Overview

Distribution

Range Description

The Nyala's natural range comprises south-eastern Africa from the Lower Shire Valley in Malawi through Mozambique and Zimbabwe to eastern South Africa and Swaziland. It has been introduced to Namibia on private land in the northern commercial farming districts. Likewise it does not occur naturally in Botswana, but some of the Tuli block farms in the east have been colonised as a result of the spread of Nyala from populations introduced to farms in the adjacent region of South Africa (East 1999; Anderson in press).

In Swaziland, the species was extinct by the 1950s, but they have been successfully reintroduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Nyala have a localized distribution, occupying some parts of southeastern Africa.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Nyala are medium sized in comparison to other antelopes, with a marked size difference between the sexes. Males weigh 98-125 kg and stand over one meter tall at the shoulder, while females weigh 55-68 kg and are slightly less than a meter tall. Males have horns, which can be up to 80 cm long and spiral upwards, curving out at the first turn. Females and juveniles are usually a rusty red color, but adult males become slate gray. Both males and females have a dorsal crest of long hair that runs from the back of the head to the base of the tail, and males additionally have a fringe of long hair along the midline of their chest and belly. Nyala have some white vertical stripes and spots, the pattern of which varies.

Range mass: 55 to 126 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An inhabitant of dense thickets, forest, and open-thicket woodland mosaic, generally near water. Nyala feed selectively on both the leaves and fruits of woody plants as well as grasses; although they drink daily where water is available, in parts of their range in Mozambique and Zimbabwe they are found where no surface water is present for several months of the year (Anderson in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nyala are found near thickets in dry savanna woodland, and prefer proximity to high quality grassland and fresh water as well.

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These antelope both graze and browse. They eat the leaves, twigs, flowers and fruits of many different species of plants. During the rainy season they mainly eat the fresh green grass. They drink daily when water is available, but they can survive in areas where water is only available seasonally.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
18.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Nyala can breed at any time of the year, but there is a breeding peak in the spring and a smaller peak in the autumn. A female's estus cycle is about 19 days long. Males court females for two days of this cycle, but females are receptive to mating for only 6 hours per cycle. Gestation takes 7 months, after which a single, 5 kg calf is born. The young are born out of the sight of potential predators (lions, hyenas, leopards, wild dogs) in a thicket. A calf remains hidden for up to 18 days, during which time the mother returns periodically to clean and nurse it. Offspring remain with their mothers until her next calf is born, but after that courting males drive adolescent males away from their mothers.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 7.33 to 8.4 months.

Average weaning age: 7 months.

