Overview

Brief Summary

The Common Eland (Taurotragus oryx) is one of the two species in the genus Taurotragus (the other being the Giant Eland, T. derbianus). Based largely on molecular and chromosomal studies (e.g., Fernández and Vrba 2005; Willows-Munro et al. 2005; Rubes et al. 2008), some authorities subsume the genus Taurotragus within Tragelaphus. The most striking feature of elands is their massive size, especially of the males.

Both male and female Common Elands have spiraled horns and a pendulous dewlap that begins at the throat (rather than under the chin, as in the Giant Eland), which in older males may hang like a curtain to below the knees. Males develop a dark crest of tufted hair on their foreheads. Historically, the Common Eland ranged widely across southern and East Africa, but it now occupies only around half of the historical range. Common Elands are associated with woodland and woodland-savannah, although they are relatively flexible in their habitat preferences. In the late 1990s, the total Common Eland population was estimated to be around 136,000. This species is now extinct in Burundi and declining in some parts of its range, but in general seems relatively stable. Around half the remaining individuals are in protected areas and perhaps another third on private ranches. Because of the value of the value of this animal to trophy hunters, poaching can be a significant problem in some areas, although habitat loss is currently the greatest threat. Semi-domesticated populations are (or have been) established in Kenya, South Africa, Zimbabwe, Russia, Ukraine, Great Britain, and the United States..

Despite their name, Giant Elands are actually generally smaller than Common Elands, but their horns are substantially larger (as are their ears).

Elands are widely hunted and this hunting pressure, in combination with habitat loss, has led to their diappearance from much of their former range, although Common Elands are still widely distributed and well represented in national parks and are even semi-domesticated as exotics in several countries.

(Kingdon 1997; Leslie 2011)

  • Fernández, M.H. and E.S. Vrba. 2005. A complete estimate of the phylogenetic relationships in Ruminantia: a dated species-level supertree of the extant ruminants. Biological Reviews 80: 269-302.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
  • Leslie, D.M., Jr. 2011. Genus Taurotragus. Pp. 617-618 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Rubes, J., S. Kubickova, E. Pagacova, H. Cernohorska, D. Di Berardino, M. Antoninova, J. Vahala, and T.J. Robinson. 2008. Phylogenomic study of spiral-horned antelope by cross-species chromosome painting. Chromosome Research 16(7): 935-947.
  • Willows-Munro, S., T.J. Robinson, and C.A. Matthee. 2005. Utility of nuclear DNA intron markers at lower taxonomic levels: Phylogenetic resolution among nine Tragelaphus spp. Molecular Phylogenetics and Evolution 35: 624-636.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The common eland is a social antelope, often forming open and fluid herds of 25 to 60 animals, and occasionally congregating in groups of over 1,000, particularly during the rainy season (2) (3). Mature males generally form herds, as do mature females, and young common eland congregate in nursery herds (4). Within these herds, a hierarchy exists, which determines access to things such as receptive females (if a male), and feeding sites (if a female) (3). Males are not territorial, but will become possessive over females that are receptive to mating (4). While mating and births may take place at any time of the year (3), matings are most common during the rains, resulting in a peak of births nine months later at the end of the dry season (2). Each female bears a single calf, which remains hidden in vegetation for the first two weeks of life (3). Common eland calves grow remarkably quickly, due to the richness of the nutritious eland milk (2), and they soon join a nursery herd (2). Common eland are known to have lived for up to 25 years (2). Foliage and herbs comprise the bulk of the common eland's diet, but this antelope also consumes fruits, seeds (2), green grass, and will dig in the ground for tubers, roots and bulbs (3). Being adapted to the arid conditions of many parts of Africa, the common eland is able to survive without water, as long as it feeds on a sufficient amount of succulent, moisture-rich food (4). This is why the common eland, although active during the day and night (3), is most often found feeding during the night, when the vegetation has absorbed moisture from the air and provides a meal with a higher water content (4). The common eland is also adapted to conserve any precious water it has, by allowing the body temperature to rise during the day, hence reducing the need to sweat. As the sun sets, the body heat then radiates out into the cooler night air (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Along with the giant eland (Tragelaphus derbianus), the common eland is one of the largest antelopes in existence (3). Its coat is tan, fawn or tawny coloured, turning slightly bluish-grey on the neck and shoulders with age, and a short dark mane runs down the back of the neck (2) (3). Both male and female common eland possess horns that rise with a slight twist, back from the head to sharp points. The horns of the male are more robust and bear more distinct ridges than those of the female (3). The massive adult males can also be recognised by the large fold of loose skin that hangs below the throat (the dewlap), and the patch of long, coarse, dark hair on the forehead (3). These features become respectively larger and bushier with age (2). The common eland has a fairly small and pointed mouth and muzzle, small, narrow ears (2), and a long tail with a tuft of black hair at the tip (2) (3). A distinct clicking sound can be heard as the common eland roams around its habitat; this unusual and distinctive feature is believed to be the result of two halves of the hoof knocking together when the foot is raised, or by the movement of bones in the leg (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Common Eland formerly occurred throughout the savanna woodlands of eastern and southern Africa, extending into high-altitude grasslands and the arid savannas and scrublands of the Kalahari and Karoo in southern Africa. It has been eliminated from more than half of its former range by the expansion of human populations, and their numbers have decreased dramatically since the 1970s as a result of civil wars and their aftermath in countries such as Uganda, Rwanda, Angola and Mozambique. They are now extinct in Burundi. However, Common Eland have been reintroduced to a number of game ranches and private ranchland in southern Africa (particularly South Africa), and this has done much to bolster numbers. In addition, animals have been introduced widely outside of their natural range; for example, although their natural range in Namibia is restricted to the northeastern parts, they now occur widely on game ranches in the southern and central parts (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once widespread throughout suitable habitat in southern, central and east Africa (3), from South Africa north to the Democratic Republic of Congo and Kenya (2), the common eland has now become extinct in many areas, and populations have declined in others (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eland males are much larger than females, weighing 400-1000 kg compared to 300-600 kg for females. Hides are a uniform fawn color with some vertical white striping on the upper parts. A dewlap, thought to be an adaptation for heat dissapation, hangs from the throat and neck. Heavy horns are twisted in a corkscrew fashion and grow up to 4 ft. long on males, 2.2 ft. long on females. A short mane occurs on the nape, and males have long hairs on the throat.

