia. Kent, England: Harrison Zoological Museum Publications.
  • 8. Grimshaw, J.M., N.J. Cordeiro and C.A.H. Foley. (1995). The mammals of Kilimanjaro. Journal of East African Natural History 84:105-139.
  • 9. Weigl, R. (2005). Longevity of Mammals in Captivity; From the Living Collections of the World. [Kleine Senckenberg-Reihe 48]. E. Schweizerbart’sche Verlagsbuchhandlung (Nägele und Obermiller), Stuttgart.
  • 10. Nowak, R. (1999). Walker's Mammals of the World. Balitimore: The John Hopkins University.
  • 11. Walther, F. (1990). Spiral-Horned Antelopes. Pp. 344-359 in S Parker, ed. Grzimek's Encyclopedia of Mammals. New York: McGraw-Hill Publishing Company.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Olingo

Supplier: Olingo

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The range of Tragelaphus imberbis, the Lesser Kudu, is restricted to northeast Africa. It was once believed to inhabit Saudi Arabia, however, only two sets of horns have been found that substantiate this claim. BR

(Harrison and Bates 1991; Nowak 1999; Roosevelt and Heller 1914; Walther 1990)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Lesser Kudu occupies semi-arid areas of north-eastern Africa, commonly known as the Somali-Masai Arid Zone of Ethiopia, Somalia, Kenya and Tanzania. Its range extends from ca. 12° N in the Awash area of Ethiopia southward through southern Ethiopia, much of Somalia except the north and northeast (i.e. east of 46° E and north of 08°N), most of Kenya except the southwest, extreme southeast Sudan, extreme northeast Uganda to northeast and central Tanzania (Leuthold in press). It is extinct in Djibouti (East 1999).

The purported former occurrence of this species in Saudi Arabia (Harrison and Bates 1991) is based on two sets of horns said to have originated from Arabia and one from southern Yemen. No live animals have ever been reported from the area, and the true origin of those specimens remains in doubt.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The lesser kudu is restricted to parts of eastern and north-eastern Africa (2). Two specimens from the Arabian Peninsula are believed to have been introduced or released from a collection (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Lesser Kudu is the largest bovid in Arabia, with the exception of the Oryx (Harrison and Bates 1991). It is 1.10-1.75 meters from the tip of the snout to the base of the tail and stands at a height of 0.90-1.05 meters. The tail ranges from 0.26 to 0.30 meters with up to 0.90 meters of additional hair length. Males have horns that range from 0.48 to 0.91 meters, have two longitudinal keels, twist 2.5 times, and a basal circumference of 156-171 mm. At the base, they span 6-12 mm; at their ends, they span 0.25-0.35 meters. Males have various shades of grey fur, and females are distinctly more reddish brown. One long white stripe runs the length of the back with 11-14 stripes branching downward off of it. The face has a black stripe from each eye to the nose and a white stripe from each eye to the center of the face. The lip area is white and four white spots are found on the lower jaw (two per side). The legs are fawn colored with a white patch above the hoof. The tail is brown above and white underneath, and a black tip. There are white patches on the throat and chest with a black stripe that spans the chest area. The abdomen is pure white. Young Kudus are similar in color to females but redder, and males become more grey by the age of two years.

The lesser kudu is hard to observe in dry bush due to its camouflage, and because its large ears aid in a well developed sense of hearing that warns it of potential predators.

The skull of the Lesser Kudu is long with a short cranium. The nasal bones are long and narrowed in the center. They form a 'V' shaped suture where they meet the frontals. The supraorbital foramina are located within indentations and are elongated horizontally. The paraoccipital proccess are flat and wide, and the teeth are hypsodont.

(Harrison and Bates 1991; Nowak 1999; Roosevelt and Heller 1914; Walther 1990)

Range mass: 60 to 105 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Tragelaphus imberbis
Catalog Number: USNM 182073
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): M. Johnston
Year Collected: 1911
Locality: Longaya Water, Marsabit District, Eastern Province, Kenya, Africa
  • Type: Heller, E. 1913 Sep 16. Smithsonian Miscellaneous Collections. 61 (13): 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The Lesser Kudu inhabits dry, flat, and densely thicketed areas, as well as woodlands and hilly land. It is rarely observed in open or cleared areas.

