Overview

Brief Summary

The Giant (or Derby's) Eland (Taurotragus derbianus) is one of the two species in the genus Taurotragus, the other being the Common Eland (T. oryx). Based largely on molecular and chromosomal studies (e.g., Fernández and Vrba 2005; Willows-Munro et al. 2005; Rubes et al. 2008), some authorities subsume the genus Taurotragus within Tragelaphus. The most striking feature of elands is their massive size, especially of the males.

Despite their name, Giant Elands are actually generally smaller than Common Elands, but their horns are substantially larger (as are their ears). The Giant Eland has a conspicuous  dewlap that begins under the chin (rather than at the throat, as in the Common Eland) and ends mid-neck. Giant Elands have much narrower habitat requirements than do Common Elands, being limited to broadleaf woodland savannahs, generally those dominated by the leguminous tree Isoberlinia doka, which makes up a major part of their diet. The Giant Eland  is uncommon in grassland savannahs. This species once occurred in a continuous band across Central Africa from Gambia to the White Nile. It is now extinct in Ivory Coast, Gambia, Ghana, and Togo. Today, as a result of hunting and habitat loss, Giant Elands are found only in three disjunct populations in (1) southeastern Senegal, northern Guinea, southwestern Mali, and possibly eastern Guinea-Bissau; (2) northern Cameroon, southwestern Chad, and possibly eastern and central Nigeria; and (3) Central African Republic, southeastern Chad, southwestern Sudan, and possibly northeastern Democratic Republic of Congo and northwestern Uganda. The total population is probably around 15,000 to 20,000. Only 200 or fewer individuals remain in West Africa, mainly in Senegal. Hunting has eliminated this species from much of its former range and a 1983 rinderpest epidemic took a serious toll on the global population.

(Kingdon 1997; Leslie 2011)

  • Fernández, M.H. and E.S. Vrba. 2005. A complete estimate of the phylogenetic relationships in Ruminantia: a dated species-level supertree of the extant ruminants. Biological Reviews 80: 269-302.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
  • Leslie, D.M., Jr. 2011. Genus Taurotragus. Pp. 617-618 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Rubes, J., S. Kubickova, E. Pagacova, H. Cernohorska, D. Di Berardino, M. Antoninova, J. Vahala, and T.J. Robinson. 2008. Phylogenomic study of spiral-horned antelope by cross-species chromosome painting. Chromosome Research 16(7): 935-947.
  • Willows-Munro, S., T.J. Robinson, and C.A. Matthee. 2005. Utility of nuclear DNA intron markers at lower taxonomic levels: Phylogenetic resolution among nine Tragelaphus spp. Molecular Phylogenetics and Evolution 35: 624-636.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

In the past, the Giant Eland probably occurred throughout the relatively narrow belt of savanna woodland which extends across West and Central Africa from Senegal to the Nile. The gap in its recent distribution between Mali and eastern Nigeria contains extensive areas of apparently suitable habitat (East 1999).

The Western Giant Eland has been formerly reported from Senegal to Togo, though its occurrence in Togo might have been a mistaken confusion with Bongo Tragalephaus eurycerus (Grubb et al. 1998). The subspecies still occurs in southeastern Senegal, the far north of Guinea, probably south-western Mali and possibly eastern Guinea-Bissau (East 1999; Darroze 2004; Planton and Michaux in press).

Eastern Giant Elands occur in the central African region, and were formerly distributed from north-eastern Nigeria to north-west Uganda. They now survive mainly in north-east Central African Republic. A separate population lives in northern Cameroon, with herds crossing the Chad border to the east; occasional vagrants may enter Nigerian territory. They may still occur in south-western Sudan, from which they may visit north-eastern DR Congo and north-west Uganda (East 1999; Planton and Michaux in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Giant Eland's home range extends from Senegal through southern Sudan.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male giant elands tend to be larger than females, weighing between 400 and 1000 kg. Females weigh between 300 and 600 kg. Shoulder height ranges from 130 to 180 cm, and body length ranges from 210 to 345 cm. Their massive, spiraled horns can extend up to 123 cm on males and 66 cm on females. The giant eland has sandy grey pelage with 8 to 12 whitish vertical stripes on its sides. There are black marks on the ears and hocks, and mature males have a black neck with a large dewlap extending from chin to chest.

Range mass: 1000 (high) kg.

Average mass: 1000 kg.

Range length: 210 to 345 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Giant Eland inhabit woodlands and forested Sudanian to Guinean savannas, never far from hilly/rocky landscapes nor from water (Planton and Michaux in press). Kingdon (1997) considered that it is quite strictly confined to lsoberlinia doka woodland, but recent studies indicate that its range includes areas of Terminalia-Combretum-Afzelia woodland where there is no Isoberlinia, e.g., in parts of Cameroon’s North Province such as Boumedje Hunting Concession (Bro-Jorgensen 1997). Giant Elands feed mostly on leaves, shoots, herbs and fruits (but occasionally on grasses), and will drink daily where water is available (Planton and Michaux in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Giant elands are found in sparse forest during the day, where they take shelter from the heat. They search surrounding savannahs and grasslands for food during the morning and evening when it is cooler. Elands are found in mountainous regions up to altitudes of 4500 meters.