Range mass: 300 to 1000 kg.

Average basal metabolic rate: 190.209 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Common Elands are one of the most adaptable ruminants, inhabiting subdesert, acacia savanna, miombo woodland, and alpine moorlands to 4,900 m. They are not found in deep forest, in true deserts, or in completely open grassland, though they do occur in grassland with good herb cover (Thouless in press). Common Eland are primarily broswers, and move long distances in search of ephemeral food sources; they can go without water for prolonged periods, able to obtain sufficient moisture from their food (Thouless in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Elands live in both steppe and sparse forests. They are also found in semidesert areas and at elevations up to 14400 ft. During the heat of the day, they are often found in shaded areas.

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The common eland is primarily an inhabitant of woodlands and woodland savanna (2), and can be found from coastal plains up to mountainous areas, and from semi-desert to areas of relatively high rainfall (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of elands consist of grasses, herbs, tree leaves, bushes, and succulent fruits. They generally forage in open areas. Water is consumed voraciously when available, but elands can abstain from drinking in dry seasons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
23.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.1 years (captivity) Observations: One captive specimen lived 26.1 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Dominant males mate with multiple females. In some areas, there are distinct breeding seasons--in Zambia, for example, young are born in July and August. Gestation lasts from 8.5-9 months and only single young are born. Male young weigh between 28-35 kg, while female young weight between 23-31 kg. Small calves lie in concealment rather than remaining with their mothers. Weaning occurs after 6 months, and sexual maturity occurs at about 3 years. Maximum lifespan is 25 years. Young often associate in groups of their peers.

Range number of offspring: 1 to 2.

Average number of offspring: 1.02.

Range gestation period: 8.8 to 9.27 months.

Average gestation period: 9.1 months.

Average weaning age: 6 months.

Average birth mass: 32000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
571 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
589 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragelaphus oryx

