Overview

Distribution

Tetracerus quadricornis is found only in India and Nepal (Nowak, 1999; Walker, 1995).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Four-horned Antelope is distributed widely, but in scattered populations, over most of India, from the Himalayan foothills to peninsular India (Rahmani 2001). A few may remain in Nepal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

T. quadricornis weighs between 15 and25 kg. The body length is 80-110 cm, with a shoulder height of 55-65 cm, and a tail length of 10-15cm. The hair is short, coarse, and thin, with sexually dimorphic brownish color above and lighter on sides. The insides of the legs are white along with the middle of the belly. Males are dull-red brown above, with white below, and have a dark stripe that runs down the front of each leg. Older males are yellowish. Females typically are a brownish-bay color. The horns, only on males, are smooth, short, and conical. The posterior set range from 80 to100 mm in length. The front two are typically 25-38 mm long, and sometimes only a raised black area of skin is present. The muzzle and outer surface of the ears are blackish brown. The small hooves are split and rounded in the front. Four-horned Antelopes are unique, being the only bovids with four horns (Nowak, 1999; Walker, 1995; Macdonald, 1984).

Range mass: 15 to 25 kg.

Range length: 80 to 110 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Four-horned antelopes are found primarily in wooded areas in India. The species is still widely distributed throughout its range. T. quadricornis uses the hilly country and tall grassy areas for shelter. It prefers open forests and is rarely seen, dashing into thick cover at the first sign of danger (MacDonald, 1984).

Habitat Regions: temperate

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The habitat and ecology of the species are not well known. It is found in well-wooded undulating or hilly areas and never far from water; they are solitary and browse and graze (Rahmani 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

T. quadricornis is primarily a grazer. The primary foods of these antelope are grasses, shoots, and fruit. They are rarely found far from water (Nowak, 1995).

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The role of this species within its ecosystem has not been evaluated. Because it is a prey species, it probably affects predator populations to the extent that those predators rely upon T. quadricornis for food. It also has a likely role in affecting plant communities through its browsing behavior.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The predators of T. quadricornis are tigers, leopards, wolves, dhole, and small cats. Information on anti-predator adaptations are not available, but they are likely to rely primarily on vigilance and speed to escape predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Tetracerus quadricornis is prey of:
Felidae
Canis lupus
Panthera pardus
Panthera tigris
Cuon alpinus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

T. quadricornis in captivity can live up to 10 years of age (Nowak, 1999).

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: wild:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.4 years (captivity) Observations: One captive specimen was still alive at 17.4 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males can be extremely aggressive to one another during the rut. Further information on the mating system of this bovid is not available.

Mating takes place during the rainy season from July to September. The gestation period is 7.5 to 8 months (Grizmek, 1990). Usually one or two young per litter are born with an average weight of about 1 kg each (Nowak, 1999).

Breeding season: The breeding season is July to September, and births occur from March to May.

Range number of offspring: 1 to 2.

Average number of offspring: 1.83.

Range gestation period: 7.6 to 8.1 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 1044 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

As in all mammals, the female nurses her young. Although information is not available on the specifics of parental care in this species, it is common for Artiodactyls to produce precocious young. Male parental care is typically not associated with bovids.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tetracerus quadricornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACTAACCATAAGGATATTGGCACCCTATATCTATTATTCGGTGCCTGAGCTGGGATAGTAGGAACAGCCCTAAGCTTATTAATTCGTGCTGAACTAGGCCAACCCGGAACCCTGCTCGGAGATGACCAAATCTATAATGTTATCGTAACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAACTGACTTGTTCCTTTAATAATTGGCGCCCCTGATATGGCATTTCCTCGTATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCTTTCCTGCTGCTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGAACAGGTTGAACCGTATATCCCCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTGACTATTTTCTCTCTACATTTAGCAGGTGTCTCCTCAATTCTAGGGGCTATTAATTTTATTACAACAATTATCAATATAAAACCACCTGCAATATCACAATATCAAACTCCCTTATTTGTATGATCCGTAATGATTACTGCCGTCCTACTACTCCTCTCACTTCCTGTACTAGCAGCAGGCATTACAATACTATTAACAGATCGAAACCTAAACACAACCTTCTTCGATCCAGCAGGAGGAGGGGACCCTGTCCTATATCAACACTTGTTCTGATTTTTCGGACACCCCGAAGTCTACATTCTTATTTTACCCGGATTCGGAATAATTTCTCACATCGTAACCTATTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTCTGAGCCATAATATCCATTGGATTTTTAGGGTTTATCGTATGAGCCCACCACATGTTTACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCCACTATAATTATTGCTATTCCAACGGGAGTAAAAGTATTTAGTTGACTAGCAACACTTCACGGAGGTAACATTAAATGATCCCCCGCTATAATATGAGCCCTAGGATTCATCTTCCTCTTTACAGTAGGAGGCCTGACCGGAATTGTCCTAGCTAACTCTTCCCTTGACATCGTCCTTCATGATACATACTATGTTGTTGCACATTTTCACTATGTATTGTCAATAGGAGCAGTATTTGCCATCATAGGAGGATTCGTACACTGATTTCCACTATTTTCAGGCTACACCCTTAACGAAACATGAGCTAAGATTCATTTTGCAATTATATTTGTAGGTGTTAATATAACTTTCTTCCCACAGCACTTCCTAGGATTATCTGGCATGCCACGACGATACTCCGACTACCCAGATGCATACACAATGTGAAATACCATTTCGTCAATAGGCTCATTCATTTCCCTGACAGCAGTCATACTAATAGTCTTTATTATCTGAGAAGCATTTGCATCCAAACGAGAAGTATCGACTGTGGATCTGACTACAACAAACCTGGAATGATTAAACGGGTGTCCTCCACCATATCACACATTTGAAGAACCTACATATATTAATTTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetracerus quadricornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

