Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Saiga are nomadic animals and undertake seasonal migrations from summer pastures in steppe grassland to winter pastures in desert areas (8). Large groups of saiga migrate southwards to the winter grounds, covering up to 72 miles in a day (6). The rut begins in late November and males gather groups of around 30 females in 'harems', which they defend aggressively (5). During the rut, males' noses swell up and the hair tufts below the eyes are covered in a sticky secretion (2). Males do not feed much during the rutting season, when they take part in violent fights that often end in death. The male mortality rate can reach 90 percent during this time, due to exhaustion (5). Surviving males begin to migrate north at the end of April (6). Females give birth at this time, usually to two young, which are initially concealed in vegetation; all the females within the herd will give birth within a week of each other (6). Once the calves are a few days old, the whole herd breaks into smaller herds which head northwards to the summer feeding grounds (9). Once there, smaller groups break off, reforming again for the journey south the following autumn (6). Saiga graze on a number of different grasses, herbs and shrubs (1). The unusual swollen nose is thought to filter out airborne dust during the dry summer migrations and to enable cold winter air to be warmed before it reaches the lungs (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Saiga antelope have an extremely distinctive appearance with an enlarged nose that hangs down over the mouth (5). Despite their common name these ungulates are thought to be intermediates between antelope and sheep (6). The coat is sparse and cinnamon-buff in the summer but becomes white and around 70 percent thicker in winter (6). The underbelly is light in colour throughout the year, and there is a small mane on the underside of the neck (6). Mature males have almost vertical horns; these are semi translucent and are ringed in the bottom sections (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Saiga tatarica inhabited the steppes and semi-desert regions of south-eastern Europe and Central Asia from the Precaspian steppes to Mongolia and western China. Currently, there is one population in Russia (Kalmykia) and three in Kazakhstan, although in winter some animals reach Uzbekistan and even northern Turkmenistan. A distinctive subspecies occurs in western Mongolia (the nominate subspecies formerly occurred in the Dzungarian Gobi of south-western Mongolia, but has not been seen in 40 years). Saiga became extinct in China by the 1960s, and in Ukraine in the 18th century.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Saiga tatarica populations are concentrated in three main areas within central Asia: Mongolia, Kazakhstan, and Kalmykia. (Milner-Gulland 1994)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Currently, there are three populations of the subspecies S. t. tatarica in Kazakhstan - the Ural, Ust'-Urt and Betpakdala, and one population in the Pre-Caspian region (a European population). Some herds from one of the populations within Kazakhstan migrate to Turkmenistan and Uzbekistan during the winter. Each of these populations is distinct and there is little intermingling of the populations. Until the early 1960s there was also a population of Saiga tatarica in China. Two populations of the Mongolian saiga (S. t. mongolica) inhabit the northwest of Mongolia (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most striking feature of a saiga is its large head with a huge mobile nose that hangs over its mouth. Males have a pair of long, waxy colored horns with ring-like ridges along their length. Except for the unusual snout and horns, S. tatarica look similar to small sheep. Saiga antelopes are approximately .6 m to .8 m tall at shoulder height and are approximately 1 m to 1.5 m long. They have long, thin legs and a slightly robust body. During the summer, S. tatarica have a short coat that is yellowish red on the back and neck with a paler underside. In the winter, the coat becomes thicker and longer. The winter pelage is dull gray on the back and neck and a very light, brown-gray shade on the belly. Saiga antelopes also have a short tail.

(Heptner, et. al. 1988; Sokolov 1974)

Range mass: 30 to 45 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Saiga is a nomadic herding species that generally inhabits the open dry steppe grasslands and semi-arid deserts of Central Asia. Bekenov et al. (1998) described the typical habitat as flat open areas covered with low-growing vegetation, allowing animals to run quickly; areas of broken terrain or dense cover are generally avoided, but animals may stray into these out of necessity.

The Saiga is a migratory species with widely separated summer (northern) and winter (southern) ranges. The species lives in large herds, usually up to thousand individuals. It has a high rate of reproduction and recruitment. In years with a favourable climate the population can increase by up to 60% in a single year (Chan et al. 1995). Very few animals in a population are more than 3.5 years old, indicating that the population is almost completely renewed after four years (Bekenov et al. 1998).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saiga tatarica inhabit dry steppes and semi deserts. Herds are found in grassy plains void of rugged terrain and hills. (Heptner, et. al. 1988)

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saigas typically inhabit open dry steppe and semi desert grasslands of Central Asia and Pre-Caspian region. They prefer open areas free from dense vegetation where they run quickly (up to 80 miles per hour) to avoid predators such as wolves and humans (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Saiga antelopes are herbivores. They graze on over one hundred different plant species; the most important being grasses, prostrate summer cypress, saltworts, fobs, sagebrush, and steppe lichens. (Heptner, et. al. 1988)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
12.0 years.