(Nowak 1999; Roosevelt and Heller 1914; Walther 1990)

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Lesser Kudu is closely associated with Acacia-Commiphora thornbush in semi-arid areas of north-eastern Africa; it generally avoids open spaces and long grass (East 1999; Leuthold in press). They have been recorded at about 1,740 m near Mt Kilimanjaro (Grimshaw et al. 1995). The Lesser Kudu is primarily a browser, consuming mainly leaves of trees, shrubs and herbs, and their water requirements can largely be fulfilled from the water content of the food plants (Leuthold in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A shy species, the lesser kudu lives in dry, flat and densely thicketed areas of subtropical and tropical dry shrubland (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Lesser Kudu feeds primarily at dusk or at dawn (Roosevelt and Heller 1914) and eats a diverse variety of bush and tree leaves, shoots and twigs, as well as, grasses, herbs, and fruits. It has been reported to be fairly independent of water sources and browses in relatively arid environments.
(Nowak 1999; Roosevelt and Heller 1914; Walther 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: wild:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.8 years (captivity) Observations: One captive specimen lived 19.8 years (Richard Weigl 2005). There are anecdotal reports of animals living over 20 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Lesser Kudu is a fairly solitary species. Young males stay with their mother for only 1.5-2.0 years, before they leave and travel alone or in small sporadic male groups (Nowak 1999). Young females form small groups with their mother or siblings. The Lesser Kudu becomes sexually mature at 1.25-1.50 years, however, males do not gain social status to reproduce until they reach the age of 4-5 years (Walther 1990). BR>Males perform a shoving match, where they press their heads and horns together and attempt to force their horns down onto the nape of their opponent. Males and females also perform a superiority contest, where the male and female stand fully erect on their hind legs and attempt to push each other over. The larger male usually wins. The males show restraint and are never aggressive towards females, though females have been observed to butt their heads against the males. When the males mount, they lay their neck and head down and onto the females back(Walther 1990). <BR>Each female has its own, independent estrus cycle and is anestrus for only a couple of weeks (Nowak 1999). Gestation ranges from 7.5 to 8.0 months, then the female separates from the group in order to give birth. Only one offspring is produced, weighing 4.0-7.5 kg. 50% of the calves die within the first six months, from disease and predation, and only 25% survive to reach 3 years of age. Males begin horn growth after the first 6-9 months and reach full length after 3 years. The life span of the Lesser Kudu reportedly can reach up to 15 years. <BR

(Harrison and Bates 1991; Nowak 1999; Roosevelt and Heller 1914; Walther 1990)