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTGTTTTCAACTAACCATAAAGACATTGGCACCCTCTACCTACTATTCGGTGCTTGAGCCGGCATAGTAGGAACAGCCCTAAGTTTGCTAATTCGTGCCGAATTGGGTCAACCCGGAACATTACTCGGAGATGACCAAATTTACAACGTTATTGTGACCGCACACGCATTTGTAATAATCTTCTTTATAGTAATACCTATTATGATTGGAGGCTTTGGTAATTGGCTCGTCCCTTTAATAATCGGAGCCCCTGATATAGCATTTCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCTCCCTCCTTTCTCCTACTCTTAGCCTCATCCATAGTCGAAGCTGGAGCAGGAACTGGCTGAACTGTATATCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAACCATTTTCTCCCTCCACTTAGCAGGTGTTTCCTCAATTCTAGGGGCTATTAATTTTATTACAACAATTATTAATATAAAACCCCCTGCAATATCACAATACCAAACCCCCTTATTCGTGTGATCCGTAATAATTACCGCCGTACTGCTACTCCTTTCACTTCCTGTATTAGCAGCTGGCATCACAATACTATTAACAGACCGAAATTTAAACACAACCTTCTTTGACCCAGCAGGAGGGGGAGACCCTATCTTATACCAACACTTGTTCTGATTCTTTGGACACCCAGAAGTCTATATTCTTATTCTACCCGGATTTGGAATAATTTCTCATATTGTAACTTACTACTCAGGAAAGAAAGAACCATTTGGGTACATAGGAATAGTTTGAGCTATAATATCAATCGGATTCCTAGGATTTATCGTATGAGCCCATCATATGTTCACAGTTGGAATAGACGTCGATACACGAGCCTATTTCACATCAGCCACTATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCAACACTTCATGGAGGCAATATTAAATGATCACCAGCTATAATGTGGGCCCTAGGGTTCATTTTCCTTTTCACAGTAGGAGGTTTAACCGGAATTGTTTTAGCAAACTCCTCCCTAGACATTGTTCTCCATGATACATATTATGTAGTTGCACATTTCCACTACGTACTATCAATAGGAGCTGTATTTGCCATTATAGGGGGTTTCGTACATTGATTCCCACTGTTTTCGGGCTACACCCTTAATGACACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGAGTTAACATGACCTTTTTCCCACAACACTTCTTAGGACTATCAGGCATGCCACGACGATACTCTGATTATCCAGACGCGTACACGATATGAAACACCATCTCATCAATAGGCTCATTCATCTCCCTAACAGCTGTAATATTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTATCTACCGTGGATTTAACTACAACAAACTTAGAGTGATTAAACGGATGTCCCCCACCATACCACACATTTGAAGAACCCGTATACGTTAACCTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragelaphus oryx

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Total numbers have been estimated at c. 136,000, about 50% of which occur in protected areas and 30% on private land. Population trends are varied in protected areas, increasing on private land and decreasing elsewhere (20%). It therefore does not currently meet the criteria for threatened status or for Near Threatened. The Common Eland’s Red List status will not change as long as substantial, stable populations continue to occur in a good number of protected areas and it remains a popular and economically significant species on private land. The requirement for large areas to accommodate its seasonal wanderings is likely to result in further contraction of the distribution and numbers of free-ranging populations as human settlement expands. This may be at least partly compensated for by the continued growth of its numbers on private farms and conservancies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eland populations have declined or have been extirpated in many parts of their range, but overall are still relatively common. Overhunting has been one cause of the declining numbers.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Citing various authors, East (1999) indicates that population density estimates obtained by aerial counts in areas where the species is moderately common generally range from about 0.05 - 0.4/km². Higher density estimates (0.6-1.0/km²) have been obtained by aerial counts. Ground surveys or total counts of areas where the species is common have produced similar density estimates.

East (1999) produced a total population estimate of 136,000, with stable/increasing national populations are now confined to Namibia, Botswana, Zimbabwe, South Africa, Malawi and possibly Tanzania. Population trends vary from increasing to decreasing within individual protected areas, and are generally increasing on private land and decreasing in other areas.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat loss (due to expanding human settlements) and poaching for its superior meat have resulted in drastic reductions of range and populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Over-hunting appears to be the greatest threat facing the common eland, resulting in its elimination from many areas (2) (5). However, this antelope is still widely distributed and occurs in numerous protected areas (2), and is therefore not yet considered threatened with extinction (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About half of this estimated total population occurs in protected areas and 30% on private land (East 1999). Protected areas that support major populations include Omo (Ethiopia), Serengeti, Katavi, Ruaha and Selous-Kilombero (Tanzania), Kafue and North Luangwa (Zambia), Nyika (Malawi), Etosha (Namibia), Kgalagadi Transfrontier Park (Botswana/South Africa) and Ukhahlamba Drakensberg Park (South Africa). Most of these populations appear to be stable. Relatively large numbers of the Common Eland now occur on private land, particularly in Namibia, Zimbabwe and South Africa, reflecting its value as a trophy animal. Common Eland have also been widely domesticated in Zimbabwe, South Africa and Kenya, as well as in Russia, Ukraine, and England (Thouless in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The common eland occurs in many protected areas throughout its range, such as Kafue National Park, Zambia, Etosha National Park, Namibia (5), and in the Cape Floral Protected Areas of South Africa, a World Heritage Site (6). In some countries, such as Malawi, the common eland is confined entirely to national parks and game reserves. The continued protection and enforcement of these areas is therefore essential for the common eland's future survival (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Elands provide large amount of tender meat, as well as high-quality hides. There has been efforts to domesticate them for both their meat and their milk, which has much higher protein content and milkfat than the milk of cows. To date, only one of these domestication attempts has been successful.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common eland