Average lifespan

Status: wild:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals. One wild born specimen was about 10.5 years old when it died in captivity (Richard Weigl 2005). They have been estimated to live up to 10-12 years in the wild (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Female saigas reach sexual maturity at 7 to 8 months while the males which reach sexual maturity at 2 years. The breeding period lasts from late November to late December. A female is pregnant for 5 months and usually gives birth to two young. Young begin to graze at 4-8 days old. Lactation lasts for about four months. In captivity, young saigas occasionally nurse from unrelated adults; however, this has never been observed in the wild. (Rubin, et. al 1994; Sokolov 1974)

Range number of offspring: 1 to 3.

Average number of offspring: 1.3.

Range gestation period: 4.63 to 5.07 months.

Range weaning age: 2.5 to 4 months.

Average birth mass: 3500 g.

Average number of offspring: 1.7.

Average age at sexual or reproductive maturity (male)

Sex: male:
669 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
331 days.

Parental Investment: extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saiga tatarica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTCTCAACCAACCATAAAGATATCGGCACTCTGTACCTCCTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCCCTAAGCTTACTAATTCGTGCCGAATTAGGCCAACCCGGAACCCTACTCGGAGACGACCAGATTTATAATGTAGTCGTAACCGCACATGCGTTTGTAATAATCTTCTTTATAGTAATGCCTATCATAATTGGGGGATTTGGCAACTGACTAGTCCCTCTAATAATTGGCGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCTTCTTTCCTGCTACTTCTAGCATCTTCCATAGTTGAGGCAGGAGCAGGAACAGGCTGAACTGTATACCCTCCTCTAGCAGGTAATTTAGCCCACGCAGGAGCCTCAGTAGACTTAACCATTTTTTCCCTTCACCTAGCAGGTGTTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATAAAACCCCCCGCAATATCACAATATCAAACGCCTCTATTTGTATGATCTGTCCTAATTACGGCTGTCCTCCTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATGCTTCTAACAGACCGAAATCTAAACACAACTTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTCTATATCAACACCTATTTTGATTCTTTGGACACCCCGAAGTATACATCCTTATTTTACCCGGATTTGGAATAATTTCTCACATTGTCACTTACTATTCAGGAAAAAAAGAACCATTTGGGTATATAGGAATGGTATGAGCTATAATATCCATCGGGTTCCTAGGATTTATTGTATGAGCCCATCATATATTTACAGTCGGAATAGACGTTGACACACGAGCCTACTTCACATCAGCTACCATAATCATTGCCATTCCAACTGGAGTAAAAGTTTTCAGTTGACTAGCTACGCTTCACGGAGGCAACATTAAATGATCCCCCGCTATAATATGAGCACTAGGTTTCATTTTCCTTTTCACAGTTGGAGGTCTAACTGGAATTGTCCTAGCCAACTCTTCCCTTGACATCGTTCTCCACGACACATATTATGTAGTTGCACACTTCCACTACGTTCTATCAATAGGGGCTGTATTTGCCATTATAGGAGGATTCGTGCACTGATTCCCACTATTCTCAGGATATACCCTCAATGATACATGAGCCAAAATTCACTTTGCAATTATATTTGTAGGCGTAAACATAACTTTCTTCCCACAACACTTCCTAGGACTGTCCGGCATGCCACGACGATACTCTGACTATCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGTTCATTTATTTCACTTACAGCAGTAATACTAATAATTTTCATTATCTGAGAGGCATTCGCATCTAAACGAGAAGTCCTAACTGTAGATCTTACCACAACAAACCTAGAGTGACTAAACGGATGCCCTCCTCCATATCACACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Saiga tatarica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2acd

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Milner-Gulland, E.J. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
The population has shown an observed decline of over 80% over the last 10 years and the decline is continuing. Severely skewed sex ratios are leading to reproductive collapse.

