Overview

Brief Summary

Biology

Bongos typically live in small family groups of up to eight females, their young, and a dominant male (5), although larger 'nursery' groups often aggregate after the calving period and mixed-sex groups of up to 50 have been observed (8). Surplus males are usually solitary, although they may be accompanied by a younger bull (8). Most active at dawn and dusk (8), these shy, reclusive animals forage within the bushes and shrubs of the forest during the day, and only come out to the salt licks during the night (3). The diet includes a range of grasses, herbs, leaves, flowers, twigs, thistles and cereals (3). Individuals use their long, prehensile tongue for grasping leaves and pulling up roots and grasses, while their broad horns are used for pulling and breaking high branches (3) (5). Females typically give birth to a single calf after a nine month gestation period (5) (8). For a short period after birth calves are left alone, lying still in a sheltered spot to avoid detection by predators, with the mother periodically returning to nurse the calf (2). Young are weaned at six months, and become sexually mature at around 20 months of age (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This striking species is the largest and most colourful of all African antelope, immediately recognisable by its rich chestnut-red coat (3), conspicuously striped with 10 to 15 thin, white vertical lines on the torso and rump (2) (5). Equally impressive are the bongo's long, spiralling horns, which reach up to around a metre in length (3) (5). Although the sexes are similar in appearance, males are larger than females and their coat darkens with age, eventually becoming brownish-black, and females tend to possess longer, thinner and more parallel horns than males (2) (3). Both sexes possess a crest of hair that runs the length of the back and the legs are boldly patterned with chestnut, black, and white (2) (6). Other notable features include large ears, a conspicuous white chevron between the eyes, two large white spots on each cheek and a whitish collar at the base of the neck (2) (6). The eastern bongo is larger than its West African counterpart (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Western or Lowland Bongo ranges from Sierra Leone to Benin, being absent east of the Dahomey Gap, and then continues east of the Adamawa Highlands in Cameroon to southern Sudan and DR Congo. West Africa populations are declining throughout much of their range, although most of the central Africa populations still maintain their historical distribution (East 1999; Elkan and Smith in press).

Historically, the Mountain Bongo occurred in and around forested zones of Mt. Kenya, the Aberdares, Mau forest, Cherengani hills and Chepalungu hills in Kenya and Mount Elgon in Kenya and Uganda (Elkan and Smith in press). The Mountain Bongo was exterminated from the Uganda side of Mount Elgon around 1913-1914 (Kingdon 1982). It is now confined to four completely isolated populations in patches of forest on Mt. Kenya, the Mau and Eburu forests, and the Aberdares in Kenya (Elkan and Smith in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bongos predominantly inhabit the lowland forests of West Africa and Zaire to southern Sudan. Small populations reside in the montane or highland forest of Kenya and in the Congo.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found from West Africa and the Congo Basin to the Central African Republic and southern Sudan (6), with small isolated populations of the eastern or mountain bongo (T. e. isaaci) in Kenya. The mountain bongo used to occur in the Mau Forest and Mount Kenya National Park, but is now believed to be extinct in these areas. A few remain in the Aberdares Conservation Area (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bongos are the largest and most colorful of the forest African antelopes. They exhibit sexual dimorphism; females weigh between 210 and 235 kilograms and the males range from 240 to 405 kilograms. Females and young are chestnut red, with darker legs. The males start out this chestnut color and proceed to darken with age, eventually becoming a dark brownish black. Both males and females have long spiraling horns (75-99cm) covered by a blackish brown keratinous sheath. The females' horns tend to be more parallel than the males and make about one spiral turn as opposed to the males' one and one half turns. Other notable features include large broad ears, white markings on the cheeks and legs, a white chevron between the eyes, and between 10 to 15 whitish-yellow stripes along the torso and rump.

Bongos tend to have shorter legs than other African antelopes and a body shape characteristic of forest ruminants. These characters help the large animal to move relatively fast in its dense forest habitat.

Range mass: 210 to 405 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Bongo is associated with disturbed forest areas and the forest-savanna ecotone in the West and Central African lowlands and the Kenya highlands. There is a record from 4,300 m on Mount Kenya (Young and Evans 1993). It thrives on transition vegetation at the forest edge and in new growth areas that occur after disturbance (i.e. post-timber exploitation, elephant disturbance, tree-falls, landslides, burned fields) (Elkan and Smith in press). Forest clearings and mineral licks are important for geophagy and socialization (Elkan and Smith in press). Bongo are primarily browsers, but exhibit some seasonal grazing on grasses (Elkan and Smith in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bongos are predominantly found in the lowland forests of West Africa where they reside among the ground level shrubs and bushes. Smaller populations are often found in the montane forest regions of East Africa where they reside among the thick forest and bamboo zone. The habitat of this animal has a dual purpose. Bongos both feed and depend for cover on the bushes, herbs and bamboo found in these forested regions.

