Overview

Brief Summary

Biology

Very little is know about the fascinating lesser short-tailed bat. Small groups occupy hollow trees and caves to roost and it is thought that bats may use their teeth and claws to excavate burrows in a manner similar to rodents (2). Agile on the ground, short-tailed bats spend large amounts of time of the forest floor, feeding on insects, fruit and nectar (3). It is thought that this species is an important pollinator of the endangered woodrose (Dactylanthus spp.), a parasitic plant of roots on the forest floor (3). During the breeding season, males are thought to compete for females via a lek mating system in which they 'sing' from important positions to attract mates (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The New Zealand lesser short-tailed bat is remarkable for the fact that it is the most terrestrial bat in the world; more at home on the forest floor than flying through the treetops (4). The tail is free of the wing membrane, and the wings can be folded beneath a leathery membrane when not in use so that the forearms act as front legs (4). The thumb has a large claw with a small talon, a feature unique amongst the smaller bats; the claws of the feet also have talons, to enable this bat to be agile on the ground and in the trees (2). The tiny lesser short-tailed bat is extremely furry and is a greyish brown colour on the upper surface whilst the underparts are paler (2). The muzzle is very short and the nostrils are oblong and vertically aligned (2). It is thought that the lesser short-tailed bat is the sole survivor of an ancient lineage; the greater short-tailed bat (Mystacina robusta) was last sighted in 1967 and is now believed to be Extinct (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

New Zealand lesser short-tailed bat is endemic to New Zealand where it was once widespread on North Island and South Island. It now occupies less than 30% of its historical geographic range (C. O'Donnell pers. comm.). The species is currently distributed on North Island in the Omahuta-Puketi Forest, the Waipoua and Warawara Forests, and throughout tracts of indigenous forest remnants ranging from Taranaki to East Cape and south to the Tararuas (Lloyd 2001, 2005). On South Island, populations are known from the Oparara Basin and Eglinton Valley, with calls recorded from Punakaiki (Lloyd 2001, 2005) and the Dart Valley (B. Lawrence pers. comm.). Large populations of this species are also present on the offshore islands of Little Barrier Island and Codfish Island (Lloyd 2001, 2005). Lesser short-tailed bats range from close to sea level to the upper altitudinal limits of forest cover (Lloyd 2001, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

M. tuberculata lives only on New Zealand and the islands immediately adjacent to it. These islands include North Island, South Island, Little Barrier Island, and several smaller islands off of Stewart Island. (Macdonald, 1984; Nowak, 1994)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to New Zealand, the lesser short-tailed bat is found on the North and South Islands as well as Little Barrier Island and smaller islands in the Stewart group (2). Three subspecies are currently recognised in different areas of the range: the kauri forest short-tailed bat, the volcanic plateau short-tailed bat, and the southern short-tailed bat (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The forearm length for M. tuberculata ranges in length from 40 to 45 mm. They are small bats, reaching head-body lengths of 6 to 8 cm. M. tuberculata has thick fur, actually thicker than that found on other species of bats. The upper portion of its body is gray brown, while the underparts are paler. The claws are needle sharp. The wings are unique in their thick and leathery membranes, and because they can be rolled under when the bat is not flying, enabling it to use its arms as forelegs when on the ground. The first phalanx of each digit folds to the outer side of the metacarpal when the wing is folded, unlike in other species of bat, in which the phalanx folds in. The thumb is also unique in that it has a large claw with a small talon projecting from it, a feature lacking in other microchiropterans. The claws of the feet also display talons. The tail perforates the dorsal surface of the tail membrane, which is thick and wrinkled at the base of the tail. M. tuberculata have an obliquely truncated muzzle, primitive nostril patterns, and a scattering of stiff bristles with spoon-shaped tips on their snout. The nostrils are oblong and vertical. The ears have a long, pointed tragus. The feet are short and broad and the sole of the foot has a grooved covering, as do the short, thick legs. A well developed calcar is present. The cheekteeth are tritubercular, and the upper molars are very well developed. M. tuberculata do not have a postorbital process. The tongue is partly extensible, with papillae at its tip. (Nowak, 1994; Macdonald, 1984; Lawlor,1979)