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the giant eland consists of leaves and fruits from trees, grasses, and herbs. Their long horns are sometimes used to break branches high up on trees to get at the leaves.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: captivity:
20.3 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.3 years (captivity) Observations: One wild born specimen was about 20.3 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating usually falls within the wet season. Dominant males will mate with several females. Estrus lasts about 3 days. Gestation lasts 8 to 9 months producing a single calf. Young associate loosely with their mothers. Weaning occurs after 4 to 6 months after which the juvenile leaves its mother permanently, joining a group of other juveniles. Sexual maturity is reached at about 2 years of age. Life expectancy of giant elands is up to 25 years.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 8 to 9 months.

Range weaning age: 4 to 6 months.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
1107 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taurotragus derbianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTGTTTTCAACTAATCACAAAGACATCGGCACCCTCTATCTATTATTCGGTGCTTGAGCCGGCATAGTAGGCACAGCCCTAAGCTTGCTAATCCGTGCCGAATTGGGTCAACCCGGAACATTACTCGGAGATGACCAAATTTATAACGTTATTGTGACTGCACACGCATTTGTAATAATCTTTTTTATAGTAATACCTATTATGATTGGAGGTTTTGGCAACTGGCTCGTTCCTCTAATAATCGGAGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGGCTTCTTCCTCCTTCCTTTCTCCTACTCTTAGCCTCATCCATAGTTGAAGCTGGAGCAGGAACTGGCTGAACTGTATATCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAACCATTTTCTCCCTTCACTTAGCAGGTGTTTCCTCAATTCTAGGAGCTATTAATTTCATCACAACAATTATCAACATAAAACCCCCTGCAATATCACAATACCAAACCCCCTTATTCGTGTGATCCGTAATGATTACCGCCGTACTGCTACTCCTCTCTCTTCCTGTATTAGCAGCCGGCATCACAATACTGTTAACAGACCGAAATTTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCTTGTATCAACACCTGTTCTGATTCTTTGGACACCCAGAAGTCTATATTCTTATTTTACCCGGATTCGGAATAATTTCTCATATCGTAACTTACTACTCAGGAAAAAAGGAACCATTCGGATACATGGGAATAGTTTGAGCTATAATGTCAATCGGATTCCTAGGATTTATTGTATGGGCCCATCATATGTTCACAGTCGGAATAGACGTCGATACACGAGCTTATTTCACATCAGCCACTATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCAACACTTCATGGAGGCAATATTAAGTGATCACCAGCTATAATGTGAGCCCTAGGGTTCATTTTCCTTTTCACAGTGGGAGGTTTAACCGGAATTGTTTTAGCTAACTCCTCCCTAGACATTGTTCTCCATGATACATATTACGTAGTAGCACATTTCCACTACGTACTATCAATAGGAGCCGTATTTGCCATTATGGGGGGTTTCGTACATTGATTCCCGCTGTTTTCAGGTTACACCCTTAACGACACGTGAGCCAAAATCCACTTTGCAATTATATTTGTAGGAGTTAACATGACCTTTTTCCCACAACACTTCTTAGGATTATCAGGCATGCCACGACGATACTCCGATTATCCAGACGCGTATACGATATGAAACACCATCTCATCAATAGGCTCATTTATCTCCCTAACAGCTGTAATATTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTATCTACCGTGGATTTAACTACAACAAACCTGGAATGATTAAACGGATGTCCCCCACCATATCACACATTTGAAGAACCCGTATACGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taurotragus derbianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Total population numbers are estimated at 15,000-20,000 and probably stable over large areas of the range in Central African Republic and Cameroon where human population densities are low, although probably gradually declining across its entire range. Giant Eland are one of the most sought after antelope trophies and sustainable safari hunting is having a positive effect on the conservation of populations in many areas.

History
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of the giant eland have been declining due to excessive hunting, habitat destruction by agricultural expansion, and the spread of rinderpest. Most of the remaining numbers live in the protected park areas of southeastern Senegal.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Total numbers of the Western Giant Eland probably do not exceed ca. 200 individuals, with most of the surviving animals in Senegal (Planton and Michaux in press).

East (1999) estimated that there are probably more than 15,000 Eastern Giant Eland remaining, with over 12,500 in the CAR. Numbers have increased in CAR, Cameroon and Chad since the 1990s. The numbers that survive in Sudan are unknown, but could be substantial. This suggests a total population of the Eastern Giant Eland in the order of at least 15,000~20,000. Its numbers are probably more or less stable over large areas of its range in Central African Republic and Cameroon where human population densities are very low. However, the Eastern Giant Eland’s overall, long-term population trend is probably gradually downwards (East 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Western Giant Eland has been reduced to very low numbers by factors such as over-hunting for meat and habitat destruction caused by the expansion of human and livestock populations.