Terrestrial Biomes: rainforest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The bongo predominantly inhabits lowland forests across most of its range, although it is found up to an altitude of 4,000 metres in the montane forest regions of East Africa, usually in tropical rainforest with dense undergrowth (2) (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bongos are grazers and browsers. They typically eat leaves, flowers, twigs, thistles, garden produce and cereals. Additionally, bongos favor younger leaves, suggesting that high protein and low fibre content influence their plant choice. Furthermore, bongos are known to regularly visit natural salt licks. In these salt lick areas they often graze, feeding on grasses and herbs. Bongos have also been known to eat burned wood as a means of getting salt or minerals. They use their long prehensile tongue for grasping leaves and their broad horns for pulling or breaking high branches.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
21.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.9 years (captivity) Observations: These animals can live up to 21.9 years in zoos (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Bongos breed seasonally in the Aberdares; however, the mating patterns of the forest dwelling groups are poorly known due to the density of their habitat and their tendency to retreat during the daytime. It is however known that females come into estrus every 21 or 22 days and remain in estrus for approximately 3 days. During this period, the male follows the estrus female in a "low stretch" posture while emitting soft vocalizations. The male approaches the female, rubbing his head against her side and rump to test her for mounting receptivity. Before attempting the mount, the male assumes a "frozen" posture. After fertilization, the gestation period lasts from 282 to 285 days. The female gives birth to a single calf weighing approximately 19.5 kilograms. On rare occasion multiple births may occur in which two calves are born, in which case the birth weights are slightly less.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 9.4 to 9.93 months.

Average birth mass: 19800 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
914 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
806 days.

Parental Investment: altricial ; precocial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus eurycerus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAATCGCTGACTATTTTCAACTAACCACAAAGACATTGGCACCCTATACTTACTATTCGGTGCTTGAGCCGGCATAGTGGGAACAGCCCTAAGCCTACTAATCCGTGCTGAGTTAGGTCAACCCGGAACATTGCTCGGAGATGACCAAATCTACAATGTAATTGTAACCGCACACGCATTTGTAATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGCTTTGGTAACTGGCTCGTTCCTTTAATAATCGGAGCCCCTGATATAGCATTTCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCCTTTCTCCTACTCTTAGCCTCATCTATAGTTGAAGCTGGAGCAGGAACTGGTTGAACTGTATATCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTGACCATTTTCTCCCTTCATTTAGCTGGTGTTTCCTCAATCTTAGGAGCTATTAATTTTATTACAACAATCATTAATATAAAACCCCCTGCAATATCACAATACCAAACCCCCTTGTTTGTGTGATCTGTAATGATTACCGCCGTGCTGCTACTCCTCTCACTTCCTGTGTTAGCAGCCGGCATCACTATGCTACTAACAGACCGAAATTTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCTATCTTATATCAACACCTATTCTGATTCTTTGGACACCCAGAAGTCTATATCCTTATTCTACCCGGATTTGGAATAATTTCTCATATTGTAACTTATTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTTTGGGCTATAATGTCAATCGGATTCCTAGGGTTTATTGTATGAGCCCACCATATATTCACAGTCGGAATAGACGTCGATACACGAGCCTATTTTACATCGGCCACCATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCAACACTCCACGGAGGCAATATCAAGTGATCACCAGCTATAATGTGAGCCCTAGGATTCATTTTCTTATTTACAGTAGGAGGTTTAACCGGAATTGTTTTAGCTAACTCCTCCCTAGACATTGTTCTACACGATACATACTATGTAGTTGCACACTTCCACTACGTACTATCAATAGGAGCTGTATTTGCCATTATAGGAGGCTTCGTACATTGATTCCCACTATTTTCAGGTTACACCCTTAATGATACGTGAGCCAAAATCCAATTCGCAATTATATTTGTAGGAGTTAACATGACCTTTTTCCCACAACACTTCCTAGGACTATCAGGCATACCACGACGATACTCTGATTACCCAGACGCATACACAATATGAAATACCATCTCATCGATAGGCTCATTTATCTCCCTAACAGCTGTAATATTAATAGTCTTCATCATCTGAGAGGCATTTGCATCTAAACGAGAAGTATCAACCGTAGATTTAACTACAACAAACCTAGAGTGATTGAATGGATGCCCCCCACCGTATCACACATTCGAAGAACCCGTATACGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus eurycerus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Near Threatened as the species faces an ongoing population decline as habitat loss and hunting pressures increase with the expansion of human settlement and commercial forestry. The level of decline is estimated to have reached more than 20% over three generations (21 years), hence approaching the threshold for Vulnerable under criterion A2cd.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat destruction, poaching and illelgal trapping are all factors that contribute to the decline of bongo populations in Africa. Projects to halt rainforest destruction and laws prohiting entrapment contribute to the conservation of the species.