Average mass: 23.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lesser short-tailed bats are associated with old-growth temperate forest, with large trees available for colonial roosts, abundant epiphytes and deep leaf-litter (Lloyd 2005). Colonial breeding trees per colony number only 20-30 and they have very specific physical and microhabitat charcteristics, which are now very rare in New Zealand forests because of the history of logging (Sedgeley 2003, 2006). The species has been recorded at low numbers in logged forest, shrubland, pine plantations, and farmland in areas adjacent to undamaged old-growth forest (Lloyd 2005). Although the species primarily roosts in tree cavities, there are records of the species using caves for roosting (Lloyd 2005).

It is primarily insectivorous but also comsumes nectar, pollen, and fruit (Lloyd 2005). Lesser short-tailed bats undergo periods of torpor and seasonal hibernation (Lloyd 2005). The species is thought to undertake a lek mating system, but this has yet to be proven (C. O'Donnell pers. comm.). Females annually give birth to a single young (Lloyd 2001, 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These bats mostly live in the forests of New Zealand and its neighboring islands. (Nowak, 1994)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These bats are found in heavily forested areas; usually associated with native trees such as totara, kauri and beech (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

M. tuberculata are omnivorous, eating fruit, nectar, and pollen, as well as insects and other arthropods, and they have been seen to dine on carrion. (Macdonald,1984; Stoddart, 1979)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
7.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.6 years (captivity) Observations: One specimen lived 7.6 years in captivity (Richard Weigl 2005). Maximum longevity could still be underestimated, though.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

M. tuberculata are polyestrous. Births occur at any time, with the single young being born between spring and autumn. (Nowak,1994)

Average birth mass: 3.2 g.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mystacina tuberculata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0642-06|NC_006925|Mystacina tuberculata| AACCGTTGACTGTTTTCAACAAACCATAAAGACATCGGCACTTTATATCTATTATTTGGTGCCTGAGCGGGAATAGTAGGAACCGCCCTT---AGCCTCCTTATTCGCGCTGAGCTAGGACAACCAGGCGCCCTGCTGGGTGAC---GATCAGATTTATAATGTTATCGTCACTGCCCACGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATCGGAGGCTTCGGTAACTGACTAGTTCCTCTAATG---ATCGGAGCCCCAGATATGGCATTTCCACGAATGAATAACATAAGTTTCTGACTGCTTCCACCATCCTTTCTCCTTCTACTAGCCTCTTCAATAGTTGAGGCTGGTGCGGGTACCGGCTGAACTGTTTATCCCCCTCTAGCCGGCAACTTAGCTCACGCAGGGGCTTCCGTTGATCTA---ACTATTTTCTCCCTTCACCTAGCGGGTGTGTCCTCTATTTTAGGAGCTATTAATTTTATCACCACAATTATTAATATAAAACCTCCAGCTTTGTCCCAATATCAAACCCCTCTTTTCGTTTGATCTGTAATGATCACGGCTGTTCTTCTCCTTCTATCCCTCCCTGTCCTGGCAGCC---GGAATTACAATGTTACTAACTGATCGAAACTTGAACACTACCTTTTTCGACCCGGCTGGAGGAGGGGACCCTATTTTATATCAACATTTGTTTTGATTCTTCGGCCACCCGGAAGTATATATTCTTATTCTACCTGGCTTTGGTATAATCTCGCATATTGTTACTTACTACTCTGGGAAAAAA---GAGCCATTCGGCTACATGGGTATAGTGTGAGCTATAATGTCTATTGGATTCCTAGGTTTTATTGTCTGAGCGCACCATATATTTACAGTAGGGATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mystacina tuberculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(i,ii,iii,iv,v)+2ab(i,ii,iii,iv,v)

Version
3.1

Year Assessed
2008

Assessor/s
O'Donnell, C.