The Eastern Giant Eland occurs in much larger numbers and still has extensive areas of available habitat which are almost uninhabited and are not subjected to development pressures, particularly in northern and eastern Central African Republic and south-western Sudan. However, political instability and armed conflict are major barriers to the implementation of effective protection and management over large parts of the eastern subspecies’ remaining range. If these problems are not overcome, the eastern giant eland’s numbers will gradually decline until its survival is eventually threatened and it becomes restricted to a few protected areas.

In the past, Giant Eland have suffered heavy mortality from rinderpest, to which it is said to be more susceptible than any other antelope. Its demise in The Gambia has been attributed primarily to the devastating effects of this disease (Camara 1990). Populations in the Central African region crashed by 60-80% during and after the 1983-1984 rinderpest outbreak, but have almost recovered now (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The only reasonably secure population of the Western Giant Eland occurs in Senegal’s Niokolo-Koba National Park and the Faleme Hunting Zone. Major surviving populations of Eastern Giant Eland occur in Faro, Benoue and Bouba Ndjidda N.P. and most of the 27 surrounding hunting concessions in northern Cameroon, and in Bamingui-Bangoran and Manovo-Gounda-St Floris N.P.s and most of the hunting blocks in CAR (East 1999; Planton and Michaux in press).

Effective long-term management of national parks and hunting zones in regions such as Cameroon’s North Province and northern and eastern Central African Republic would ensure the survival of Eastern Giant Eland. Safari hunting is the most likely justification for the long-term preservation of the substantial areas of unmodified savanna woodland which this antelope requires, and sustainable trophy hunting is a key to the Giant Eland’s future. Mature bulls are one of the world’s most prized big game trophies (East 1999).

The survival of the Western Giant Eand depends on continued protection of the Niokolo-Koba population in Senegal. This subspecies’ prospects will remain precarious as long as there is only a single protected population but would be enhanced if additional populations can be protected (East 1999).

Individuals of both subspecies are held in captivity (East 1999; Planton and Michaux in press). A captive breeding group of Western Giant Eland using founders from Niokolo-Koba was established in 2000 in Bandia Reserve, Senegal. There have been 30 births at Bandia between 2000 and 2006 (M. Antonínová and P. Hejcmanová, in Planton and Michaux in press), and a second enclosure has been built in Fathala Reserve, to which a male-only group (9) and a breeding nucleus (1, 3) were translocated in mid-2006 (Antonínová et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Giant elands are a source of large quantities of tender meat, quality hides, and milk with higher protein and fat content than milk from dairy cows. These characteristics, along with the docile nature of the giant eland, have made it the target of domestication efforts in Africa and Russia.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Giant eland

The giant eland (Taurotragus derbianus), also known as the Lord Derby eland, is an open-forest and savanna antelope. A species of the family Bovidae and genus Taurotragus, it was first described in 1847 by John Edward Gray. The giant eland is the largest species of antelope, with a body length ranging from 220–290 cm (87–114 in). There are two subspecies: T. d. derbianus and T. d. gigas.

The giant eland is an herbivore, eating grasses, foliage and branches. They usually form small herds consisting of 15–25 members, both males and females. Giant elands are not territorial, and have large home ranges. They are naturally alert and wary, which makes them difficult to approach and observe. They can run at up to 70 km/h (43 mph) and use this speed as a defence against predators. Mating occurs throughout the year but peaks in the wet season. They mostly inhabit broad-leafed savannas, woodlands and glades.

The giant eland is native to Cameroon, Central African Republic, Chad, Democratic Republic of the Congo, Guinea, Mali, Senegal, and South Sudan. It is no longer present in The Gambia, Ghana, Ivory Coast, and Togo. Its presence is uncertain in Nigeria, Guinea-Bissau, and Uganda. The subspecies have been listed with different conservation statuses by the International Union for Conservation of Nature (IUCN).

Etymology[edit]

The scientific name of the giant eland is Taurotragus derbianus, derived from three words: tauros, tragos, and derbianus. Tauros is Greek for a bull or bullock.[3][4] Tragos is Greek for a male goat, and refers to the tuft of hair that grows in the eland's ear which resembles a goat's beard.[5]

The giant eland is also called "Lord Derby's eland" in honour of Edward Smith-Stanley, 13th Earl of Derby. It was due to his efforts that the giant eland was first introduced to England between 1835 and 1851. Lord Derby sent botanist Joseph Burke to collect animals, either alive or dead, from South Africa for his museum and menagerie. The first elands introduced in England were a pair of common elands, and what would later be identified as a giant eland bull.[6] The details were recorded in Smith-Stanley's privately printed work, Cleanings from the Menagerie at Knowsley Hall.[7] The Latin name indicates that it "belonged to" (given by the suffix -anus) Derby, hence derbianus.[8]

Although the giant eland is somewhat larger than the common eland, the epithet 'giant' actually refers to its large horns.[8][9] The name 'eland' is Dutch for "elk" or "moose". It has a Baltic source similar to the Lithuanian élnis, which means "deer". It was borrowed earlier as ellan (French) in the 1610s or elend (German).[10][11][12]