US Federal List: no special status

CITES: appendix iii; no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened (LR/nt) on the IUCN Red List 2006 (1), and listed on Appendix III of CITES in Denmark (4). Subspecies: the western bongo (T. e. eurycerus) is classified as Lower Risk/near threatened (LR/nt), and the eastern bongo, or mountain bongo, (T. e. isaaci) as Endangered (EN) on the IUCN Red List 2006 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total population of Lowland Bongo at 28,000, with populations in the order of a few thousands in the west (where populations are fragmented), and tens of thousands in the central Africa forest zone. It tends to be naturally rare or absent over large parts of the equatorial forest zone.

The current population estimate (2007) for the Mountain Bongo is ca. 75-140 individuals: Aberdare Mts (50-100); Mt Kenya (6-12); Mau Forest (6-12), Eburu Forest (6-12) (M. Prettejohn and L. Estes in litt to ASG 2007).

Dense forest habitat, patchy distributions, wide-ranging patterns, retiring behaviour and crepuscular/nocturnal activity patterns hinder any reliable estimation of Bongo densities (Elkan and Smith in press). Hillman (1986) estimated 1.2/km² in southern Sudan based on group size observations and mineral lick distribution.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Lowland Bongo faces an ongoing population decline as habitat destruction and hunting for meat (mainly through snares) increase with the relentless expansion of commercial forestry exploitation and human settlement (East 1999; Elkan and Smith in press).

Threats to Mountain Bongo include hunting with dogs and loss of habitat in the Mau and Eburu forests to illegal logging. The decline of Mountain Bongo populations in the Aberdares in recent years has been attributed to increased hunting by local people and habitat loss, and even to the increased numbers of Lion in the area (Elkan and Smith in press). Although these factors have no doubt contributed to the decline of Mountain Bongo, the impact of disease has probably been underestimated: the grazing of cattle in the forest reserves of Mount Kenya and the Aberdares as high as the Hagenia forest on the Aberdares plateau may have greater implications for Bongo conservation than hunting pressure in terms of disease transmission (L. Estes, in Elkan and Smith in press). Percival (1928) reported that rinderpest drastically reduced the populations of the Mountain Bongo in the 1890s, and populations are thought to have suffered greatly in later epidemics in the early 1900s.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Poaching and illegal trapping for food and skins, combined with habitat destruction, have resulted in the decline of bongo populations (3) (8), and even their complete elimination in some areas (6). Large scale and unrestricted hunting with dogs and snares has had a particularly strong impact on the eastern bongo subspecies (6), which, together with lion predation and an outbreak of rinderpest in the 1980s, has decimated the wild population, leaving a mere 100 estimated individuals remaining (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
As the largest and most spectacular forest antelope, the Lowland Bongo is both an important flagship species for protected areas such as national parks, and a major trophy species which has been taken in increasing numbers in Central Africa by international sport hunters during the 1990s. Both of these factors are strong incentives to provide effective protection and management of Lowland Bongo populations. Trophy hunting has the potential to provide economic justification for the preservation of larger areas of Bongo habitat than national parks, especially in remote regions of Central Africa where possibilities for commercially successful tourism are very limited (East 1999).

East (1999) estimated that perhaps 60% of Bongo numbers were confined to protected areas. In Central Africa, these include Dzanga-Ndoki National Park and Bangassou areas of the Central African Republic, Lobeke National Park (Cameroon), and in Nouabale-Ndoki National Park and Odzala National Park (Republic of Congo); in West Africa, strongholds include Taï (Côte d’Ivoire), Sapo (Liberia), and Kakum National Parks (Ghana) (East 1999; Elkan and Smith in press). However, because the highest known abundances of Bongo in Central Africa occur in logging concessions not protected areas, an approach is needed that incorporates both protected areas and logging concessions (see Elkan 2003; Elkan and Smith in press).