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 7.4 to 8.5 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 6000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
504 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
504 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus imberbis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGACATTGGCACCCTGTATTTACTATTTGGTGCTTGAGCTGGCATGGTAGGAACTGCTCTGAGCCTGCTAATCCGTGCTGAGTTAGGTCAACCCGGAACACTACTCGGAGATGATCAAATCTATAATGTAATTGTAACCGCACACGCATTTGTAATAATCTTCTTTATAGTAATACCTATCATAATTGGGGGCTTCGGTAACTGACTTGTCCCATTAATAATTGGAGCCCCTGATATAGCGTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCTTCCTTTCTCCTGCTCTTGGCCTCATCAATAGTCGAAGCTGGAGCGGGGACTGGTTGAACCGTATATCCCCCTCTGGCAGGTAATCTAGCACACGCAGGAGCCTCAGTAGACTTAACCATCTTTTCCCTACACTTAGCAGGTGTTTCTTCAATCCTAGGGGCTATTAACTTTATTACAACGATCATTAACATAAAACCCCCTGCAGTATCACAATATCAAACACCCTTATTCGTGTGATCTGTAATAATCACCGCTGTACTACTACTTCTCTCACTCCCTGTGCTAGCAGCTGGCATCACAATACTCCTGACAGACCGAAATCTAAACACAACTTTCTTTGACCCGGCAGGAGGAGGAGACCCTATCTTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTTTACATTCTTATTCTACCCGGGTTTGGAATAATTTCTCATATTGTAACTTACTACTCAGGAAAAAAAGAGCCATTCGGATATATAGGAATAGTTTGAGCTATGATATCAATCGGATTCTTAGGATTTATTGTATGGGCCCACCACATATTCACAGTTGGAATAGACGTTGACACACGAGCCTACTTCACATCAGCTACTATGATTATTGCCATCCCAACAGGAGTAAAAGTTTTCAGTTGACTAGCAACACTTCATGGAGGCAATATCAAATGATCACCAGCTATAATGTGAGCCCTAGGCTTCATTTTCCTCTTTACAGTAGGAGGCTTGACCGGAATCGTCCTAGCTAACTCCTCCCTGGATATTGTTCTCCACGATACATATTATGTAGTCGCACATTTCCATTACGTACTGTCAATAGGAGCCGTGTTTGCCATTATAGGGGGATTCGTACATTGATTCCCACTGTTTTCGGGCTACACTCTCAATGACACATGAGCCAAAATCCACTTTGTAATTATATTCGTAGGGGTTAACATGACTTTCTTCCCACAACATTTCCTAGGACTGTCAGGCATGCCACGACGATACTCTGACTACCCGGACGCATACACAATATGAAATACCATCTCATCAATAGGCTCATTTATTTCCCTAACAGCTGTAATACTAATAGTCTTTATTATCTGGGAAGCATTCGCATCTAAACGAGAAGTCCTGACCGTAGACCTAACTTCAACAAACCTAGAGTGGTTAAATGGATGTCCCCCACCATATCATACATTTGAAGAACCCACATACGTCAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus imberbis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Lesser Kudu is listed in IUCN as conservation dependent (Nowak 1999). Populations have continued to decline due to hunting or habitat loss caused by human activities or in the case of Tsavo National Park, elephant populations that alter the vegetative landscape.

(Nowak 1999; Walther 1990)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Total numbers are estimated to number at least 118,000, about 33% of them in protected areas. Numbers are considered to be in decline in much of the range, as a result of hunting, overgrazing, and outbreaks of rinderpest. In some other areas, bush encroachment has increased the amount of suitable habitat, and local range expansion and population increases have been reported. Nevertheless, the level of decline is estimated to have reached at least 20% over a period of three generations (21-24 years), so approaching the threshold for Vulnerable under criterion A2cde. The Lesser Kudu will probably persist in the arid scrublands of northeastern Africa, as long as human and livestock densities remain relatively low in extensive parts of its range such as northern Kenya and southern Ethiopia. It nevertheless faces a continuing, long-term population decline as meat hunting and pastoralism increase within its remaining range. Its status may eventually decline to threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The lesser kudu is classified as Lower Risk (LR) on the IUCN Red List 2004 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Citing various authors, East (1999) indicates that population estimates based on recent aerial surveys are available for considerable areas of the lesser kudu’s range, but aerial surveys substantially underestimate this species’ true numbers. In addition, its populations are unknown in the remainder of its range. The sum of available estimates, about 22,000, is therefore probably a significant underestimate of the species’ actual total numbers. Correcting for undercounting bias in aerial surveys, East (1999) produced a total population estimate of 118,000. Despite the species’ ability to persist in the face of uncontrolled meat hunting, its numbers are probably in gradual decline over extensive areas of its range as human settlement expands.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Its shyness and preference for thick cover enable it to withstand considerable hunting pressure, e.g., it is relatively plentiful throughout the Ogaden region wherever there is sufficient dense bush, despite widespread, uncontrolled hunting by local people (East 1999). On the other hand, its susceptibility to rinderpest resulted in a substantial decrease in its numbers in eastern regions of Kenya during the mid-1990s. These populations can be expected to recover following the subsidence of this rinderpest outbreak. There are relatively few parts of the Lesser Kudu’s range where protection against poaching reaches moderate levels or better, and eradication of rinderpest from cattle would be a major step towards reducing current pressures on its populations (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lesser kudu is hunted for meat and its horns (2), which are hollowed out and used as wind instruments, honey containers and in spiritual rituals as they are thought to house powerful spirits as well as being a symbol of male virility (4). Lesser kudu are also vulnerable to the rinderpest virus which periodically breaks out and reduces populations (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About one-third of the estimated total population occurs in protected areas. Important populations occur in protected areas such as Awash, Omo and Mago National Parks (Ethiopia), Bush Bush National Park (Somalia), Tsavo National Park (Kenya) and Ruaha National Park and adjoining game reserves (Tanzania), but it occurs in larger numbers outside protected areas (East 1999).