Taxonomy[edit]

Subspecies T. d. gigas in Cincinnati Zoo

The giant eland was first described in 1847 by John Edward Gray, a British zoologist, who called it Boselaphus derbianus.[2] At that time, it was also called the 'black-necked eland' and Gingi-ganga.[13]

Giant eland is placed in the genus Taurotragus of family Bovidae. Giant elands are sometimes considered part of the genus Tragelaphus on the basis of molecular phylogenetics, but are usually categorized as Taurotragus, along with the common eland (T. oryx). Giant eland and common eland are the only antelopes in the tribe Tragelaphini to be given a generic name other than Tragelaphus.[14] Although some authors, like Theodor Haltenorth, regarded the giant eland as conspecific with the common eland, they are usually considered two distinct species.[2]

Two subspecies of giant eland have been recognized:[1][15][16]

Physical description[edit]

Giant elands have tightly spiraled, V-shaped horns

The giant elands are spiral-horned antelopes. Despite its common name, this species broadly overlaps in size with the common eland (Taurotragus oryx). The giant eland is the largest species of antelope in the world.[17][18][19][20] They are typically between 220 and 290 cm (7.2 and 9.5 ft) in head-and-body length and stand approximately 130 to 180 cm (4.3 to 5.9 ft) at the shoulder. Giant elands exhibit sexual dimorphism, as males are larger than females. The males weigh 400 to 1,000 kg (880 to 2,200 lb) and females weigh 300 to 600 kg (660 to 1,320 lb).[21] The tail is long, having a dark tuft of hair, and averages 90 cm (35 in) in length.[8] The life expectancy of giant elands is up to 25 years in the wild, and about 20 years in captivity.[21]

The smooth coat is reddish-brown to chestnut, usually darker in males than females, with 8–12 well-defined vertical white stripes on the torso. The colour of the male's coat darkens with age. According to zoologist Jakob Bro-Jørgensen, the colour of the male's coat can reflect the levels of androgen, a male hormone, which is highest during rutting.[22] Comparing the subspecies, T. d. derbianus is characterised by 15 body stripes, smaller size, and a rufous colour, while T. d. gigas is larger, a sandy colour, and has 12 body stripes.[22]

A crest of short black hair extends down the neck to the middle of the back, and is particularly prominent on the shoulders. The slender legs are slightly lighter on their inner surfaces, with black and white markings just above the hooves. There are large black spots on the upper forelegs. The bridge of the nose is charcoal black, and there is a thin, indistinct tan-coloured line, which is the chevron, between the eyes. The lips are white, as are several dots along the jawline.[8] A pendulous dewlap, larger in males than females, originates from between the jowls and hangs to the upper chest when they reach sexual maturity, with a fringe of hair on its edge. The large ears of the giant eland serve as signaling devices.[23] Giant elands have comparatively longer legs than the common eland, as well as much brighter black and white markings on the legs and pasterns.[15][24]

Both sexes have tightly spiraled, 'V'-shaped horns.[25] They can be up to 123 cm (4.04 ft) long on males and 66 cm (2.17 ft) on females.[21] Males have horns that are thicker at the ends, longer, and more divergent than those of females.[9] These features of the horns suggest that the giant eland evolved from an ancestor with true display horns.[23]

Parasites[edit]

Fecal studies of the western giant eland revealed the presence of a newly found species Eimeria derbani, of genus Eimeria, which consists of Apicomplexan parasites. The sporulation lasted for two days at a temperature of 23 °C (73 °F). The species has been differentiated from E. canna and E. triffittae, which parasitize the common eland (T. oryx).[26] The giant eland is also parasitised by Carmyerius spatiosus (a trematode species), Taenia crocutae and T. hyaennae (two tapeworm species).[27]

Genetics and evolution[edit]

The giant eland has 31 male chromosomes and 32 female chromosomes. In a 2008 phylogenomic study of spiral-horned antelopes, chromosomal similarities were observed between cattle (Bos taurus) and eight species of spiral-horned antelopes, namely: nyala (Tragelaphus angasii), lesser kudu (T. imberbis), bongo (T. eurycerus), bushbuck (T. scriptus), greater kudu (T. strepsiceros), sitatunga (T. spekei), giant eland (Taurotragus derbianus), and common eland (T. oryx). It was found that chromosomes involved in centric fusions in these species used a complete set of cattle painting probes generated by laser microdissection. The study confirmed the presence of the chromosome translocation known as Robertsonian translocation (1;29), a widespread evolutionary marker common to all known tragelaphid species.[28]

An accidental mating between a male giant eland and a female kudu produced a male offspring, but it was azoospermic. Analysis showed that it completely lacked germ cells, which produce gametes. Still, the hybrid had a strong male scent and exhibited male behaviour. Chromosomal examination showed that chromosomes 1, 3, 5, 9, and 11 differed from the parental karyotypes. Notable mixed inherited traits were pointed ears as the eland's, but a bit widened like kudu's. The tail was half the length of that of an eland with a tuft of hair at the end as in kudu.[29]

