Overview

Distribution

Range Description

Steenbok have a disjunct distribution, with one population in East Africa (southern Kenya, north and central Tanzania) and a larger one in southern Africa, the isolating barrier being the tall miombo woodlands of central Zambia, Malawi (from which there are no records) and northern Mozambique (Du Toit in press). In southern Africa, their range extends from southern Angola and western Zambia, into most of Namibia (except the arid coastal parts), throughout Botswana, much of Zimbabwe, southern Mozambique, and much of South Africa (being absent only from southern and south-eastern KwaZulu-Natal and the neighbouring Eastern Cape) (Du Toit in press). Although their distribution is largely unchanged in southern Africa, in East Africa they no longer occur in Uganda, where most suitable habitat is now cultivated (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The steinbuck is found in the southern and eastern savanna of Africa. There are two main populations of steinbuck, separated from one another by the miombo woodlands (Kingdon, 1982).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The steinbuck is a small antelope (Stuart and Stuart, 1995). The length of its head and body ranges from 70 - 95 cm. The shoulder height varies from 45 - 60 cm. The tail is very short, with total length ranging from 4 - 6 cm (Kingdon, 1982). The horns are only found on males; they range in height from 9- 19 cm (Kingdon, 1982) and are vertical in orientation (Stuart and Stuart, 1995). The coloration of the steinbuck is reddish-fawn, with a white throat and belly. They also have large, white lined ears. The hooves are sharp and serve a variety of functions (Kingdon, 1982).

Range mass: 7 to 16 kg.

Average basal metabolic rate: 20.619 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Steenbok occupy a variety of habitats, from semi-desert to alpine moorland zones up to altitudes of 3,500 m on Mt Kenya (Du Toit in press). They occur widely in drier savannas, grasslands and scrublands (East 1999). In southern Africa they show a particular preference for heavily grazed areas, where the herb layer has a high forb to grass ratio and the woody layer is dominated by encroaching thorn scrub; such conditions often occur around watering points although Steenbok are largely water-independent. The key habitat requirement is the availability of high-quality food items (green browse, geophytes, berries, flowers or pods) throughout the year (Du Toit in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Steinbucks prefer open areas, but they require cover nearby (Stuart and Stuart, 1995). Steinbucks are never found in wooded or broken areas. They are beginning to be found in slightly wooded areas and areas where the environment is more open due to cultivation and road building (Kingdon, 1982).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the steinbuck ranges from grasses to roots and tubers of some plants. Steinbucks prefer the shoots of buchland trees and shrubs. They prefer foods that are rich and easily digestible. Steinbuck tend to eat more grasses in the early rainy season or after burns (Kingdon, 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
9.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Steinbucks breed throughout the year (Kingdon, 1982), but calves are usually born in the summer (Stuart and Stuart, 1995). The interval between births ranges from five and a half to nine months. The gestation period ranges from 168 - 177 days. At birth, the young steinbucks weigh around one kilogram. Within five minutes of birth, steinbucks begin to feed from their mothers. Steinbucks begin to eat grass around two weeks after birth (Kingdon, 1982). For the first few weeks, young steinbucks remain hidden (Stuart and Stuart, 1995). Steinbucks are weaned in three months (Kingdon, 1982).

Range number of offspring: 1 to 2.

Range gestation period: 5.6 to 5.9 months.

Average weaning age: 3 months.