The Lesser Kudu’s long-term survival prospects would be enhanced by improved protection and management of the relatively few protected areas which support substantial populations. In addition, its value as a trophy animal gives the species high potential for increased revenue generation in the extensive bushlands where it still occurs in good numbers outside national parks and equivalent reserves (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The lesser kudu occurs in several National Parks and is part of the American Zoo and Aquarium Association's studbook program which ensures the most possible genetic diversity within the captive breeding population of lesser kudus (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

N/A

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Lesser Kudu is a hunted game animal, that is used for sport, food, and as a source of money.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lesser kudu

The lesser kudu (Tragelaphus imberbis) is a forest antelope found in East Africa. It is placed in the genus Tragelaphus and family Bovidae. It was first described by the English zoologist Edward Blyth in 1869. The head-and-body length is typically between 110–140 cm (43–55 in). Males reach approximately 95–105 cm (37–41 in) at the shoulder, while females reach 90–100 cm (35–39 in). Males typically weigh 92–108 kg (203–238 lb) and females 56–70 kg (123–154 lb). The females and juveniles have a reddish-brown coat, while the males become yellowish grey or darker after the age of two years. Horns are present only on males. The spiral horns are 50–70 cm (20–28 in) long, and have two to two-and-a-half twists.

A pure browser, the lesser kudu feeds on foliage from bushes and trees, shoots, twigs and herbs. Despite seasonal and local variations, foliage from trees and shrubs constitute 60-80% of the diet throughout the year. The lesser kudu is mainly active at night and during the dawn, and seeks shelter in dense thickets just after the sunrise. The lesser kudu exhibits no territorial behaviour, and fights are rare. While females are gregarious, adult males prefer being solitary. There is no fixed breeding season; births may occur at any time of the year. The lesser kudu inhabits dry, flat and heavily forested regions.

The lesser kudu is native to Ethiopia, Kenya, Somalia, South Sudan, Tanzania and Uganda; while it is extinct in Djibouti. The total population of the lesser kudu has been estimated to be nearly 118,000, with a decreasing trend in populations. One-third of the populations survive in protected areas. Presently, the International Union for Conservation of Nature (IUCN) rates the lesser kudu as "Near Threatened".

Taxonomy and genetics[edit]

The scientific name of the lesser kudu is Tragelaphus imberbis. The animal is placed in the genus Tragelaphus and family Bovidae. It was first described by the English zoologist Edward Blyth in 1869.[3] The generic name, Tragelaphus, derives from Greek word Tragos, meaning a male goat, and elaphos, which means a deer; while the specific name imberbis comes from the Latin term meaning unbearded, referring to this kudu's lack of mane. The vernacular name kudu (or koodoo) is the Hottentot name for the greater kudu, a close relative of this species. The term "lesser" denotes the smaller size and lack of mane of this antelope as compared to the greater kudu.[4] In 1912, the genus Ammelaphus was established for just the lesser kudu by American zoologist Edmund Heller, the type species being A. strepsiceros.[2] However, today the lesser kudu is placed in Tragelaphus instead of Ammelaphus.[3]

The lesser kudu has 38 chromosomes, in both males and females. But unlike other tragelaphids, the X chromosome and Y chromosome are compound and fused with autosomes from ancestors having a greater chromosome number.[5]