Previous genetic studies of African savanna ungulates revealed the presence of a long-standing Pleistocene refugium in east and South Africa, which also includes the giant eland. The common eland and giant eland have been estimated to have diverged about 1.6 million years ago.[30]

Habitat and distribution[edit]

Distribution:
      Western giant eland
      Eastern giant eland

Giant elands live in the broad-leafed savanna, woodlands, and glades of central and western Africa, which correspond to the two subspecies. They also live in forests as well as on the fringes of deserts. The giant elands can also live in deserts, as they produce very dry dung.[31] They are found in South Sudan and Central African Republic into northern Cameroon and southern Chad.[15]

They inhabit places near hilly or rocky landscapes and those with water sources nearby. Science author Jonathan Kingdon had thought the giant elands lived only in woodlands of Isoberlinia doka, an African hardwood tree.[1] The giant eland is adapted to these broad-leafed, deciduous Isoberlinia woodlands.[24] Recent studies proved that they also inhabit woodlands with trees of the genera Terminalia, Combretum, and Afzelia.[1]

In the past, giant elands occurred throughout the relatively narrow belt of savanna woodland that extends across West and Central Africa from Senegal to the Nile. Today they are conserved in national parks and reserves, and occur mostly in Senegal. The western giant eland is largely restricted to Niokolo-Koba National Park in Senegal. The eastern giant eland is found in several reserves, for example in Bénoué National Park, Faro National Park and Bouba Njida National Park in Cameroon and in Manovo-Gounda St. Floris National Park in the Central African Republic. They are also kept in captivity.[1]

Ecology and behaviour[edit]

Primarily nocturnal,[32] giant elands have large home ranges and seasonal migration patterns. They form separate groups of males and of females and juveniles.[21] Adult males mainly remain alone,[23] and often spend time with females for an hour to a week. A gregarious species, giant eland herds usually consist of 15–25 animals (sometimes even more) and do not disband during the wet season, suggesting that social rather than ecological factors are responsible for herding.[8] During the day, herds often rest in sheltered areas. As many other animals do, giant elands scrape mineral lick sites with the help of horns to loosen soil.[33]

Giant elands are alert and wary, making them difficult to approach and observe or to hunt.[15][34] If a bull senses danger, he will give deep-throated barks while leaving the herd, repeating the process until the whole herd is aware of the danger. Giant elands can move quickly, running at over 70 km/h (43 mph), and despite their size are exceptional jumpers, easily clearing heights of 1.5 m (4.9 ft).[31] Their primary predators are the lion, spotted hyena and perhaps leopards.[8] Due to their large size, they prove a good meal for the predators.[15]

Diet[edit]

The giant eland is a herbivore.

Primarily a herbivore, the giant eland eats grasses and foliage, as well as other parts of a plant.[17][25] In the rainy season, they browse in herds and feed on grasses. They can eat coarse, dry grass and weeds if nothing else is available. They eat fruits too, such as plums. A study in South Africa showed that an eland's diet consists of 75% shrubs and 25% grasses, with highly varying proportions. They often use their long horns to break off branches.[31]

They need regular intake of water in their diet. That is the reason for their preference of a place with a water source nearby.[8] However, some adaptations they possess help them to survive even in the lack of water by maintaining a sufficient quantity of it in their body. They produce very dry dung compared to domestic cattle. In deserts, they can get their required water from the moisture of succulent plants. Another way in which they conserve water is by resting in the day, and feeding in the night, so that they minimize the water quantity required to cool themselves.[31]

Several studies have investigated the eland's diet. A study of giant elands in the Bandia Natural reserve in Senegal revealed that the most important and most preferred plants were Acacia species, Terminalia species, Azadirachta indica, Combretum species, Danielia olliveri, Lonchocarpus laxiflorus, Maytenus senegalensis, Prosopis africana, Pterocarpus erinaceus, Saba senegalensis and pods of Piliostigma thonningii.[17] Another study in Sudan showed that western giant elands preferred Cassia tora the most, and it was the most abundant legume there.[35]

In 2010, histological analysis of the feces of South African western giant elands was done in the Niokolo-Koba National Park and in the Bandia National Reserve. In both studies leaves, shoots of woody plants, and fruits were found to be the three major components. The other components that appeared in minor proportions were forbs and grasses, generally below five percent of the mean fecal volume. They were seen eating most foliage from Boscia angusifolia, Grewia bicolor, Hymenocardia acida, and Ziziphus mauritiana, and the fruits of Acacia and Strychnos spinosa. In the Bandia Reserve, differences in diet were marked among age classes. The conclusions were that in the dry season the eland was a pure browser, consuming grasses in small amounts.[36][37]

Reproduction[edit]

Two males fighting for dominance

Mating occurs throughout the year, but peaks in the wet season. Females reach sexual maturity at about two years, and males at four to five years. A female can remain in estrus for three days, and the estrous cycle is 21–26 days long.[21][38] As in all antelopes, mating occurs at a time of food abundance.[38][39] In some areas distinct breeding seasons exist. In southern Africa, females have been seen giving birth from August to October, and are joined by the males from late October to January. In Zambia calves are born in July and August.[38]