The Mountain Bongo’s survival in the wild is dependent on more effective protection of the surviving remnant populations in Kenya (East 1999). Two conservation initiatives are currently in progress on Mountain Bongo. A programme to reintroduce Bongo to Mt Kenya began in 2004, when 18 animals where flown from North American zoos to a captive-breeding facility at Mount Kenya Game Ranch, on the north-western slope of the mountain. A second phase began in 2005, with the commencement of a research programme into the Mountain Bongo’s ecology. This project will attempt to determine the configuration of Bongo habitat on both the Aberdares and Mount Kenya, using recently collected field and remotely sensed data (L. Estes pers. comm.). Meanwhile, the Bongo Surveillance Programme, initiated in 2004, has been investigating the status of the remaining wild Bongo populations in Kenya (L. Estes pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Fortunately, there has been concerted conservation effort over recent decades to help protect the endangered eastern bongo subspecies. Remaining wild bongos are currently fully protected by the Kenyan Wildlife Service, and in an attempt to protect the dwindling Aberdares population, the Park Service culled 200 lions from the Aberdares Conservation Area in April 2000 (5). A robust captive population of 526 individuals (as of December 2003) flourishes in over one hundred locations around the world, and captive stock have now begun to be used in a crucial and collaborative reintroduction project known as the Bongo Repatriation Program (5) (8). In January 2004, the first captive stock was moved from America to Mount Kenya Wildlife Conservancy, where the animals form a core breeding group, producing offspring that will eventually be released into the Mount Kenya World Heritage Site (5). In 2006, the entire herd at the Conservancy numbered 36, and three additional adult males were released on Mount Kenya (9). The success of the reintroduction of the above specimens into the wild is currently uncertain. However, while the future of the wild eastern bongo still remains uncertain, the healthy captive population is sure to play a key role in the fate of this subspecies, by providing a reservoir of animals that could be reintroduced into the wild, where they truly belong (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Although these animals are difficult to shoot, they are rather easily hunted by dogs and hence provide a food source for African populations. Additionally, as browsers, bongos are important factors in keeping the vegetation of the forests from becoming overgrown. Since many other game animals depend on the health of this vegetation for food, this attribute secondarily affects humans.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bongo (antelope)

Eastern/mountain bongo
Conservation status
Scientific classification
Kingdom:Animalia
Phylum:Chordata
Subphylum:Vertebrata
Class:Mammalia
Order:Artiodactyla
Family:Bovidae
Subfamily:Bovinae
Genus:Tragelaphus
Subspecies:T. eurycerus isaaci
Trinomial name
Tragelaphus eurycerus isaaci
Ogilby, 1837
Mountain bongo range

The bongo, Tragelaphus eurycerus, is a herbivorous, mostly nocturnal forest ungulate; it is among the largest of the African forest antelope species.

Bongos are characterised by a striking reddish-brown coat, black and white markings, white-yellow stripes and long slightly spiralled horns. Indeed, bongos are the only tragelaphid in which both sexes have horns. They have a complex social interaction and are found in African dense forest mosaics.

The western or lowland bongo, T. e. eurycerus, faces an ongoing population decline, and the IUCN Antelope Specialist Group considers it to be Near Threatened on the conservation status scale.

The eastern or mountain bongo, T. e. isaaci, of Kenya, has a coat even more vibrant than that of T. e. eurycerus. The mountain bongo is only found in the wild in one remote region of central Kenya. This bongo is classified by the IUCN Antelope Specialist Group as Critically Endangered, with more specimens in captivity than in the wild.

In 2000, the Association of Zoos and Aquariums in the USA (AZA) upgraded the bongo to a Species Survival Plan participant and in 2006 named the Bongo Restoration to Mount Kenya Project to its list of the Top Ten Wildlife Conservation Success Stories of the year. However, in 2013, it seems, these successes have been negated with reports of possibly only 100 mountain bongos left in the wild due to logging and poaching.

Taxonomy[edit]

The bongo belongs to the genus Tragelaphus, which includes the sitatunga (T. spekeii), the nyala (T. angasii), the bushbuck (T. scriptus), the mountain nyala (T. buxtoni), the lesser kudu (T. imberbis), and the greater kudu (T. strepsiceros).

Bongos are further classified into two subspecies: T. e. eurycerus, the lowland or western bongo, and the far rarer T. e. isaaci, the mountain or eastern bongo, restricted to northeastern Central Africa. The eastern bongo is larger and heavier than the western bongo. Two other subspecies are described from West and Central Africa, but taxonomic clarification is required. They have been observed to live up to 19 years.[3]

The generic name Tragelaphus is derived from the Greek words trago (a male goat) and elaphos (a deer), in combination referring to "an antelope". The specific name eurycerus originated from the fusion of eurus (broad, widespread) and keras (an animal's horn). "Bongo" is derived from a West African native name.