"Eland antelope" redirects here. For Taurotragus derbianus, see Giant eland.

The common eland (Taurotragus oryx), also known as the southern eland or eland antelope, is a savannah and plains antelope found in East and Southern Africa. It is a species of the family Bovidae and genus Taurotragus. It was first described by Peter Simon Pallas in 1766. An adult male is around 1.6 metres (5') tall at the shoulder (females are 20 centimetres (8") shorter) and can weigh up to 942 kg (2077 lbs) with an average of 500–600 kilograms (1,100–1,300 lb, 340–445 kilograms (750–980 lb) for females). It is the second largest antelope in the world, being slightly smaller on average than the giant eland.[3]

Mainly an herbivore, its diet is primarily grasses and leaves. Common elands form herds of up to 500 animals, but are not territorial. The common eland prefers habitats with a wide variety of flowering plants such as savannah, woodlands, and open and montane grasslands; it avoids dense forests. It uses loud barks, visual and postural movements and the flehmen response to communicate and warn others of danger. The common eland provides leather and rich, nutritious milk, and has been domesticated in many areas.

It is native to Botswana, Burundi, the Democratic Republic of the Congo, Ethiopia, Kenya, Lesotho, Malawi, Mozambique, Namibia, Rwanda, South Africa, South Sudan, Swaziland, Tanzania, Uganda, Zambia and Zimbabwe but is no longer present in Burundi and Angola. The common eland's population is decreasing but it is classified as "Least Concern" by the International Union for Conservation of Nature (IUCN).

Etymology[edit]

The scientific name of the common eland is Taurotragus oryx, composed of three words: tauros, tragos and oryx. Tauros is Greek for a bull or bullock, meaning the same as the Latin taurus.[4] Tragos is Greek for a male goat, referring to the tuft of hair that grows in the eland's ear and its resemblance to a goat's beard.[5] Oryx is Latin and Greek (generally orygos) for pickaxe, referring to the pointed horns of North African antelopes like the common eland and scimitar-horned oryx.[6]

The name 'eland' is Dutch for "elk" or "moose".[7] It has a Baltic source similar to the Lithuanian élnis, which means "deer". It was borrowed earlier as ellan (French) in the 1610s or Elend (German).[8][9] When Dutch settlers came to the Cape Province they named it after the large, herbivorous moose. In Dutch the animal is called "Eland antelope" to distinguish it from the moose, which is found in the northern boreal forests.[7]

Physical description[edit]

Common eland bull

Common elands are spiral-horned antelopes. They are sexually dimorphic, with females being smaller than the males.[10] Females weigh 300–600 kg (660–1,320 lb), measure 200–280 cm (79–110 in) from the snout to the base of the tail and stand 125–153 cm (49–60 in) at the shoulder. Bulls weigh 400–942 kg (882–2,077 lb),[11] are 240–345 cm (94–136 in) from the snout to the base of the tail and stand 150–183 cm (59–72 in) at the shoulder. The tail is 50–90 cm (20–35 in) long.[3] Male elands can weigh up to 1,000 kg (2,200 lb).[12]

Their coat differs geographically with elands in north Africa having distinctive markings (torso stripes, markings on legs, dark garters and a spinal crest) that are absent in the south.[13] The coat is smooth except for a rough mane. Females have a tan coat, while the coats of males are darker, with a bluish-grey tinge. Bulls may also have a series of vertical white stripes on their sides (mainly in parts of the Karoo in South Africa). As males age, their coat becomes more grey. Males also have dense fur on their foreheads and a large dewlap on their throats.[3]