Fights occur for dominance, in which the bulls lock horns and try to twist the necks of their opponents. As an act during rut, the males rub their foreheads in fresh urine or mud. They also use their horns to thresh and throw loose earth on themselves. The horns of older males get worn out due to rubbing them on tree barks.[31] Expressions of anger are not typically observed.[8] Dominant males may mate with multiple females. The courtship is brief, consisting of a penetration and one ejaculatory thrust.[39]

After the courtship, the gestational period begins, which is of nine months duration. The delivery usually takes place in the night, after which the mother ingests the afterbirth.[31] Generally one calf is delivered, and it remains with its mother for six months.[21] Lactation can last for four to five months. After the first six months the young eland might join a group of other juveniles.[38]

A Senegalese study focused on the suckling behaviour of giant eland and common eland calves about one to five months old determined that suckling bouts increased with the age of the calves. No other change occurred in the farmed common eland calves, but in the giant eland calves, the males were found to suckle more than female ones and shorter suckling bouts were marked in primiparous mothers than multiparous ones. The results suggest that Derby elands that lived in their natural habitat adjusted their maternal behaviour so as to be able to readily maintain a vigilant lookout for predators and other similar risks. In contrast, the farmed common elands behaved as in the conditions of captivity, without predators.[40]

Populations[edit]

The eastern giant eland ranged from Nigeria, through Cameroon, Chad, the Central African Republic, and the Democratic Republic of the Congo (formerly Zaire) to Sudan and Uganda in 1980.[41] But the rinderpest outbreak (1983–1984) caused a devastating 60–80% decline in the populations.[1] The eastern giant eland is still found in extensive areas and is listed as 'Least Concern' by the IUCN. It has many uninhabited habitats that are not expected to be occupied for human settlement, particularly in northern and eastern Central African Republic and south-western Sudan, where their population has notably increased.[41] According to Rod East, 15,000 eastern giant elands existed as of 1999, of which 12,500 are in Central African Republic. The remaining areas are often disturbed by wars and conflicts—activities that can lead to a rapid decline in the eastern giant eland's numbers if not controlled.[1]

The western giant eland is in a more dangerous situation, being listed as 'Critically Endangered' by the IUCN. Today they mostly occur in Senegal. In 1990, populations were about 1000, of which 700 to 800 were found in the Niokolo-Koba National Park and the rest in the region around the Falémé River.[15][41] As of 2008, a population of less than 200 individuals occur there, and only a few elands exist in neighboring countries.[1]

A study of the long-term conservation strategy of the western giant eland was done in the Bandia and Fathala reserves, using demographic and pedigree data based on continuous monitoring of reproduction during 2000 to 2009. In 2009, the semi-captive population was 54 individuals (26 males, 28 females). The female breeding probability was 84%, and the annual population growth was 1.36. With more population, the elands were divided into five groups for observation. Although the mean interbreeding level became 0.119, a potential gene diversity (GD) of 92% was retained. The authors concluded that with the introduction of new founders, the GD could be greatly improved in the next 100 years, and suggested that with proper management of the semi-captive population, the numbers of the western giant eland could be increased.[42]

Threats and conservation[edit]

At the Houston zoo

The major threats to the western giant eland population are overhunting for its rich meat and habitat destruction caused by the expansion of human and livestock populations.[1] The eastern giant eland is also depleting for similar reasons, and natural causes like continued droughts and competition from domestic animals are contributing to the reduction in numbers. Populations of the eastern giant eland had already gone down due to the rinderpest attacks. The situation was worse during World War II and other civil wars and political conflicts that harmed their natural habitats.[15]

The giant eland is already extirpated in The Gambia, Ghana, Ivory Coast, and Togo. The western giant eland was once reported in Togo, but is believed to have been confused with the bongo (Tragalephaus eurycerus).[1] In 1970, it was reported eliminated in Uganda, during military operations.[23] Its presence is uncertain in Guinea-Bissau[43] and Nigeria.[1]

Today the western giant eland is conserved in the Niokolo-Koba National Park and the Faheme Hunting Zone in Senegal. Field studies have proved that the Niokolo-Koba National Park is ecologically suitable for the giant eland. As observed in the 2000 census of the park, the number of deaths in a decade were only 90 to 150.[44]

The eastern giant eland is conserved in the Faro National Park, Bénoué National Park, Bouba Njida National Park, Bamingui-Bangoran National Park and Manovo-Gounda-St Floris National Park. They are bred in captivity in the Bandia Reserve and Fathala Reserve in Senegal,[1] and at White Oak Conservation in Yulee, Florida, United States. Eland born at White Oak have been sent to other countries, including Costa Rica and South Africa, to initiate breeding programs.[45]

Uses[edit]