Physical description[edit]

A male lesser kudu

The lesser kudu is a spiral-horned antelope. The head-and-body length is typically between 110–140 cm (43–55 in).[4] Males reach approximately 95–105 cm (37–41 in) at the shoulder, while females reach 90–100 cm (35–39 in). Males typically weigh 92–108 kg (203–238 lb) and females 56–70 kg (123–154 lb).[6] The bushy tail is 25–40 cm (9.8–15.7 in) long, white underneath and with a black tip at the end.[7]

There are distinct signs of sexual dimorphism in the antelope. The male is considerably larger than the female. The females, as well as juveniles, have a rufous coat, whereas the males become yellowish grey or darker after the age of two years. While the male has a prominent black crest of hair on the neck, this feature is not well-developed in the female.[8] One long white stripe runs along the back, with 11-14 white stripes branching towards the sides.[7] The chest has a central black stripe, and there is no throat beard.[6] A black stripe runs from each eye to the nose and a white one from each eye to the centre of the dark face. A chevron is present between the eyes. The area around the lips is white, the throat has white patches and two white spots appear on each side of the lower jaw. The underparts are completely white, while the slender legs are tawny and have black and white patches.[4][7] The lesser kudu is characterised by large, rounded ears. Its tracks are similar to the greater kudu's.[9] Females have four teats.[8] The average lifespan is 10 years in the wild, and 15 years in captivity.[7]

Horns are present only on males. The spiral horns are 50–70 cm (20–28 in) long, and have two to two-and-a-half twists.[6] The base circumference is 156–171 cm (61–67 in).[7] The slender horns are dark brown and tipped with white.[8] Male young begin developing horns after six to eight months, which reach full length after three years.[7]

Ecology and behaviour[edit]

A herd of lesser kudu in Dvůr Králové Zoo

The lesser kudu is mainly active at night and during the dawn, and seeks shelter in dense thickets just after the sunrise.[4][7] It can camouflage so well in such dense vegetation that only its ears and tail can indicate its presence.[10] The midday is spent in rest and rumination in shaded areas.[8][11] The animal spends about 35% of daytime foraging, 36% standing and lying, and 29% in roaming.[6] As the thinnest tragelaphine, the lesser kudu can move through dense vegetation with ease. The lesser kudu is a shy and wary animal. When alarmed, the animal will stand motionless, confirming any danger. If it senses any approaching predator, it will give out a short sharp bark, similar to the bushbuck's. The lesser kudu would then make multiple leaps of up to 2 m (6.6 ft) height with an upraised tail. If captured by the predator, the victim gives a loud bleat.[4][6]

The lesser kudu is gregarious in nature. There is no distinct leader or any hierarchy in the social structure. There is no territorial behaviour and fights are uncommon. While fighting, the lesser kudu will interlock horns and try pushing one another. Mutual grooming is hardly observed.[8] Unlike most tragelaphines, females can be closely associated for several years. One to three females along with their offspring may form a group. Juvenile males leave their mothers when aged a year-and-a-half, and may form pairs. However, at the age of four to five years, males prefer a solitary lifestyle and avoiding one another, though four to five bulls may share the same home range. Lesser kudu do not usually associate with other animals, except when they feed in the same area.[6][10]

Diet[edit]

Feeding female and juvenile

A pure browser, the lesser kudu feeds on foliage from bushes and trees, shoots, twigs and herbs.[7] It also eats flowers and fruits if available, and takes small proportions of grasses, usually in the wet season. Despite seasonal and local variations, foliage from trees and shrubs constitute 60-80% of the diet throughout the year. Foliage from creepers and vines (such as Thunbergia guerkeana and some species of Cucurbitaceae and Convulvulaceae) form 15-25% of the diet in the wet season. Fruits are consumed mainly in the dry season. Olfactory searching, much in the same posture as grazing, is used to find fallen fruits (like Melia volkensii and Acacia tortilis), while small fruits (like Commiphora species) are directly plucked from trees. The size and structure of its stomach also suggests its primary dependence on browse.[8]