Both sexes have horns with a steady spiral ridge (resembling that of the bushbuck). The horns are visible as small buds in newborns and grow rapidly during the first seven months.[14] The horns of males are thicker and shorter than those of females (males' horns are 43–66 centimetres (17–26 in) long and females' are 51–69 centimetres (20–27 in) long), and have a tighter spiral. Males use their horns during rutting season to wrestle and butt heads with rivals, while females use their horns to protect their young from predators.[3]

The common eland is the slowest antelope, with a peak speed of 40 kilometres (25 mi) per hour that tires them quickly. However, they can maintain a 22 kilometres (14 mi) per hour trot indefinitely. Elands are capable of jumping up to 2.5 metres (8 ft 2 in) from a standing start when startled[13] (up to 3 metres (9.8 ft) for young elands).[3] The common eland's life expectancy is generally between 15 and 20 years; in captivity some live up to 25 years.[3]

Eland herds are accompanied by a loud clicking sound that has been subject to considerable speculation. It is believed that the weight of the animal causes the two halves of its hooves to splay apart, and the clicking is the result of the hoof snapping together when the animal raises its leg.[15] The sound carries some distance from a herd, and may be a form of communication.[12]

Taxonomy[edit]

The common eland was first described in 1766 by the German zoologist and botanist Peter Simon Pallas. It belongs to the order Artiodactyla, family Bovidae and subfamily Bovinae.[16] Common elands are sometimes considered part of the genus Tragelaphus on the basis of molecular phylogenetics, but are usually categorized as Taurotragus, along with the giant eland (T. derbianus).[3]

Subspecies[edit]

Three subspecies of common eland have been recognized, though their validity has been in dispute.[1][2][3][10][14]

  • T. o. livingstonii (Sclater, 1864; Livingstone's eland): also called kaufmanni, niediecki, selousi and triangularis. It is found in the Central Zambezian Miombo woodlands. Livingstone's eland has a brown pelt with up to twelve stripes.
  • T. o. oryx (Pallas, 1766; Cape eland): also called alces, barbatus, canna and oreas. It is found in south and southwest Africa. The fur is tawny, and adults lose their stripes.
  • T. o. pattersonianus (Lydekker, 1906; East African eland or Patterson's eland): also called billingae. It is found in east Africa, hence its common name. Its coat can have up to 12 stripes.

Diseases and parasites[edit]

Common elands are resistant to trypanosomiasis, a protozoan infection that has the tsetse fly as a vector, but not to the Rhipicephalus-transmitted disease theileriosis. The disease-causing bacteria Theileria taurotragi has caused many eland deaths. Clostridium chauvoei, another bacterium, can be harmful as well. Elands are also hosts to several kinds of ticks. In one study an eland was found to be host to the Amblyomma species A. gemma and A. variegatum, and Rhipicephalus species R. decoloratus, R. appendiculatus, R. evertsi, R. pulchellus and R. pravus. Elands produce antibodies for Brucella bacteria, but none for Mycobacterium paratuberculosis or various types of pneumonia like contagious bovine pneumonia and contagious caprine pneumonia, normally infectious in cows or antelopes.[3]

Genetics and evolution[edit]

Male elands have 31 diploid chromosomes and females have 32. The male (Y) chromosome has been translocated to the short arm of an autosome.[3] Both the X and Y replicate late; they do not match well and are variable. The chromosomes resemble those of the greater kudu (Tragelaphus strepsiceros).[17]

Male elands and female greater kudus can produce a viable male hybrid, though it is not known if it is sterile. An accidental crossing of an east African common eland (T. o. pattersonianus') with an east African kudu (T. s. bea) occurred in the San Diego Zoo Safari Park. This was believed to be due to the absence of male kudus in the herd. The hybrid produced was sterile, which was unexpected before the study. The study conformed the chromosome numbers of both the eland the kudu and the strangeness of their attached Y chromosomes. Reports state that repeated matings of male elands with domestic (Bos primigenius) and zebu cows (Bos indicus) have also produced sterile hybrids.[18] Female elands can also act as surrogates for bongos.[3]

The Bovidae family ancestors of the common eland evolved approximately 20 million years ago in Africa; fossils are found throughout Africa and France but the best record appears in sub-Saharan Africa. The first members of the tribe Tragelaphini appear 6 million years in the past during the late Miocene. An extinct ancestor of the common eland (Taurotragus arkelli) appears in the Pleistocene in northern Tanzania and the first T. oryx fossil appears in the Holocene in Algeria.[3]

In 2010, a genetic study was made basing on the evolutionary history of common elands. Located in the sub-Saharan savanna biome of east and southern Africa, the study used methods like analysis of mitochondrial DNA control-region fragments from 122 individuals to learn more about various topics such as the phylogeography, genetic diversity, demographic history of the species. The conclusions strongly supported the presence of a longer-standing population in the south and a mosaic of Pleistocene refugia in the east. It is believed that today their extinction from these parts could be due to colonization. The similarity of dates obtained from more studies indicates a significant event c. 200 ka, which had brought a great change in the genetic history of the species.[19]

Ecology and behavior[edit]

Common elands resting in herds.