Giant elands give large quantities of tender meat and high-quality hides even if fed a low-quality diet. These are game animals and are also hunted for trophies. Their milk is comparatively richer in proteins and milkfat than dairy cows, which can be an explanation for the quick growth of eland calves.[25][31] Eland's milk has about triple the fat content and twice the protein of a dairy cow's milk.[38] Its docility and profitable characteristics have made it a target of domestication in Africa and Russia and has also resulted in hunting.[21][32]

Many people prefer to domesticate eland rather than cattle due to their numerous benefits. Elands can survive on scarce water, which is a great advantage over domestic cattle. They can also eat coarse grasses, and can even manage to ingest some poisonous plants that can prove fatal for cattle. They are also immune to some diseases that cattle may succumb to.[31]

References[edit]

  1. ^ a b c d e f g h i j k l IUCN SSC Antelope Specialist Group (2008). Tragelaphus derbianus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b c Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 696. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ "Taurus". Encyclopaedia Britannica. Merriam-Webster. Retrieved 29 July 2012. 
  4. ^ Harper, Douglas. "Taurus". Online Etymology Dictionary. Retrieved 29 July 2012. 
  5. ^ "Tragos". Online Etymology Dictionary. Retrieved 29 July 2012. 
  6. ^ Glover, R. (1975). "The man who did not go to California" (PDF). Historical Papers 10 (1): 95–112. doi:10.7202/030791ar. 
  7. ^ Cook, John Douglas; Harwood, Philip; Pollock, Walter Herries; Harris, Frank; Hodge, Harold (February 12, 1859). "The New Venison". The Saturday Review of Politics, Literature, Science and Art 7. John W Parker and Sons. p. 183. 
  8. ^ a b c d e f g h Huffman, B. "Giant eland, Derby eland". Ultimate Ungulate. Retrieved 29 July 2012. 
  9. ^ a b Groves, Colin; Grubb, Peter (2011). Ungulate Taxonomy. Baltimore, Maryland: Johns Hopkins University Press. pp. 142–143. ISBN 1-4214-0093-6. 
  10. ^ "Eland". Oxford Dictionaries. Oxford University Press. Retrieved 29 July 2012. 
  11. ^ "Eland". Encyclopaedia Britannica. Merriam-Webster. Retrieved 29 July 2012. 
  12. ^ Douglas, Harper. "Eland". Online Etymology Dictionary. Retrieved 7 August 2012. 
  13. ^ Gray, J. E. (1 October 1847). "Description of a new species of Antelope from West Africa". Journal of Natural History Series 1 20 (133): 286–286. doi:10.1080/037454809496047. 
  14. ^ Pappas, L. A.; Anderson, Elaine; Marnelli, Lui; Hayssen, Virginia (2002). "Taurotragus oryx" (PDF). Mammalian Species (American Society of Mammalogists) 689: 1–5. doi:10.1644/1545-1410(2002)689<0001:TO>2.0.CO;2. 
  15. ^ a b c d e f g Hildyard, A (2001). "Eland" (PDF). In Anne Hildyard. Endangered wildlife and plants of the world. Marshall Cavendish. pp. 501–503. ISBN 0-7614-7198-7. 
  16. ^ East, comp. by Rod; Group, the IUCN/SSC Antelope Specialist (1999). African antelope database 1998. IUCN Species Survival Commission. pp. 143–148. ISBN 2-8317-0477-4. 
  17. ^ a b c "Ecology". Czech University of Life Sciences. Giant eland conservation. Retrieved 29 July 2012. 
  18. ^ Prothero, Donald R.; Schoch, Robert M. (2002). "Hollow horns". Horns, tusks, and flippers : the evolution of hoofed mammals. Johns Hopkins University Press. p. 91. ISBN 0-8018-7135-2. 
  19. ^ Lill, Dawid van (2004). Van Lill's South African miscellany. Zebra Press. p. 4. ISBN 1-86872-921-4. 
  20. ^ Carwardine, Mark (2008). "Artiodactyl". Animal Records. Sterling. p. 8. ISBN 1-4027-5623-2. 
  21. ^ a b c d e f g Atlan, B. "Taurotragus derbianus". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 29 July 2012. 
  22. ^ a b "Biological characteristics". Czech University of Life Sciences. Giant eland conservation. Retrieved 29 July 2012. 
  23. ^ a b c d Jonathan Kingdon (1989). "Derby's Eland". East African Mammals: An Atlas of Evolution in Africa. Academic Press [u.a.] pp. 123–125. ISBN 0-226-43724-8. 
  24. ^ a b R. D. Estes (2004). "Eland". The behaviour guide to African mammals including hoofed mammals, carnivores, primates. Univ. of California Press. p. 188. ISBN 0-520-08085-8. 
  25. ^ a b c "Western giant eland". Animal Planet. Retrieved 29 July 2012. 