Distribution and habitat[edit]

Bongos are found in dense tropical jungles with dense undergrowth up to an altitude of 4,000 meters (12,800 ft) in Central Africa, with isolated populations in Kenya, and these West African countries: Angola, Benin, Burkina Faso, Cameroon, the Central African Republic, the Republic of the Congo, the Democratic Republic of Congo, the Ivory Coast, Equatorial Guinea, Ethiopia, Gabon, Ghana, Guinea, Guinea-Bissau, Kenya, Liberia, Mali, Niger, Sierra Leone, Sudan, Togo, and Uganda (regionally extinct, IUCN, 2002).

A bongo drinks from a swamp.

Historically, bongos occurred in three disjunct parts of Africa: East, Central and West. Today, all three populations’ ranges have shrunk in size due to habitat loss for agriculture and uncontrolled timber cutting, as well as hunting for meat.

Bongos favour disturbed forest mosaics that provide fresh, low-level green vegetation. Such habitats may be promoted by heavy browsing by elephants, fires, flooding, tree-felling (natural or by logging), and fallowing. Mass bamboo die-off provides ideal habitat in East Africa. They can live in bamboo forests.

Appearance[edit]

Bongos are one of the largest of the forest antelopes. In addition to the deep chestnut colour of their coats, they have bright white stripes on their sides to help camouflage them from their enemies.

Adults of both sexes are similar in size. Adult height is about 1.1 to 1.3 m (3.6 to 4.3 ft) at the shoulder and length is 2.15 to 3.15 m (7.1 to 10.3 ft), including a tail of 45–65 cm (18–26 in). Females weigh around 150–235 kg (331–518 lb), while males weigh about 220–405 kg (485–893 lb). Its large size puts it as the third-largest in the Bovidae tribe of Strepsicerotini, behind both the common and greater elands by about 300 kg (660 lb), and above the greater kudu by about 40 kg (88 lb).[4][5]

Both sexes have heavy spiral horns; those of the male are longer and more massive. All bongos in captivity are from the isolated Aberdare Mountains of central Kenya.

Coat and body[edit]

The side facial patination of an eastern bongo

The bongo sports a bright auburn or chestnut coat, with the neck, chest, and legs generally darker than the rest of the body. Coats of male bongos become darker and buffy as they age until they reach a dark mahogany-brown colour. Coats of female bongos are usually more brightly coloured than those of males.

The pigmentation in the coat rubs off quite easily; anecdotal reports suggest rain running off a bongo may be tinted red with pigment. The smooth coat is marked with 10–15 vertical white-yellow stripes, spread along the back from the base of the neck to the rump. The number of stripes on each side is rarely the same. It also has a short, bristly, and vertical brown ridge of hair along the spine from the shoulder to the rump; the white stripes run into this ridge.

A white chevron appears between the eyes, and two large white spots grace each cheek. Another white chevron occurs where the neck meets the chest. The large ears are to sharpen hearing, and the distinctive coloration may help bongos identify one another in their dark forest habitats. Bongos have no special secretion glands, so rely less on scent to find one another than do other similar antelopes. The lips of a bongo are white, topped with a black muzzle.

Horns[edit]

A western bongo's horns

Bongos have two heavy and slightly spiralled horns that slope over their backs, and like in many other antelope species, both male and female bongos have horns. Bongos are the only tragelaphids in which both sexes have horns. The horns of bongos are in the form of a lyre and bear a resemblance to those of the related antelope species of nyalas, sitatungas, bushbucks, kudus and elands.

Unlike deer, which have branched antlers shed annually, bongos and other antelopes have pointed horns they keep throughout their lives. Males have massive backswept horns, while females have smaller, thinner, and more parallel horns. The size of the horns range between 75 and 99 cm (30–39 in). The horns twist once.

Like all other horns of antelopes, the core of a bongo's horn is hollow and the outer layer of the horn is made of keratin, the same material that makes up human fingernails, toenails. and hair. The bongo runs gracefully and at full speed through even the thickest tangles of lianas, laying its heavy spiralled horns on its back so the brush cannot impede its flight. Bongos are hunted for their horns by humans.[6]

Social organization and behavior[edit]

This female eastern bongo presents her hindquarters while looking over her shoulder to check for threats at Mt. Kenya Wildlife Conservancy.

Like other forest ungulates, bongos are seldom seen in large groups. Males, called bulls, tend to be solitary, while females with young live in groups of six to eight. Bongos have seldom been seen in herds of more than 20. Gestation is about 285 days (9.5 months), with one young per birth, and weaning occurs at six months. Sexual maturity is reached at 24–27 months. The preferred habitat of this species is so dense and difficult to operate in, few Europeans or Americans observed this species until the 1960s. As young males mature and leave their maternal groups, they most often remain solitary, although rarely they join an older male. Adult males of similar size/age tend to avoid one another. Occasionally, they meet and spar with their horns in a ritualised manner and rarely serious fights take place. However, such fights are usually discouraged by visual displays, in which the males bulge their necks, roll their eyes, and hold their horns in a vertical position while slowly pacing back and forth in front of the other male. They seek out females only during mating time.[7] When they are with a herd of females, males do not coerce them or try to restrict their movements as do some other antelopes.