History
  • 2003
    Critically Endangered
    (IUCN 2003)
  • 2003
    Critically Endangered
  • 2002
    Critically Endangered
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Up until 1990, Saiga tatarica were successfully managed by the Soviet Union. However, the break-up of the Soviet state led to the end of the intense management of the saiga antelope. Currently, the population is rapidly declining due to severe poaching. (Milner-Gullan 1994)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3). It is also listed on Appendix II of the Convention on the Conservation of Migratory Species (CMS or Bonn Convention) (4). Subspecies: Mongolian saiga (Saiga tatarica mongolica) classified as Endangered (EN) and the Russian saiga (S. t. tatarica) is Critically Endangered (CR) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Historically, this was a common species in Eurasian steppes and semi-deserts. From information provided in recent references it appears that between 1991 and 1994, the global population of S. tatarica was relatively stable at just under one million animals, the majority of which were in Kazakhstan (approximately 810,00–825,000) (Bekenov et al. 1998, Lushchekina et al. 1999, Sokolov and Zhirnov 1998). However, the population in Kazakhstan had fallen to around 570,000 animals by 1998 (A.B. Bekenov and Iu. A. Grachev, in litt. to ASG).

In European Russia (Kalmykia), the Saiga population steeply declined after land reclamation of the Volga basin started, but the species remained numerous within the distribution area. In the 1970s the population recovered to ca.700,000–800,000 as a result of hunting regulation. However, since then the population has drastically declined. In 1980 there were an estimated 380,000 individuals, in 1996 there were 196,000, and by 2000 just 26,000 (see Milner-Gulland et al. 2001 for annual survey results for 1980–2000). At present there are no more than 18,000 animals in Kalmykia. Sex ratio is severely skewed; the proportion of males varies from 1 to 10% in different years.

The population of Mongolian Saiga increased from ca. 3,000 in 1998, to 5,200 in 2000 helped by favourable climatic conditions and active conservation measures by WWF–Mongolia. Numbers fell between 2000 and 2002 as a result of severe winters and summer drought. They continued to decline in 2002–2003, mainly because of poaching. Numbers were ca. 1,020 in 2003, and 750 in January 2004 (J. Chimeg, in litt.).

In total, the global population of Saiga is now estimated at ca.50,000, down from 1,250,000 in the mid-1970s, with most animals found in Kazakhstan.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Uncontrolled illegal hunting for horns (male horns are exported for the traditional Chinese medicine trade) and meat since the break-up of the former USSR has led to the catastrophic fall in numbers. Selective hunting of young males and subsequent distortion of the sex ratio has affected reproduction: recent research shows that heavily skewed sex ratios are resulting in reproductive collapse (Milner-Gulland et al. 2003). A second significant threat is the destruction of key habitats and traditional migration routes. Agricultural abandonment is a problem in some areas; cattle grazing formerly maintained the grassy species but land abandonment allows another species (Stippa sp.) to encroach, which the Saiga cannot eat. The recent increase in steppe fires is a further cause for concern. Severe winters can cause mass mortality.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

All the saiga populations have suffered from habitat degradation, poaching and disturbance. Droughts or severe winters, diseases and predation pressure from wolves can also act as threats of saiga populations, although these are unlikely to be major causes of the decline (10). Saiga within the former Soviet Union were the subject of concerted conservation programmes (2), so much so that the population reached almost one million individuals (1). Management of the species has now broken down however and illegal poaching is rife (1). Saiga horns are highly valued in traditional Chinese medicine as cures for illnesses such as strokes (2). Only the males of the species bear horns and poaching thus produces a population where there are far more females than males. The average life span of saiga is only around three to four years and if females do not mate every year the species can rapidly decline (2). Another main cause of the saiga's decline is the overgrazing of its pastures, general habitat degradation and construction of roads and canals. Before 1991 numbers of livestock, particularly sheep increased enormously. As a result the quality of the pastures for saiga has deteriorated (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Legislation protecting Saiga exists at national level, but increased enforcement, and especially external funding for anti-poaching measures and linked rural development are urgently needed. Some protected areas exist within Saiga range but distance between summer/winter ranges of the various populations hinders full protected area coverage. Extension of already existing and new protected areas is under discussion by the Russian Federation government. Some research is being carried out on numbers, range and behaviour. Total prohibition of saiga meat and horn trade as well as temporary removal of saiga from the hunting animals list have been proposed as key conservation measures.

The Mongolian Saiga has been legally protected since 1930. Two protected areas, Sharga NR (286,900 ha) and Mankhan NR (30,000 ha), were designated in 1993 to protect most of the remaining areas of occurrence.

Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

International trade in saiga antelope, and derivatives such as horn, is banned by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (1). Hunting is banned throughout the saiga's range (9). Further research into saiga reproductive behaviour is needed to assess the impact of hunting and this may be used to produce an effective conservation action plan (7). In order to conserve this species, protected areas for lambing and rutting should be established where saiga populations are present. Given that poaching for domestic consumption is now a major threat, strengthening of anti-poaching law enforcement is crucial. It is considered to be more important to fund national conservation action than to improve the international trade control (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Saiga tatarica occasionally trample agricultural plants and feed on crops. (Sokolov, 1974)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Saiga antelopes are valued for their fur, meat, and horns. Their horns are considered their most valuable feature. The horns are ground up and commonly used in Chinese medicine to reduce fevers. (But, et. al. 1990)

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Saiga antelope

"Saiga" redirects here. For the shotgun named after the antelope, see Saiga-12. For the rifle, see Saiga semi-automatic rifle.

The saiga (Saiga tatarica) is a critically endangered antelope which originally inhabited a vast area of the Eurasian steppe zone from the foothills of the Carpathian Mountains and Caucasus into Dzungaria and Mongolia. They also lived in North America during the Pleistocene. Today, the nominate subspecies (S. t. tatarica) is only found in one location in Russia (steppes of the northwest Precaspian region) and three areas in Kazakhstan (the Ural, Ustiurt and Betpak-dala populations). A proportion of the Ustiurt population migrates south to Uzbekistan and occasionally Turkmenistan in winter. It is extinct in China and southwestern Mongolia. The Mongolian subspecies (S. t. mongolica) is found only in western Mongolia.[2]

Physical characteristics[edit]

The saiga typically stands 0.6–0.8 m (2 ft 0 in–2 ft 7 in) at the shoulder and weighs between 36 and 63 kg (79 and 139 lb). The horned males are larger than the hornless females. Their lifespans range from 6 to 10 years. The saiga is recognizable by an extremely unusual, over-sized, flexible nose structure, the proboscis. During summer migrations the saigas' nose helps filter out dust kicked up by the herd and heats up the animals blood. In the winter it heats up the frigid air before it is taken to the lungs.

Saiga antelope skull and taxidermy mount on display at the Museum of Osteology.

Habitat and behavior[edit]

Saigas form very large herds that graze in semideserts, steppes, grasslands and possibly open woodlands eating several species of plants, including some that are poisonous to other animals. They can cover considerable distances and swim across rivers, but they avoid steep or rugged areas. The mating season starts in November, when stags fight for the possession of females. The winner leads a herd of five to 50 females. In springtime, the mothers give birth to two (in two thirds of all cases) or one single foal.

Distribution[edit]

Remains of saiga killed by a pair of wolves at a waterhole. Chu river valley, Kazakhstan. 3 November 1955.

During the Ice Age, the saiga ranged from the British Isles through Central Asia and the Bering Strait into Alaska and Canada's Yukon and Northwest Territories. By the classical age they were apparently considered a characteristic animal of Scythia, judging from the historian Strabo's description of an animal called the "Kolos" that was "between the deer and ram in size" and was (understandably but wrongly) believed to drink through its nose.[3] At the beginning of the 18th century, it was still distributed from the shores of the Black Sea, the foothills of the Carpathian Mountains, and the northern edge of the Caucasus into Dzungaria and Mongolia.

After a rapid decline they were nearly completely exterminated in the 1920s, but they were able to recover. By 1950, two million of them were found in the steppes of the USSR. Their population fell drastically following the collapse of the USSR due to uncontrolled hunting and demand for horns in Chinese medicine. At one point, some conservation groups, such as the World Wildlife Fund, encouraged the hunting of this species, as its horn was presented as an alternative to that of a rhinoceros.[4]

The saiga's distinctive face

Today, the populations have again shrunk enormously — as much as 95% in 15 years,[5] — and the saiga is classified as critically endangered by the IUCN. An estimated total number of 50,000 saigas survive today in Kalmykia, three areas of Kazakhstan and in two isolated areas of Mongolia. Another small population in the Pre-Caspian region of Russia remains under extreme threat.[6]

Cherny Zemli Nature Reserve was created in Russia's Kalmykia Republic in the 1990s to protect the local saiga population. Kalmykia's president Kirsan Ilyumzhinov announced 2010 as the Year of Saiga in Kalmykia. In Kazakhstan, the number of saiga was recently found to be increasing, from around 21,000 at the begin of this millennium to around 81,000 in January 2010.[citation needed] However, in May 2010, an estimated 12,000 of the 26,000 Saiga population in the Ural region of Kazakhstan have been found dead. Although the deaths are currently being ascribed to pasteurellosis, an infectious disease that strikes the lungs and intestines, the underlying trigger remains to be identified.[7]