  26. ^ Máca, O (2012). "Description of a new species of Eimeria Schneider, 1875 (Apicomplexa: Eimeriidae) from the western Derby eland Taurotragus derbianus derbianus Gray (Artiodactyla: Bovidae) in Senegal". Systematic Parasitology 82 (2): 121–123. doi:10.1007/s11230-012-9352-0. PMID 22581248. 
  27. ^ "Taurotragus derbianus". Myers Enterprises. Global Species. Retrieved 29 July 2012. 
  28. ^ Rubes, J; Kubickova, S; Pagacova, E; Cernohorska, H; Di Berardino, D; Antoninova, M; Vahala, J; Robinson, TJ (2008). "Phylogenomic study of spiral-horned antelope by cross-species chromosome painting". Chromosome Research: an International Journal on the Molecular, Supramolecular and Evolutionary Aspects of Chromosome Biology 16 (7): 935–947. doi:10.1007/s10577-008-1250-6. PMID 18704723. 
  29. ^ Jorge, W; Butler, S; Benirschke, K (1976). "Studies on a male eland X kudu hybrid". Journal of reproduction and fertility 46 (1): 13–16. doi:10.1530/jrf.0.0460013. PMID 944778. 
  30. ^ Lorenzen, Eline D.; Masembe, Charles; Arctander, Peter; Siegismund, Hans R. (2010). "A long-standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope". Journal of Biogeography 37 (3): 571–581. doi:10.1111/j.1365-2699.2009.02207.x. 
  31. ^ a b c d e f g h Burton, RM (2002). "Eland". International wildlife encyclopedia (3 ed.). Marshall Cavendish. pp. 757–759. ISBN 0-7614-7266-5. 
  32. ^ a b "Eland". 101 things to know when you go on safari in Africa : a travel companion. Passion for Africa Publishing. 2008. p. 136. ISBN 978-0-9805048-0-4. 
  33. ^ Ruggiero, Richard G.; Fay, J. Michael (1 September 1994). "Utilization of termitarium soils by elephants and its ecological implications". African Journal of Ecology 32 (3): 222–232. doi:10.1111/j.1365-2028.1994.tb00573.x. 
  34. ^ East, compiled by R. (1990). West and Central Africa.. IUCN. p. 170. ISBN 2-8317-0016-7. 
  35. ^ Galat, Gérard; Galat-Luong, Anh; Nizinski, Jerzy J. (2011). "Diet preferences of a Western giant (Lord Derby's) eland group in a Sahelian dry habitat". Animal Biology 61 (4): 485–492. doi:10.1163/157075511x597610. 
  36. ^ Acton, Q. Ashton (3 September 2010). "Study results from P. Hejcmanova broaden understanding of wildlife research". Issues in Global Environment: Biology and Geoscience. Scholarly Editions. ISBN 978-1-4649-6576-0. 
  37. ^ Hejcmanová, Pavla; Homolka, Miloslav; Antonínová, Markéta; Hejcman, Michal; Podhájecká, Veronika (2010). "Diet composition of Western Derby eland (Taurotragus derbianus derbianus) in the dry season in a natural and a managed habitat in Senegal using faecal analyses". South African Journal of Wildlife Research 40 (1): 27–34. doi:10.3957/056.040.0105. 
  38. ^ a b c d e Nowak, Ronald M. (1999). "Elands". Walker's Mammals of the World (Vol. 2) (6th ed.). Johns Hopkins University Press. pp. 1143–1145. ISBN 0-8018-5789-9. 
  39. ^ a b Estes, R. D. (1999). The Safari Companion: A Guide to Watching African Mammals Including Hoofed Mammals, Carnivores, and Primates. Chelsea Green Publishing. pp. 23–24. ISBN 1-890132-44-6. 
  40. ^ Hejcmanová, Pavla; Vymyslická, Pavla; Koláčková, Karolína; Antonínová, Markéta; Havlíková, Barbora; Stejskalová, Michaela; Policht, Richard; Hejcman, Michal (2011). "Suckling behavior of eland antelopes (Taurotragus spp.) under semi-captive and farm conditions". Journal of Ethology 29 (1): 161–168. doi:10.1007/s10164-010-0241-1. ISSN 1439-5444. 
  41. ^ a b c "Status". Czech University of Life Sciences, Institute of Tropics and Subtropics. Giant Eland Conservation. Retrieved 29 July 2012. 
  42. ^ Koláčková, Karolína; Hejcmanová, Pavla; Antonínová, Markéta; Brandl, Pavel (2011). "Population management as a tool in the recovery of the critically endangered Western Derby eland Taurotragus derbianus in Senegal, Africa". Wildlife Biology 17 (3): 299–310. doi:10.2981/10-019. 
  43. ^ Compiled by R.East (1990). "Guinea-Bissau". Antelopes: Part 3 - West and Central Africa: Global Survey And Regional Action Plans. IUCN. p. 35. ISBN 2-8317-0016-7. 
  44. ^ Nežerková, P.; Hájek, I. (2000). "Wildlife in National Park of Niokolo-Koba (Senegal) and its ecological background, with special regard to diet of Giant Eland". Agricultura Tropica et Subtropica 33: 44–51. ISSN 0231-5742. 
  45. ^ "Eastern Giant Eland". Retrieved 21 June 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!