Although mostly nocturnal, they are occasionally active during the day. However, like deer, bongos may exhibit crepuscular behaviour.[citation needed] Bongos are both timid and easily frightened; after a scare, a bongo moves away at considerable speed, even through dense undergrowth. They seek cover, where they stand still and alert, facing away from the disturbance and turning their heads from time to time to check on the situation.[8] The bongo's hindquarters are less conspicuous than the forequarters, and from this position the animal can quickly flee.

When in distress, the bongo emits a bleat. It uses a limited number of vocalisations, mostly grunts and snorts; females have a weak mooing contact-call for their young. Females prefer to use traditional calving grounds restricted to certain areas, while newborn calves lie in hiding for a week or more, receiving short visits by the mother to suckle.[9]

The calves grow rapidly and can soon accompany their mothers in the nursery herds. Their horns grow rapidly and begin to show in 3.5 months. They are weaned after six months and reach sexual maturity at about 20 months.

Diet[edit]

A male bongo eating grass at Louisville Zoo

Like many forest ungulates, bongos are herbivorous browsers and feed on tree/bush leaves, bushes, vines, bark and pith of rotting trees, grasses/herbs, roots, cereals, shrubs, and fruits.

Bongos require salt in their diets, and are known to regularly visit natural salt licks. Examination of bongo feces revealed the charcoal from trees burnt by lightning is consumed. This behavior is believed to be a means of getting salts and minerals into their diets. This behavior has also been reported in the okapi. Another similarity to the okapi, though the bongo is unrelated, is bongo has a long prehensile tongue which it uses to grasp grasses and leaves.

Suitable habitats for bongos must have permanent water available.[10] A large animal, the bongo requires an ample amount of food, and is restricted to areas with abundant year-round growth of herbs and low shrubs.

Population and conservation[edit]

Few estimates of population density are available. Assuming average population densities of 0.25 animals per km2 in regions where it is known to be common or abundant, and 0.02 per km2 elsewhere, and with a total area of occupancy of 327,000 km2, a total population estimate of around 28,000 is suggested. Only about 60% are in protected areas, suggesting the actual numbers of the lowland subspecies may only be in the low tens of thousands. In Kenya, their numbers have declined significantly and on Mt. Kenya, they were extirpated within the last decade due to illegal hunting with dogs. Although information on their status in the wild is lacking, lowland bongos are not presently considered endangered.

Bongos are susceptible to diseases such as rinderpest, which almost exterminated the species the 1890s. Tragelaphus eurycerus may suffer from goitre. Over the course of the disease, the thyroid glands greatly enlarge (up to 10 x 20 cm) and may become polycystic. Pathogenesis of goiter in the bongo may reflect a mixture of genetic predisposition coupled with environmental factors, including a period of exposure to a goitrogen.[11] Leopards and spotted hyenas are the primary natural predators (lions are seldom encountered due to differing habitat preferences); pythons sometimes eat bongo calves. Humans prey on them for their pelts, horns, and meat, with the species being a common local source for "bush meat".[12] Bongo populations have been greatly reduced by hunting, poaching, and animal trapping, although some bongo refuges exist.

Although bongos are quite easy for humans to catch using snares, many people native to the bongos' habitat believed that if they ate or touched bongo, they would have spasms similar to epileptic seizures. Because of this superstition, bongos were less harmed in their native ranges than expected. However, these taboos are said no longer to exist, which may account for increased hunting by humans in recent times.

Zoo programmes[edit]

Eastern bongo at Edinburgh Zoo

An international studbook is maintained to help manage animals held in captivity. Because of its bright colour, it is very popular in zoos and private collections. In North America, over 400 individuals are thought to be held, a population that probably exceeds that of the mountain bongo in the wild.

In 2000, the Association of Zoos and Aquariums (AZA) upgraded the bongo to a Species Survival Plan participant, which works to improve the genetic diversity of managed animal populations. The target population for participating zoos and private collections in North America is 250 animals. Through the efforts of zoos in North America, a reintroduction to the population in Kenya is being developed.

At least one collaborative effort for reintroduction between North American wildlife facilities has already been carried out. In 2004, 18 eastern bongos born in North American zoos gathered at White Oak Conservation in Yulee, Florida for release in Kenya. White Oak staff members traveled with the bongos to a Mt. Kenya holding facility, where they stayed until being reintroduced.[13]

Conservation[edit]

In the last few decades, a rapid decline in the numbers of wild mountain bongo has occurred due to poaching and human pressure on their habitat, with local extinctions reported in Cherangani and Chepalungu hills, Kenya.