T. quadricornis is currently listed by the IUCN as vulnerable and is on CITES Appendix III in Nepal. The habitat of this species is being fragmented by human activities (Nowak, 1999).

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
The population was estimated at less than 10,000 mature individuals (Mallon and Kingswood 2001). Based on loss of forest habitat, there is a continuing inferred and projected population decline and no subpopulation is estimated to contain more than 1,000 mature individuals.

History
  • 2003
    Vulnerable
    (IUCN 2003)
  • 2003
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No robust estimates of the global population are available. Numbers were estimated at >10,000 (Mallon and Kingswood (2001).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats to the species are habitat destruction, through the clearance of scrub and forest for agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in many protected areas in India (for example, Gir N.P., Panna N.P., Pench N.P., and Kanha Tiger Reserve). It is totally protected by law on Schedule I of the Indian Wildlife (Protection) Act. It is listed on CITES Appendix III (Nepal only).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

No negative affects on humans have been reported.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

T. quadricornis may be eaten by people in India and Nepal, but it is reportedly not as good to eat as are other antelopes. This species is sought after by trophy hunters because of its unique horns. In India ecotours are offered and one the top attractions is often the four-horned antelope. It is also a species sought after by zoos. (Nowak, 1999)

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Four-horned antelope

The four-horned antelope (Tetracerus quadricornis), or chousingha, is a species of small antelope found in open forest in India and Nepal. It is the only species currently classified in the genus Tetracerus. Standing only 55 to 64 cm (22 to 25 in) at the shoulder, it is the smallest of Asian bovids. Males of the species are unique among extant mammals in that they possess four permanent horns. The species is listed as Vulnerable by the IUCN due to habitat loss.

Description[edit]

The four-horned antelope is among the smallest Asian bovids, standing just 55 to 64 cm (22 to 25 in) tall at the shoulder, and weighing 17 to 22 kg (37 to 49 lb). It has a generally slender build, with thin legs and a short tail. The coat is yellow-brown or reddish, fading to a whitish colour on the underparts and the insides of the legs. A black stripe of hair runs down the anterior surface of each leg, with black patches on the muzzle and the backs of the ears. Females have four teats, located far back on the abdomen.[2]

The most distinctive feature of the animal is the presence of four horns; a feature unique among extant mammals. Only the males grow horns, usually with two between the ears and a second pair further forward on the forehead. The first pair of horns appear at just a few months of age, and the second pair generally grow after 10 to 14 months. The horns are never shed, although they may be damaged during fights. Not all adult males have horns; in some individuals, especially those belonging to the subspecies T. q. subquadricornis, the forward pair of horns is absent or represented only by small, hairless bumps. The hind pair of horns reaches 7 to 10 cm (2.8 to 3.9 in) in length, while the forward pair is usually smaller, at just 2 to 5 cm (0.79 to 1.97 in).[2]

Distribution and habitat[edit]

Range map of the four-horned Antelope

Most wild four-horned antelope are found in India, with small, isolated populations in Nepal. Their range extends south of the Gangetic plains down to the state of Tamil Nadu, and east as far as Odisha. They also occur in the Gir Forest National Park of western India.[1][2]

Four-horned antelope live in a variety of habitats across their range, but prefer open,[3][4] dry, deciduous forests in hilly terrain. They tend to remain in areas with significant vegetation cover from tall grasses or heavy undergrowth, and close to a supply of water. They generally stay away from human-inhabited areas.[2] Predators of four-horned antelopes include tigers,[5] leopards, and dholes.[6]