Average birth mass: 920 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
243 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
238 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Raphicerus campestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAATCGCTGACTATTTTCAACCAATCACAAAGACATCGGAACCCTATATCTTCTATTTGGTGCCTGAGCCGGTATAGTGGGAACCGCCTTAAGCCTGCTAATTCGTGCTGAACTAGGCCAACCCGGAACCTTGCTTGGAGACGACCAGATCTACAATGTGATCGTAACTGCACATGCATTCGTAATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGGTTTGGTAACTGACTAGTTCCCCTAATAATTGGCGCCCCCGACATAGCATTTCCTCGAATAAACAATATGAGCTTTTGACTCCTTCCCCCGTCTTTCCTACTACTCCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGTTGAACTGTATACCCCCCTCTAGCAGGTAACCTAGCCCATGCAGGAGCCTCAGTAGACCTGACCATCTTCTCTCTCCACCTGGCAGGTGTTTCCTCAATTTTAGGAGCCATCAACTTTATTACAACTATTATTAACATAAAACCCCCTGCAATATCACAGTATCAAACCCCCCTGTTCGTATGATCTGTCTTAATTACTGCCGTACTACTACTCCTTTCACTTCCCGTACTAGCTGCCGGCATTACAATACTCCTAACAGACCGAAACCTGAATACAACCTTCTTCGATCCTGCAGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGCCACCCTGAAGTATATATTCTCATTTTACCCGGATTCGGGATAATCTCCCACATTGTTACCTATTACTCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTATGGGCCATAATATCTATTGGATTTCTAGGGTTCATTGTATGGGCTCATCATATATTCACAGTAGGAATAGACGTCGATACACGAGCATACTTTACATCAGCTACCATGATTATTGCAATCCCAACTGGAGTAAAAGTCTTCAGTTGACTAGCCACACTCCACGGAGGCAATATTAAATGATCTCCTGCCATAATGTGAGCACTAGGCTTTATTTTCCTTTTTACAGTCGGAGGCTTAACTGGGATTGTTTTAGCCAACTCTTCTCTTGACATTGTTCTTCATGACACATACTATGTAGTTGCACATTTCCATTATGTACTATCAATAGGAGCTGTATTTGCTATTATGGGCGGATTTGTGCATTGATTCCCATTATTCTCAGGTTATACTCTAAATGATACATGAGCCAAAATTCACTTCGCAATCATATTTGTAGGTGTAAATATGACCTTCTTCCCACAGCATTTCCTAGGACTATCCGGCATACCACGACGATACTCTGATTACCCAGACGCATACACAACATGAAATACTATCTCATCAATAGGCTCATTCATTTCACTAACAGCAGTAATACTAATAATTTTTATTATTTGAGAAGCATTTGCATCCAAACGAGAGGTCCTAACTGTAGACTACACCACAACAAATTTAGAGTGACTAAACGGATGCCCTCCACCCTACCATACATTTGAAGAACCCACATACATTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Raphicerus campestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species is widespread, relatively common and there are no major threats. The population trend is generally stable or increasing in protected areas and on private land (though it varies from decreasing to increasing elsewhere). Numbers may be declining in some unprotected areas where settlement densities and hunting pressures are high.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

---

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
East (1999) estimated a total population size in excess of 600,000 individuals, but this is an underestimate. Aerial surveys underestimate population numbers, but ground surveys, in areas where the species is common, give density estimates of 0.3-1.0/km² (East 1999). In general, there are no reliable estimates of Steenbok population density, as census methods are too unreliable for this cryptic species (Du Toit in press).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. However, Steenbok are locally vulnerable to predation by domestic dogs and subsistence herdsmen who frequently capture and kill juveniles in particular (when they are found lying alone in cover) (Du Toit in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Steenbok is very well represented in protected areas and private farmland. The largest numbers occur in areas such as Serengeti-Mara and Tarangire (East Africa), Etosha National Park and private farmland (Namibia), northern, central and south-western rangelands (Botswana), Hwange National Park and private farmland (Zimbabwe) and Kruger National Park and private farmland (South Africa) (East 1999). About one-quarter of this estimated population occurs in protected areas and 30% on private land (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

In Africa, steinbucks have been hunted for sport and meat. They are captured by snaring or by hunting with dogs (Kingdon, 1982).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Steenbok

This article is about the African antelope. For the European wild goat sometimes known as "Steinbock" or "steenbok", see Alpine Ibex.

The steenbok (Raphicerus campestris) is a common small antelope of southern and eastern Africa. It is sometimes known as the steinbuck or steinbok.

Description[edit]

Steenbok resemble small Oribi, standing 45–60cm (16"-24") at the shoulder. Their pelage (coat) is any shade from fawn to rufous, typically rather orange. The underside, including chin and throat, is white, as is the ring around the eye. Ears are large with "finger-marks" on the inside. Males have straight, smooth, parallel horns 7–19 cm long (see image left). There is a black crescent-shape between the ears, a long black bridge to the glossy black nose, and a black circular scent-gland in front of the eye. The tail is not usually visible, being only 4–6 cm long.

Distribution[edit]

There are two distinct clusters in steenbok distribution. In East Africa, it occurs in central and southern Kenya and Tanzania. It was formerly widespread in Uganda,[2] but is now possibly extinct there. In southern Africa, it occurs in Angola, Namibia, South Africa, Swaziland, Botswana, Mozambique, Zambia, Zimbabwe and probably Lesotho.