The Bongo Surveillance Programme, working alongside the Kenya Wildlife Service, have recorded photos of bongos at remote salt licks in the Aberdare Forests using camera traps, and, by analyzing DNA extracted from dung, have confirmed the presence of bongo in Mount Kenya, Eburru and Mau forests. The programme estimate as few as 140 animals left in the wild - spread across four isolated populations. Whilst captive breeding programmes can be viewed as having been successful in ensuring survival of this species in Europe and North America, the situation in the wild has been less promising. Evidence exists of bongo surviving in Kenya. However, these populations are believed to be small, fragmented, and vulnerable to extinction.

Animal populations with impoverished genetic diversity are inherently less able to adapt to changes in their environments (such as climate change, disease outbreaks, habitat change, etc.). The isolation of the four remaining small bongo populations, which themselves would appear to be in decline, means a substantial amount of genetic material is lost each generation. Whilst the population remains small, the impact of transfers will be greater, so the establishment of a "metapopulation management plan" occurs concurrently with conservation initiatives to enhance in situ population growth, and this initiative is both urgent and fundamental to the future survival of mountain bongo in the wild.

The western/lowland bongo faces an ongoing population decline as habitat destruction and hunting pressures increase with the relentless expansion of human settlement. Its long-term survival will only be assured in areas which receive active protection and management. At present, such areas comprise about 30,000 km2, and several are in countries where political stability is fragile. So, a realistic possibility exists whereby its status could decline to Threatened in the near future.

As the largest and most spectacular forest antelope, the western/lowland bongo is both an important flagship species for protected areas such as national parks, and a major trophy species which has been taken in increasing numbers in Central Africa by sport hunters during the 1990s.[14] Both of these factors are strong incentives to provide effective protection and management of populations.[15]

A young mountain bongo grazes

Trophy hunting has the potential to provide economic justification for the preservation of larger areas of bongo habitat than national parks, especially in remote regions of Central Africa, where possibilities for commercially successful tourism are very limited. [16]

The eastern/mountain bongo’s survival in the wild is dependent on more effective protection of the surviving remnant populations in Kenya. If this does not occur, it will eventually become extinct in the wild. The existence of a healthy captive population of this subspecies offers the potential for its reintroduction.[17]

Groups supporting bongo conservation in Kenya[edit]

Four bongo calves photographed here with a "nanny": All will be released into the wild near Mount Kenya.

In 2004, Dr. Jake Veasey; the head of the Department of Animal Management and Conservation at Woburn Safari Park and a member of the European Association of Zoos and Aquariums Population Management Advisory Group, with the assistance of Lindsay Banks, took over responsibility for the management and coordination of the European Endangered Species Programme for the eastern bongo. This includes some 250 animals across Europe and the Middle East.

Along with the Rothschild giraffe, the eastern bongo is arguably one of the most threatened large mammals in Africa, with recent estimates numbering less than 140 animals, below a minimum sustainable viable population. The situation is exacerbated because these animals are spread across four isolated populations. Whilst the bongo endangered species program can be viewed as having been successful in ensuring survival of this species in Europe, it has not yet become actively involved in the conservation of this species in the wild in a coordinated fashion. The plan is to engage in conservation activities in Kenya to assist in reversing the decline of the eastern bongo populations and genetic diversity in Africa, and in particular, applying population management expertise to help ensure the persistence of genetic diversity in the free ranging wild populations.

A baby eastern bongo at Louisville Zoo in Kentucky

To illustrate significance of genetic diversity loss, assume the average metapopulation size is 35 animals based on 140 animals spread across four populations (140/4=35). Assuming stable populations, these populations will lose 8% of their genetic diversity every decade. By managing all four populations as one, through strategic transfers, gene loss is reduced from 8% to 2% per decade, without any increase in bongo numbers in Kenya. By managing the European and African populations as one - by strategic exports from Europe combined with in situ transfers, gene loss is reduced to 0.72% every 100 years, with both populations remaining stable. If populations in Kenya are allowed to grow through the implementation of effective conservation, including strategic transfers, gene loss can be effectively halted in this species and its future secured in the wild.