Common elands are nomadic and crepuscular. They eat in the morning and evening, rest in shade when hot and remain in sunlight when cold. They are commonly found in herds of up to 500, with individual members remaining in the herd anywhere from several hours to several months. Juveniles and mothers tend to form larger herds, while males may separate into smaller groups or wander individually. During estrus, mainly in the rainy season, groups tend to form more regularly.[3] In southern Africa common elands will often associate with herds of zebras, roan antelopes and oryxes.[20]

Common elands communicate via gestures, vocalizations, scent cues and display behaviors. The flehmen response also occurs, primarily in males in response to contact with female urine or genitals. Females will urinate to indicate fertility during the appropriate phase of their estrous cycle, as well as to indicate their lack of fertility when harassed by males.[3] If eland bulls find any of their predators nearby, they will bark and attempt to attract the attention of others by trotting back and forth until the entire herd is conscious of the danger.[20] Some of their main predators include lions, wild dogs, cheetahs and spotted hyenas. Juvenile elands are more vulnerable than adults to their predators.[3]

Habitat and distribution[edit]

Distribution of the common eland over the savannas and plains in eastern and southern Africa.

Common elands live on the open plains of southern Africa and along the foothills of the great southern African plateau. The species extends north into Ethiopia and most arid zones of Sudan, east into western Angola and Namibia, and south to South Africa. However, there is a low density of elands in Africa due to poaching and human settlement.

Elands prefer to live in semi-arid areas that contain many shrub-like bushes, and often inhabit grasslands, woodlands, sub-desert, bush, and mountaintops with altitudes of about 15,000 ft (4600 m).[21] Elands do, however, avoid forests, swamps and deserts. The places inhabited by elands generally contain Acacia, Combretum, Commiphora, Diospyros, Grewia, Rhus and Ziziphus trees and shrubs; some of these also serve as their food.

Elands can be found in many National Parks and reserves today, including Nairobi and Tsavo National Park, Masai Mara NR, Kenya; Serengeti, Ruaha and Tarangire National Park, Ngorongoro Crater, Tanzania; Kagera National Park, Rwanda; Nyika National Park, Malawi; Luangwa Valley and Kafue National Park, Zambia; Hwange National Park, Matobo National Park, Tuli Safari Area and Chimanimani Eland Sanctuary, Zimbabwe; Kruger National Park, Kgalagadi Transfrontier Park, Giant's Castle and Suikerbosrand NR, South Africa.[22]

They live on home ranges that can be 200–400 km2 for females and juveniles and 50 km2 for males.[23][24]

Diet[edit]

Elands are mainly grazers.

Common elands are herbivores that browse during drier winter months but have also adapted to grazing during the rainy season when grasses are more common.[3] They require a high-protein diet of succulent leaves from flowering plants but will consume lower quality plant material if available including forbs, trees, shrubs, grasses, seeds and tubers.[3][12][21][24] The eland can conserve water by increasing its body temperature.[12] Grasses the eland eats include Setaria and Themeda and fruits from Securinega and Strychnos. Large antelopes can survive on lower quality food in times of little rain. Elands feed during the night in hot weather and sleep for long periods during the day.

Most of their water is obtained from their food, though they will drink water when available.[3] As they quickly adjust to the surroundings due to seasonal changes and other causes, they also change their feeding habits. They also use their horns to break off branches that are hard to reach.[25]

Sociability and reproduction[edit]

Two male elands fighting over dominance, Knowsley Safari Park, 9 September 2009

Females are sexually mature at 15–36 months and males at 4–5 years. Mating may occur anytime after reaching sexual maturity, but is mostly seen in the rainy season. In Zambia, young are born in July and August, while elsewhere it is the mating season.[21] Mating begins when elands gather to feed on lush green plains with plentiful grass, and some males and females start mating with each other in separate pairs. Males chase the females to find out if they are in estrus. They also test the female's urine. Usually a female chooses the most dominant and fit male to mate with. Sometimes she runs away from males trying to mate, causing more attraction. This results in fights between males, in which their hard horns are used. It is 2–4 hours before a female allows a male to mount. Males usually keep close contact with females in the mating period.[24] The dominant male can mate with more than one female.[21] Females have a gestation period of 9 months, and give birth to only one calf each time.[26]