Three subspecies of four-horned antelope are recognized:[7]

  • T. q. quadricornis
  • T. q. iodes
  • T. q. subquadricornis

Behaviour[edit]

Four-horned antelope are generally solitary animals, although they are occasionally found in groups of up to four individuals. They are sedentary, rather than nomadic, and may defend exclusive territories. Males tend to become very aggressive towards other males during mating seasons. Adults make alarm calls that sound like a husky 'phronk', and other, quieter calls to communicate with young or other adults. They also communicate through scent marking, leaving piles of droppings in their territories, and marking vegetation using large scent glands in front of the eyes.[2]

They are herbivorous, feeding on soft leaves, fruits, and flowers. Although the precise details of their diets in the wild are unknown, they have been observed to prefer plants such as Indian plum, Indian gooseberry, Bauhinia, and Acacia in artificial trials.[2]

Reproduction[edit]

ChousinghaHead.jpg

The breeding season lasts from May to July, and males and females generally remain apart for the remainder of the year. Courtship behaviour consists of the male and female kneeling and pushing at each other with intertwined necks, followed by ritual strutting by the male. Gestation lasts about eight months, and results in the birth of one or two young. At birth, the young are 42 to 46 cm (17 to 18 in) long, and weigh 0.74 to 1.1 kg (1.6 to 2.4 lb). Young remain with the mother for about a year, and reach sexual maturity at around two years.[2]

Evolution[edit]

The four-horned antelope is currently regarded as the only species in the genus Tetracerus. Both genetic and morphological studies, however, confirm it as one of only two living members of the tribe Boselaphini, with its closest living relative being the nilgai. This group originated at least 8.9 million years ago, in much the same area where the four-horned antelope lives today, and may represent the most "primitive" of all living bovids, having changed the least since the origins of the family.[8]

Conservation[edit]

Living in a densely populated part of the world, the four-horned antelope is threatened by loss of its natural habitat to agricultural land. In addition, the unusual four-horned skull has been a popular target for trophy hunters. Only around 10,000 four-horned antelope are estimated to remain alive in the wild, although many are in protected animal conservation areas. The species is protected under the Indian Wildlife Protection Act and the Nepalese population is listed in Appendix III of CITES. The four-horned antelope is considered Vulnerable by the IUCN, primarily due to increasing habitat loss.[1]

See also[edit]

References[edit]

  1. ^ a b c Mallon, D.P. (2008). "Tetracerus quadricornis". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 25 March 2011. 
  2. ^ a b c d e f g Leslie, D.M. & Sharma K. (2009). "Tetracerus quadricornis (Artiodactyla: Bovidae)". Mammalian Species 843: 1–11. doi:10.1644/843.1. 
  3. ^ Krishna, C.Y, Krishnaswamy, J & Kumar, N.S. (2008). "Habitat factors affecting site occupancy and relative abundance of four horned antelope". Journal of Zoology 276 (1): 63–70. doi:10.1111/j.1469-7998.2008.00470.x. 
  4. ^ Krishna, C.Y, Clyne, P, Krishnaswamy, J & Kumar, N.S. (2009). "Distributional and ecological review of the four horned antelope Tetracerus quadricornis". Mammalia 73 (1): 1–6. doi:10.1515/MAMM.2009.003. 
  5. ^ Biswas, S. & Sankar, K. (2002). "Prey abundance and food habit of tigers (Panthera tigris tigris) in Pench National Park, Madhya Pradesh, India". Journal of Zoology 256 (3): 411–420. doi:10.1017/S0952836902000456. 
  6. ^ Karanth, K.U. & Sunquist, M.E. (1992). "Population structure, density and biomass of large herbivores in the tropical forests of Nagarhole, India". Journal of Tropical Ecology 8 (1): 21–35. doi:10.1017/S0266467400006040. 
  7. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). "Tetracerus quadricornis". Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  8. ^ Bibi, F. (2007). "Origin, paleoecology, and paleobiogeography of early Bovini". Palaeogeography, Palaeoclimatology, Palaeoecology 248 (1): 60–72. doi:10.1016/j.palaeo.2006.11.009. 
  • Baskaran, N., Desai, A. A., & Udhayan, A. (2009). Population distribution and conservation of the four-horned antelope (Tetracerus quadricornis) in the tropical forest of Southern India. Scientific Transactions in Environment and Technovation, 2, 139-144.
  • Sharma, K., Rahmani, A. R. and Chundawat, R. S. (2005). Ecology and Distribution of Four-horned antelope in India: Final Report. Bombay Natural History Society.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!