The lesser kudu browses primarily at dusk or at dawn,[11] and is associated with the gerenuk and the impala.[8] The lesser kudu and the gerenuk might compete for evergreen species in the dry season.[8] However, unlike the gerenuk, the lesser kudu rarely prefers Acacia species and does not stand on its hindlegs while feeding.[6] The lesser kudu does not have a great requirement for water, and can browse in arid environments.[7] It eats succulent plants, like the wild sisal, Sansevieria and Euphorbia species in the dry season, and will have a drink when water sources are available.[6][8]

Reproduction[edit]

Both the males and females become sexually mature by the time they are a year-and-a-half old. However, males actually mate after the age of four to five years.[7] Males and females are most reproductive till the age of 14 and 14–18 years respectively, with the maximum age of successful lactation in females being 13–14 years.[12] There is no fixed breeding season; births may occur at any time of the year. A study at Dvůr Králové Zoo (Czech Republic) showed that 55% of the births occurred between September and December.[12] A rutting male will test the urine of any female he encounters, to which the female responds by urinating. Having located a female in estrus, the male follows her closely, trying to rub his cheek on her rump, head, neck and chest. He performs gasping movements with his lips. Finally, the male mounts the female, resting his head and neck on her back, in a similar way as other tragelaphines.[6][8]

The gestational period is of seven to eight months, after which a single calf is born. A female about to give birth isolates herself from her group, and remains alone for some days afterward. The newborn calf weighs 4–7.5 kg (8.8–16.5 lb). Around 50% of the calves die within the first six months of birth, and only 25% can survive after three years. In a study at Basle Zoo (Switzerland), where 43% of the offspring from captive breeding died before reaching the age of six months, the major causes of high juvenile mortality were found to be the spread of white muscle disease and deficiency of vitamin E and selenium in diets. The herd size, sex, interbreeding and season did not play any role in juvenile mortality.[13] The mother hides her calf while she goes out to feed, and returns mainly in the evening to suckle her young. She checks the calf's identity by sniffing its rump or neck. In the first month, suckling may occur for eight minutes. The mother and calf communicate with low bleats. She licks her offspring, particularly in the perineal region, and may consume its excreta.[6][8]

Habitat and distribution[edit]

The lesser kudu is confined to the Horn of Africa.

The lesser kudu inhabits dry, flat and heavily forested regions.[7] It is closely associated with Acacia and Commiphora thornbush in semi-arid areas of northeastern Africa. The animal avoids open areas and long grass, preferring shaded areas with short grasses instead.[1] Found in woodlands and hilly areas as well, the lesser kudu is generally found at altitudes below 1,200 m (3,900 ft);[6] though they have been recorded at heights of about 1,740 m (5,710 ft) near Mount Kilimanjaro.[1] While individual home ranges of these animals are 0.4–6.7 km2 (4,300,000–72,000,000 sq ft) in size, those of males have an average size of 2.2 km2 (24,000,000 sq ft) and those of females 1.8 km2 (19,000,000 sq ft).[14]

The lesser kudu is native to Ethiopia, Kenya, Somalia, South Sudan, Tanzania and Uganda; while it is extinct in Djibouti.[1] Largely confined to the Horn of Africa today, the species historically ranged from Awash (Ethiopia) southward through southern and eastern Ethiopia, and most parts of Somalia (except the north and the northeast) and Kenya (except the southwest). It also occurred in southeastern Sudan and northeastern and eastern parts of Uganda and Tanzania. The only evidence for its existence in the Arabian peninsula is a single set of horns obtained in 1967 from an individual shot in South Yemen and another in Saudi Arabia.[8]

Threats and conservation[edit]

The lesser kudu's shyness and its ability to camouflage itself in dense cover has protected it from the risks of poaching. For instance, the lesser kudu is widespread in the Ogaden region, which is rich in dense bush, despite reckless hunting by local people here.[1] However, rinderpest outbreaks, to which the lesser kudu is highly susceptible, have resulted in a steep decline of 60% in the animal's population in Tsavo National Park in Kenya.[15] Overgrazing, human settlement, loss of habitat are some other threats to the survival of the lesser kudu.[1]