Males, females and juveniles each form separate social groups. The male groups are the smallest; the members stay together and search for food or water sources. The female group is much larger and covers greater areas.[21] They travel the grassy plains in wet periods and prefer bushy areas in dry periods. Females have a complex linear hierarchy. The nursery and juvenile group is naturally formed when females give birth to calves. After about 24 hours of the delivery, the mother and calf join this group. The calves start befriending each other and stay back in the nursery group while the mother returns to the female group. The calves leave the nursery group when they are at least two years old and join a male or female group.[26]

Conservation[edit]

Common eland in a zoo in Kraków, Poland.

Currently, common elands are not endangered. They are conserved by the U.S. Endangered Species Act, and regulated in international trade by the Convention on International Trade in Endangered Species.[27] Using ground counts and aerial surveys, the International Union for Conservation of Nature (IUCN) calculates the population density of the common eland to be between 0.05 and 1 per square kilometre with a total population estimate of 136,000.[1] Populations are considered stable or increasing in the countries of Namibia, Botswana, Zimbabwe, South Africa, Malawi and possibly Tanzania.

The population is, however, gradually decreasing due to habitat loss, caused by expanding human settlements and poaching for its superior meat.[28] As they are docile and inactive most of the time, they can easily be killed.[29] The species became extinct in Swaziland[2] and Zimbabwe,[24] but has been reintroduced.

The IUCN states that about half of the estimated total population lives in protected areas and 30% on private land. Protected areas that support major populations include Omo (Ethiopia), Serengeti, Katavi, Ruaha and Selous-Kilombero (Tanzania), Kafue and North Luangwa (Zambia), Nyika (Malawi), Etosha (Namibia), Kgalagadi Transfrontier Park (Botswana/South Africa) and Ukhahlamba Drakensberg Park (South Africa). Most of these populations appear to be stable. Relatively large numbers of common eland now live on private land, particularly in Namibia, Zimbabwe and South Africa, reflecting its value as a trophy animal. Common elands have also been widely domesticated in Zimbabwe, South Africa and Kenya, as well as in Russia, Ukraine and England.[30][31]

Uses[edit]

A common eland being skinned for its leather.
Coat of arms of Grootfontein, Namibia.

The common eland is sometimes farmed and hunted for its meat, and in some cases can be better used than cattle because it is more suited to African climates. This has led to some Southern African farmers switching from cattle to eland. Common elands are also pictured as supporters in the coat of arms of Grootfontein, Namibia.

Husbandry[edit]

Common elands have a mild temperament and have been successfully domesticated for meat and milk production in South Africa and Russia.[25] Their need for water is quite low because they produce urine with a high-urea content, but they require a substantial grazing area, along with salt licks and large amounts of supplementary foods like maize, sorghum, melons and beans which can be expensive. A female can produce up to 7 kilograms (15 lb) of milk per day that is richer in milkfat than cow milk. The pleasant-tasting milk has a butterfat content of 11-17% and can be stored for up to eight months if properly prepared, versus several days for cow milk.[3]

Housing common elands is difficult due to their ability to jump over fences as tall as 3 metres (9.8 ft) or simply break through using their substantial mass. Sometimes wild elands will break through enclosures to mix with domesticated ones. Common elands can reproduce in captivity, but calf survival is low and the young may need to be separated from their mothers to ensure health and adequate feeding.[3] Husbandry requires care because the generally placid animals startle easily and require large amounts of space.[10]

References[edit]