Average birth mass: 5232.5 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
452 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus angasii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAAGATATCGGCACCCTATACTTGCTATTTGGTGCTTGAGCTGGCATAGTAGGGACAGCCCTAAGCCTATTGATCCGCGCCGAGTTAGGTCAACCCGGGACATTACTCGGAGATGACCAGATTTACAACGTAATTGTAACCGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGATTTGGCAACTGACTCGTTCCCTTGATAATTGGAGCCCCTGATATAGCATTCCCCCGAATAAATAACATAAGTTTCTGACTTCTTCCTCCTTCTTTTCTTCTGCTATTAGCCTCATCTATAGTTGAAGCTGGAGCAGGAACCGGTTGAACCGTGTACCCTCCTTTAGCAGGTAACMTAGCCCACGCAGGAGCCTCAGTGGACCTGACCATTTTCTCTCTTCACTTAGCAGGTGTTTCCTCAATCTTAGGGGCTATTAATTTTATCACAACAATTATTAACATAAAACCTCCCGCAATATCACAATACCAAACCCCATTATTTGTATGGTCTGTGATGATCACAGCCGTACTGCTACTCCTCTCGCTTCCTGTACTAGCAGCCGGCATCACAATACTACTAACAGACCGGAATCTAAATACAACTTTCTTTGATCCAGCAGGAGGAGGAGACCCCATCCTATATCAACACTTATTTTGATTCTTTGGACACCCGGAAGTTTATATTCTTATTCTACCTGGATTTGGAATAATCTCTCATATTGTAACTTACTACTCAGGAAAAAAAGAACCATTTGGATACATAGGAATAGTTTGAGCTATAATATCAATTGGATTTTTAGGGTTTATTGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTTGATACACGAGCCTATTTCACATCAGCCACTATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCAACACTTCACGGAGGCAATATCAAATGATCACCAGCTATAATATGGGCCCTGGGGTTTATTTTCCTTTTCACAGTAGGGGGCTTAACTGGAATTGTCCTAGCTAACTCCTCCCTAGACATTGTCCTTCACGATACATACTATGTAGTTGCACATTTCCACTATGTGCTGTCAATAGGAGCTGTATTTGCCATTATGGGGGGCTTCGTACACTGATTCCCATTGTTTTCAGGCTACACCCTTAATGACACATGAGCCAAAATCCACTTTGTAATCATATTTGTAGGTGTTAATATGACTTTTTTCCCGCAACACTTCCTAGGACTATCAGGCATGCCACGACGATACTCTGACTACCCGGACGCATATACAATGTGAAATACCATCTCATCAATGGGCTCATTTATCTCCCTAACAGCCGTTATACTTATAGTTTTTATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTGACCGTAGACTTAACCACAACAAACCTAGAGTGGTTAAACGGATGCCCTCCACCATACCACACATTTGAAGAACCAACATACGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus angasii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
While Nayla have been severely depleted in the past, total population numbers have been estimated at ca. 32,000, with over 80% in protected areas and 10-15% on private land. Population trends are generally stable or increasing. It therefore does not currently meet the criteria for threatened status or for Near Threatened. As long as effective protection and management are maintained in the key protected areas for this species and its numbers continue to increase on private land, its status is unlikely to change. Its long-term survival will be further enhanced if the current efforts to rehabilitate the wildlife of areas such as Gorongosa, Banhine and Zinave National Parks, Gaza Province and the Maputo reserve in Mozambique are successful.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nyala currently have a more limited distribution than they have had in the past. Recently in some areas their habitat has actually been improved through human activities, such as shifting agricultural techniques resulting in abandonment of fields and subsequent bush encroachment, and overgrazing of grasslands by cattle, which results in invasion by many herbs that nyala eat.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total population of Nyala to exceed around 32,000 individuals.

More recently, Anderson (in press) estimates that South Africa has at least 30,000, with the largest populations (25,000) in KwaZulu-Natal. There are now more than 1,000 on protected areas and ranches in Swaziland (Monadjem 1998). Nyala are still widespread in Mozambique but numbers probably do not exceed 3,000 (Anderson in press). Zimbabwe has more than 1,000, while numbers in Malawi have declined from 3,000 (East 1999) to about 1,500, most notably in the population in Lengwe N.P. (which was originally created especially for this species). Extralimital to the species’ natural range, Namibia has about 250, all on private ranches.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Nyala disappeared from extensive areas of its former range mainly due to habitat loss to agriculture and cattle grazing, and the combined effects of rinderpest and hunting. However, today they remain relatively widespread both within and outside of their former range. There are no current major threats to Nyala populations, although some protected area populations have undergone declines, notably that in Lengwe N.P.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Over 80% of the estimated total population occurs in protected areas (East 1999). The major populations survive in South African protected areas in the KwaZulu-Natal Game Reserves of Ndumo, uMkuze and Hluhluwe-Umfolozi, and in Kruger N.P. (East 1999; Anderson in press). Nyala also occur in substantial numbers on private land (10-15%) in South Africa, including extralimital areas (East 1999). The dispersion of Nyala and their increase in numbers in South Africa is due primarily to the high demand for adult males by trophy hunters (Anderson in press). Nyala respond well to protection, to the point where over-population can become a management problem. The current efforts to rehabilitate Mozambique’s wildlife offer the prospect that the nyala may recover its former abundance in areas such as Gorongosa and Banhine National Parks (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

These antelopes have probably historically been hunted as food animals.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!