The total population of the lesser kudu has been estimated to be nearly 118,000, with a decreasing trend in populations. The rate of decline has increased to 20% over two decades. Presently, the IUCN rates the lesser kudu as "Near Threatened".[1] Around a third of the population of the lesser kudu occur in protected areas such as Awash, Omo and Mago National Parks (Ethiopia); Bush Bush National Park (Somalia); Tsavo National Park (Kenya); Ruaha National Park and game reserves (Tanzania); though it occurs in larger numbers outside these areas.[16] Population density rarely exceeds 1/km2., and is generally much lower.[14]

References[edit]

  1. ^ a b c d e f g IUCN SSC Antelope Specialist Group (2008). "Tragelaphus imberbis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 23 July 2012. 
  2. ^ a b Heller, E. (November 2, 1912). New Genera and Races of African Ungulates. Washington D. C.: Smitsonian Institution. p. 15. 
  3. ^ a b c Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 698. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ a b c d e Huffman, B. "Tragelaphus imberbis (Lesser kudu)". Ultimate Ungulate. Retrieved 2 March 2014. 
  5. ^ Benirschke, K.; Rüedi, D.; Müller, H.; Kumamoto, A.T.; Wagner, K.L.; Downes, H.S. (1980). "The unusual karyotype of the lesser kudu, Tragelaphus imberbis". Cytogenetic and Genome Research 26 (2–4): 85–92. doi:10.1159/000131429. 
  6. ^ a b c d e f g h i j k Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 180–2. ISBN 0520080858. 
  7. ^ a b c d e f g h i j k Paschka, N. "Tragelaphus imberbis (lesser kudu)". University of Michigan Museum of Zoology. Animal Diversiy Web. Retrieved 2 March 2014. 
  8. ^ a b c d e f g h i j k l Kingdon, J.; Butynski, T.; Happold, D. (2013). Mammals of Africa. London: Bloomsbury Publishing. pp. 142–7. ISBN 1408189968. 
  9. ^ Chris, S.; Stuart, T. (2000). A Field Guide to the Tracks and Signs of Southern and East African Wildlife (3rd ed.). Cape Town: Struik. ISBN 1868725588. 
  10. ^ a b "Lesser kudu". Wildscreen. ARKive. Retrieved 2 March 2014. 
  11. ^ a b Mitchell, A. W. (September 1977). "Preliminary observations on the daytime activity patterns of lesser kudu in Tsavo National Park, Kenya". African Journal of Ecology 15 (3): 199–206. doi:10.1111/j.1365-2028.1977.tb00398.x. 
  12. ^ a b Váhala, J. (1992). "Reproduction of the lesser kudu (Tragelaphus imberbis) at Dvůr Králové Zoo". Zoo Biology 11 (2): 99–106. doi:10.1002/zoo.1430110205. 
  13. ^ Besselmann, D.; Schaub, D.; Wenker, C.; Völlm, J.; Robert, N.; Schelling, C.; Steinmetz, H.; Clauss, M. (March 2008). "Juvenile mortality in captive lesser kudu (Tragelaphus imberbis) at Basle Zoo and its relation to nutrition and husbandry". Journal of Zoo and Wildlife Medicine 39 (1): 86–91. doi:10.1638/2007-0004.1. 
  14. ^ a b Nowak, R. M. (1999). Walker's Mammals of the World (6th ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1140–1. ISBN 0801857899. 
  15. ^ Sherman, D. M. (2002). Tending Animals in the Global Village: A Guide to International Veterinary Medicine. Philadelphia: Lippincott Williams & Wilkins. p. 264. ISBN 0470292105. 
  16. ^ East, R.; Group, the IUCN/SSC Antelope Specialist (1999). African Antelope Database 1998. Gland, Switzerland: The IUCN Species Survival Commission. pp. 132–4. ISBN 2831704774. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!