Habitat[edit]

Steenbok can use a variety of habitats from semi-desert, such as the edge of the Kalahari Desert and Etosha National Park, to open woodland and thickets, including open plains, stony savannah, and Acaciagrassland mosaics. They are said to favour unstable or transitional habitats.[3] At least in the central part of Kruger National Park, South Africa, Steenbok show a distinct preference for Acacia tortilis savannah throughout the year, with no tendency to migrate to moister areas in the dry season (unlike many African savannah ungulates, including species sympatric with Steenbok in the wet season).[4]

Diet[edit]

Steenbok typically browse on low-level vegetation (they cannot reach above 0.9 m[5]), but are also adept at scraping up roots and tubers. In central Kruger National Park, Steenbok show a distinct preference for forbs, and then woody plants (especially Flueggea virosa) when few forbs are available.[4] They will also take fruits and only very rarely graze on grass.[4] They are almost entirely independent of drinking water, gaining the moisture they need from their food.

Behaviour[edit]

During cool periods, steenbok are active throughout the day; however, during hotter periods, they rest under shade during the heat of the day. While resting, they may be busy grooming, ruminating or taking brief spells of sleep.[6]

Anti-predator[edit]

Steenbok typically lie low in vegetation cover at the first sign of threat

At the first sign of trouble, steenbok typically lie low in the vegetation. If a predator or perceived threat comes closer, a steenbok will leap away and follow a zigzag route to try to shake off the pursuer. Escaping steenbok frequently stop to look back, and flight is alternated with prostration during extended pursuit. They are known to take refuge in the burrows of Aardvarks. Known predators include African wild cat, caracal, jackals, leopard, martial eagle and pythons.

Breeding[edit]

Steenbok are typically solitary, except for when a pair come together to mate. However, it has been suggested[3] that pairs occupy consistent territories while living independently, staying in contact through scent markings, so that they know where their mate is most of the time. Scent marking is primarily through dung middens. Territories range from 4 hectares to one square kilometre. The male is aggressive during the female's oestrus, engaging in "bluff-and-bluster" type displays with rival males—prolonged contests invariably involve well-matched individuals, usually in their prime.[6]

Breeding occurs throughout the year, although more fawns are born November to December in the southern spring–summer; some females may breed twice a year. Gestation period is about 170 days, and usually a single precocious fawn is produced. The fawn is kept hidden in vegetation for 2 weeks, but they suckle for 3 months. Females become sexually mature at 6–8 months and males at 9 months.

Steenbok are known to live for 7 years or more.

Taxonomy[edit]

Steenbok phylogenetic relationships (simplified)[7]

Two subspecies are recognized: R. c. campestris in Southern Africa and R. c. naumanni of East Africa; although MSW3 also recognizes capricornis and kelleni.[8] Up to 24 subspecies have been described from Southern Africa, distinguished on such features as coat colour.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Raphicerus campestris. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Williams, John G. 1967. A Field Guide to the National Parks of East Africa. Collins, London. (ISBN 0-00-219294-2)
  3. ^ a b Kingdon, Jonathan. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego & London. Pp. 387–388. (ISBN 0-12-408355-2)
  4. ^ a b c Du Toit, Johan T. 1993. The feeding ecology of a very small ruminant, the steenbok (Raphicerus campestris). African Journal of Ecology 31: 35–48.
  5. ^ Du Toit, J.T. 1990. Feeding-height stratification among African browsing ruminants. African Journal of Ecology 28: 55–61.
  6. ^ a b Cohen, Michael. 1976. The Steenbok: A neglected species. Custos (April 1976): 23–26.
  7. ^ Matthee, Conrad A.; Scott K. Davis (2001). "Molecular Insights into the Evolution of the Family Bovidae: A Nuclear DNA Perspective". Molecular Biology and Evolution (Society for Molecular Biology and Evolution) 11 (7): 1220–1230. PMID 11420362. Retrieved 2007-06-17. 
  8. ^ Wilson, Don E. and DeeAnn M. Reeder (ed.). 2005. Mammal Species of the World. A Taxonomic and Geographic Reference (3rd edn). Johns Hopkins University Press, 2142p.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!