Kazakhstan in November 2010 reaffirmed a ban on hunting saiga antelopes, and extended this ban until 2021, as the Central Asian nation seeks to save the endangered species.[8]

The Mongolian saiga (S. t. mongolica) is found in a small area in western Mongolia around the Sharga and Mankhan Nature Reserves.[9]

Currently, only the Moscow Zoo and Askania-Nova keep saigas.[10] Cologne Zoological Garden and San Diego Zoo had them in the past. Pleistocene Park in northern Siberia plans to introduce the species.

Conservation[edit]

Stuffed saiga herd at The Museum of Zoology, St. Petersburg

The Saiga Conservation Alliance was started in the early 1990s as an informal network of researchers and conservationists to study and protect the critically endangered saiga antelope. The SCA was officially inaugurated in September 2006, and in November 2006 was granted Candidate Partner status by the Wildlife Conservation Network.[11] SCA also publishes a bi-annual newsletter with latest updates from the field and range countries.[12]

The organization Rewilding Europe has plans for reintroducing saiga to Europe.[13]

The horn of the saiga antelope is used in traditional Chinese medicine, and can sell for as much as $150.[14] Demand for the horns have wiped out the population in China, where the saiga antelope is a Class I protected species, and drives poaching and smuggling.

Under the auspices of the Convention on Migratory Species of Wild Animals (CMS), also known as the Bonn Convention, the Memorandum of Understanding (MoU) Concerning Conservation, Restoration and Sustainable Use of the Saiga Antelope was concluded and came into effect 24 September 2006.[15] Being one of the fastest population collapses of large mammals recently observed, the MoU aims to reduce current exploitation levels and restore the population status of these nomads of the Central Asian steppes.

In June 2014, Chinese customs at the Kazakh border uncovered 66 cases containing 2,351 saiga antelope horns, estimated to be worth over Y70.5 million (US$11 million).[16] At that price, each horn would cost over US$4,600.

References[edit]

  1. ^ Mallon, D.P. (2008). "Saiga tatarica". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 19 December 2012. 
  2. ^ "Saiga/mongolian Saiga (Saiga tatarica)". Evolutionarily Distinct and Globally Endangered. The Zoological Society of London. Retrieved 19 December 2012. 
  3. ^ Strabo (25 September 2012). "Book VII, Chapter 4, Paragraph 8". Geography. Retrieved 19 December 2012. 
  4. ^ Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 210. ISBN 0-06-055804-0. Retrieved 19 December 2012. 
  5. ^ "Welcome to the Saiga Conservation Alliance". Saiga Conservation Alliance. Retrieved 19 December 2012. 
  6. ^ "Emergency appeal: saigas of the pre-Caspian region of Russia under extreme threat". Saiga Conservation Alliance. 18 March 2010. Retrieved 19 December 2012. 
  7. ^ "Mystery over mass antelope deaths in Kazakhstan". BBC News. 28 May 2010. Retrieved 19 December 2012. 
  8. ^ "Kazakhstan extends Saiga antelope hunting ban until 2021". Silk Road Intelligencer. 19 January 2011. Archived from the original on 29 July 2011. Retrieved 19 December 2012. 
  9. ^ Mallon, David P.; Kingswood, Steven Charles (2001). Antelopes: Part 4 - North Africa, the Middle East, and Asia: Global Survey and Regional Action Plans. International Union for Conservation of Nature. p. 164. ISBN 2831705940. Retrieved 19 December 2012. 
  10. ^ "Western saiga (Russian saiga)". Zootierliste. Retrieved 19 December 2012. 
  11. ^ "Who we are". Saiga Conservation Alliance. Retrieved 19 December 2012. 
  12. ^ "Saiga News". Saiga Conservation Alliance. Retrieved 19 December 2012. 
  13. ^ "Big efforts needed for wildlife recovery". Rewilding Europe. 11 November 2011. Retrieved 19 December 2012. 
  14. ^ See Wild Russia
  15. ^ "Memorandum of Understanding concerning Conservation, Restoration and Sustainable Use of the Saiga Antelope (Saiga spp)". Convention on Migratory Species. 25 September 2011. Retrieved 19 December 2012. 
  16. ^ (Chinese) 新疆霍尔果斯海关破获一起羚羊角走私案 天山网 2014-06-23

Further reading[edit]