The initial aims of the project are:

  1. Through faecal DNA analysis, estimate the genetic diversity of the remaining wild bongos and calculate the relatedness of the isolated wild populations.
  2. More accurately estimate the total population of wild bongos through faecal DNA analysis, camera trapping, and transect surveying.
  3. Through direct sampling, estimate the genetic diversity of the captive bongo population and calculate its relatedness with the remaining isolated wild populations.
  4. Collect DNA samples from western bongos to calculate the relatedness of the two subspecies.
  5. Fund rangers to collect the above data in Kenya, enhance the degree of protection afforded to and level of understanding of the eastern bongos' ecological needs.
  6. To realise such a metapopulation management plan, work with local communities is essential to reverse the decline and allow for the implementation of a transfer strategy. A substantial proportion of wild genetic diversity likely will have already have been lost.

If effective protection were implemented immediately and bongo populations allowed to expand without transfers, then this would create a bigger population of genetically impoverished bongos. These animals would be less able to adapt to a dynamic environment. Whilst the population remains small, the impact of transfers will be greater. For this reason, the 'metapopulation management plan' must occur concurrently with conservation strategies to enhance in situ population growth. This initiative is both urgent and fundamental to the future survival of the mountain bongo in the wild.

In 2013, SafariCom telecommunications donated money to the Bongo Surveillance Programme [18] to try and keep tabs on what is thought to be the last 100 eastern bongos left in the wild in the Mau Eburu Forest in central Kenya, whose numbers are still declining due to logging of their habitat and illegal poaching.[19]

Status[edit]

In 2002, the IUCN, listed the western/lowland species as Near Threatened. These bongos may be endangered due to human environmental interaction, as well as hunting and illegal actions towards wildlife.[1] CITES lists bongos as an Appendix III species, only regulating their exportation from a single country, Ghana. It is not protected by the US Endangered Species Act and is not listed by the USFWS.

The IUCN Antelope Specialist Group considers the western or lowland bongo, T. e. eurycerus, to be Lower Risk (Near Threatened), and the eastern or mountain bongo, T. e. isaaci, of Kenya, to be Critically Endangered. Other subspecific names have been used, but their validity has not been tested.

References[edit]

  1. ^ a b IUCN SSC Antelope Specialist Group (2008). Tragelaphus eurycerus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of near threatened.
  2. ^ >IUCN SSC Antelope Specialist Group (2008). Tragelaphus eurycerus ssp. issaci. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 22 April 2010.
  3. ^ Spinage, C.A. The Natural History of Antelopes. New York: Facts on File Publications, 1986.
  4. ^ [1] (2011).
  5. ^ Kingdon, Jonathan (1993). Kingdon Guide to African Mammals. ISBN 978-0-85112-235-9. 
  6. ^ Walther, F. R. 1990. Spiral-horned antelopes. In Grzimek's Encyclopedia of Mammals. Edited by S. P. Parker. New York: McGraw-Hill. Volume 5, pp. 344-359.
  7. ^ Estes, Richard D. The Behavior Guide to African Mammals: Including Hoofed Mammals, Carnivores, Primates. Berkeley and Los Angeles: University of California Press., 1991.
  8. ^ Spinage, C.A. The Natural History of Antelopes. New York: Facts on File Publications, 1986
  9. ^ Estes, Richard. The Safari Companion. Vermont: Chelsea Green Publishing Co., 1993.
  10. ^ Nowak, Ronald M. Walker's Mammals of the World Fifth Ed. Vol. II. Baltimore: The Johns Hopkins University Press., 1991
  11. ^ Schiller, C.A.; et al. (1995). "Clinical and morphologic findings of familial goiter in bongo antelope (T.e. eurycerus)". Veterinary Pathology (Washington DC, USA: Department of Pathology, National Zoological Park, Smithsonian Institution) 32 (3): 242–249. doi:10.1177/030098589503200305. 
  12. ^ Wilson, D. E., and D. M. Reeder [editors]. 1993. Mammal Species of the World (Second Edition). Washington: Smithsonian Institution Press
  13. ^ "Eastern Bongo". Retrieved 21 June 2013. 
  14. ^ Wilkie D.S.; Carpenter J. 1999. "The potential role of safari hunting as a source of revenue for protected areas in the Congo Basin" Oryx 33(4): 340–345
  15. ^ IEA (Institute of Applied Ecology) 1998. Tragelaphus eurycerus. In African Mammals Databank - A Databank for the Conservation and Management of the African Mammals Vol 1 and 2. Bruxelles: European Commission Directorate
  16. ^ (Wilkie and Carpenter 1999).
  17. ^ IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN Red List of Threatened Species
  18. ^ Bongo Surveillance Programme monitoring and surveillance continues in Aberdare, Mt. kenya, Eburru and South West Mau - http://www.mountainbongo.org/index2.html
  19. ^ BBC News - Kenya's Mountain Bongo antelope under threat http://www.bbc.co.uk/news/world-africa-22207922
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!