  1. ^ a b c IUCN SSC Antelope Specialist Group (2008). "Tragelaphus oryx". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 21 November 2011. 
  2. ^ a b c Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 696–7. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c d e f g h i j k l m n o p q r s t Pappas, LA; Elaine Anderson; Lui Marnelli; Virginia Hayssen (5 July 2002). "Taurotragus oryx" (PDF). Mammalian Species 689: 1–5. doi:10.1644/1545-1410(2002)689<0001:TO>2.0.CO;2. 
  4. ^ "Taurus". Encyclopaedia Britannica. Merriam-Webster. 
  5. ^ Harper, Douglas. "Tragos". Online Etymology Dictionary. 
  6. ^ Harper, Douglas. "Oryx". Online Etymology Dictionary. 
  7. ^ a b "Common Eland". Tititudorancea.com. 14 October 2010. Retrieved 5 January 2011. [dead link]
  8. ^ "Eland". Oxford University Press. Oxford Dictionaries. 
  9. ^ "Eland". Encyclopaedia Britannica. Merriam-Webster. 
  10. ^ a b c Harris, H (April 30, 2010). "Husbandry Guidelines For The Common Eland" (PDF). Retrieved 2012-04-14. 
  11. ^ Kingdon, J (1997). The Kingdon Field Guide to African Mammals. Princeton University Press. ISBN 0-691-11692-X. 
  12. ^ a b c d "Animal Bytes – Common Eland". Seaworld.org. Retrieved 2012-04-08. 
  13. ^ a b Estes, RD (1999). "Bushbuck Tribe". The Safari Companion: A Guide to Watching African Mammals, Including Hoofed Mammals, Carnivores, and Primates. Chelsea Green Publishing. pp. 154. ISBN 0-9583223-3-3. 
  14. ^ a b Skinner, JD; Chimimba, CT (2005). "Ruminantia". The Mammals of the Southern African Subregion (3rd ed.). Cambridge: Cambridge University Press. pp. 637–9. ISBN 0-521-84418-5. 
  15. ^ Carnaby T (2008). Beat About the Bush: Mammals. Jacana Media. p. 172. ISBN 978-1-77009-240-2. 
  16. ^ "Common eland: Taxonomy". Museumstuff.com. Retrieved 5 January 2011. 
  17. ^ Groves, CP; Grubb P (2011). "Artiodactyla". Ungulate Taxonomy. Maryland: Johns Hopkins University Press. p. 142. ISBN 978-1-4214-0093-8. 
  18. ^ Jorge, W.; Butler, S.; Benirschke, K. (1 January 1976). "Studies on a male eland x kudu hybrid". Reproduction 46 (1): 13–16. doi:10.1530/jrf.0.0460013. PMID 944778. 
  19. ^ Lorenzen, Eline D.; Masembe, Charles; Arctander, Peter; Siegismund, Hans R. (1 March 2010). "A long-standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope". Journal of Biogeography 37 (3): 571–581. doi:10.1111/j.1365-2699.2009.02207.x. 
  20. ^ a b Burton, RM (2002). "Eland". International wildlife encyclopedia (3 ed.). New York: Marshall Cavendish. pp. 757–9. ISBN 0-7614-7266-5. 
  21. ^ a b c d e "Taurotragus Oryx:Information". University of Michigan Museum of Zoology. Animal Diversity Web. 
  22. ^ "Wild Animals of Africa-Common eland". Wackywildlifewonders.com. Retrieved 5 January 2011. 
  23. ^ Eline D. Lorezen, Eline D.; Charles Masembe; Peter Arctander; Hans R. Siegismund (2010). "A long‐standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope". Journal of Biogeography 37 (3): 571–581. doi:10.1111/j.1365-2699.2009.02207.x. 
  24. ^ a b c d "The Living Africa: Wildlife – Bovid Family – Common Eland". Library.thinkquest.org. Retrieved 2012-04-09. 
  25. ^ a b Rafferty, edited by John P. (2010). "Elands, Antelopes". Grazers (1st ed.). New York, NY: Britannica Educational Pub. pp. 77–8. ISBN 978-1-61530-465-3. 
  26. ^ a b "Taurotragus oryx (Common eland)-Ontogeny and Reproduction". Ultimateungulate.com. Retrieved 5 January 2011. 
  27. ^ Dolly, Stephanie L.; Stephen Shurter. "Common Eland". 
  28. ^ East, compiled by R. (1990). "Common Eland (Tragelaphus oryx)" (PDF). West and Central Africa. Gland: IUCN. p. 131. ISBN 2-8317-0016-7. 
  29. ^ "Ecology and conservation of the eland". Seaworld.org. Retrieved 5 January 2011. 
  30. ^ "Conservation status (least concern)". Iucnredlist.org. Retrieved 5 January 2011. 
  31. ^ East, comp. by Rod; Group, the IUCN/SSC Antelope Specialist (1999). "Common Eland (Conservation status)". African antelope database 1998 (PDF). Gland, Switzerland: The IUCN Species Survival Commission. p. 139. ISBN 2-8317-0477-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!