  • Singh, N.J., Milner-Gulland, E.J. (2011) (2011). "Conserving a moving target: planning protection for a migratory species as its distribution changes". Journal of Applied Ecology, 48: 35–46. doi:10.1111/j.1365-2664.2010.01905.x. 
  • Singh, N.J., Grachev, Iu.A., Bekenov, A.B., Milner-Gulland, E.J. (2010) (2010). "Tracking greenery in Central Asia: The migration of the saiga antelope". Diversity and Distributions 16 (4): 663–675. doi:10.1111/j.1472-4642.2010.00671.x. 
  • Singh, N.J., Grachev, Iu.A., Bekenov, A.B., Milner-Gulland, E.J. (2010) (2010). "Saiga antelope calving site selection is increasingly driven by human disturbance". Biological Conservation 143 (7): 1770–1779. doi:10.1016/j.biocon.2010.04.026. 
  • Kuhl, A., Mysterud, A., Grachev, Iu.A., Bekenov, A.B., Ubushaev, B.S., Lushchekina, A.A., Milner-Gulland, E.J. (2009) (2009). "Monitoring population productivity in the saiga antelope". Animal Conservation 12 (4): 355–363. doi:10.1111/j.1469-1795.2009.00260.x. 
  • Kuhl, A., Balinova, N., Bykova, E., Esipov, A., Arylov, Iu.A., Lushchekina, A.A., Milner-Gulland, E.J. (2009) (2009). "The role of saiga poaching in rural communities: Linkages between attitudes, socio-economic circumstances and behaviour". Biological Conservation 142 (7): 1442–1449. doi:10.1016/j.biocon.2009.02.009. 
  • Kuhl, A., Mysterud, A., Erdnenov, G.I., Lushchekina, A.A., Grachev, Iu. A., Bekenov, A.B., Milner-Gulland, E.J. (2007) (2007). "The big spenders of the steppe: sex-specific maternal allocation and twinning in the saiga antelope". Proceedings of the Royal Society B 274 (1615): 1293–1299. doi:10.1098/rspb.2007.0038. PMC 2176182. PMID 17341456. .
  • Morgan, E.R., Medley, G.F., Torgerson, P.R., Shaikenov, B., and Milner-Gulland, E.J. (2007) (2007). "Parasite transmission in a migratory multiple host system". Ecological Modelling 200 (3–4): 511–520. doi:10.1016/j.ecolmodel.2006.09.002. 
  • Kholodova, M.V., Milner-Gulland, E.J., Easton, A.J., Amgalan, L., Arylov, Iu., Bekenov, A., Grachev, Iu.A., Lushchekina, A.A., Ryder, O. (2006) (2006). "Mitochondrial DNA variation and population structure of the Critically Endangered saiga antelope Saiga tatarica". Oryx 40: 103–107. doi:10.1017/S0030605306000135. 
  • Morgan, E.R., Lundervold, M., Medley, G.F., Shaikenov, B.S., Torgerson, P.R., Milner-Gulland, E.J. (2006) (2006). "Assessing risks of disease transmission between wildlife and livestock: the Saiga antelope as a case study". Biological Conservation 131 (2): 244–254. doi:10.1016/j.biocon.2006.04.012. 
  • Morgan, E.R., Shaikenov, B., Torgerson, P.R., Medley, G.F., Milner-Gulland, E.J. (2005) (2005). "Helminths of saiga antelopes in Kazakhstan: Implications for conservation and livestock production". Journal of Wildlife Diseases 41 (1): 149–162. doi:10.7589/0090-3558-41.1.149. PMID 15827221. 
  • Milner-Gulland, E.J., Bukreeva, O.M., Coulson, T.N., Lushchekina, A.A., Kholodova, M.V., Bekenov, A.B., Grachev, Iu.A. (2003) (2003). "Reproductive collapse in saiga antelope harems". Nature 422 (6928): 135. doi:10.1038/422135a. PMID 12634775. 
  • Robinson, S., Milner-Gulland, E.J. (2003) (2003). "Political change and factors limiting numbers of wild and domestic ungulates in Kazakhstan". Human Ecology 31: 87–110. doi:10.1023/A:1022834224257. 
  • Milner-Gulland, E.J., Kholodova, M.V., Bekenov, A.B., Bukreeva, O.M., Grachev, Iu.A., Amgalan, L., Lushchekina, A.A. (2001) (2001). "Dramatic declines in saiga antelope populations". Oryx 35 (4): 340–345. doi:10.1046/j.1365-3008.2001.00202.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!