Reviewer/s
Lamoreux, J. (Global Mammal Assessment Team), Racey, P.A., Medellín, R. & Hutson, A.M. (Chiroptera Red List Authority)

Justification
Listed as Vulnerable, because its extent of occurrence is less than 20,000 km2 and the area of occupancy is less than 2,000 km2, the population is severely fragmented, and there is a continuing decline in: the extent of occurrence, area of occupancy, quality of habitat, number of locations and subpopulations, and the number of mature individuals. Additionally, further research is needed to determine whether or not the area of occupancy is <500 km2, which would qualify this species as Endangered under criterion B2.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The IUNC regards M. tuberculata ans vulnerable. It is thought that this species declined through destruction of forest habitat, predation by introduced rats and other non-native mammals, accidental poisoning, and human disturbance of roosts. (Nowak, 1994)

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU – A2c, C2a) on the IUCN Red List 2002 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Large numbers have been recorded in undamaged old-growth forest (Lloyd 2001, 2005). The largest colonial roost recorded consisted of >6,000 animals (Lloyd 2005). The overall population of lesser short-tailed bats probably exceeds 30,000 individuals with several populations containing more than 1,000 bats (Lloyd 2005).

The geographic ranges of the colonies are c.150 km2 a piece, and only about a dozen subpopulations are known (O'Donnell et al. 1999; Christie 2003; Lloyd 2005). Within these, the range of the 'irreplaceable colonial breeding sites' are much smaller (17 ha in one study; Christie 2003). Colonial breeding trees per colony number only 20-30 and they have very specific physical and microhabitat charcteristics, which are now very rare in New Zealand forests because of the history of logging (Sedgeley 2003, 2006).

The central North Island populations are large, but they are fragmented and we have little understanding of current trends there. Two of the three subpopulations that are being studied continue to decline (i.e., Oparara and Tararua). In fact, the Oparara bats (only 1 of 2 subpopulations in South Island) have not been detected for a few years now, despite considerable survey effort.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Old-growth roost trees are very important to the species. Lesser short-tailed bats are thought to have declined through forest clearance following human settlement of New Zealand.

Predation by introduced stoats and rats has also been, and continues to be, a major threat to this species. This is evident from the increase in bats on Codfish Island following the removal of Pacific rats, as well as increases in the Eglinton Valley following the initiation of comprehensive rat and stoat control. Stoats and rats are also known to visit colonial roosts, and are suspected as the reason for the critical status of the Tararua, Oparara, and Northland subpopulations in areas where no logging has occurred. Furthermore, these bats disappeared from the southern Titi Islands when ship rats were introduced.

Populations of this species also appear to be minimally impacted by poisoning through consumption of bait distributed in New Zealand forests to control invasive vertebrate species, and also through secondary poisoning resulting from consumption of invertebrates that have fed on poisoned bait (Lloyd 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The lesser short-tailed bat is under threat from habitat destruction of the native forests within which it is found; 66% of New Zealand's lowland forest has been cleared to make way for development, farming and for timber extraction (4). The only native terrestrial mammal in New Zealand, these bats evolved without the threat of ground predators; however, when Europeans first arrived on the islands they brought with them rats and cats which decimated native fauna(including these unusual bats), and remain a pertinent threat today (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Mystacina tuberculata is protected by New Zealand's Wildlife Act of 1953. Conservation is occurring using guidance from a national Bat Recovery Plan (Molloy 1995), with on-going assessments and annual work plans being co-ordinated by the national Bat Recovery Group. Management includes eradications of introduced predators from offshore islands (rats have already been eliminated from islands containing two large offshore populations), predator control at mainland sites (this is just beginning), habitat protection, trial translocations to new habitats, and general advocacy. This species occurs in a number of protected areas. More research is needed to determine the area of occupancy for the species.

There are three subspecies and five evolutionary significant units (ESUs) recognised by the New Zealand Bat Recovery Group and the New Zealand Department of Conservation (Lloyd 2003a,b). The national (non-IUCN) listings for these populations are as follows (Hitchmough et al. 2007):

Northern lesser short-tailed bat Mystacina tuberculata aupourica, nationally endangered
Eastern lesser short-tailed bat Mystacina tuberculata rhyacobia, at risk
North-western lesser short-tailed bat Mystacina tuberculata rhyacobia, at risk
Southern North Island lesser short-tailed bat Mystacina tuberculata tuberculata, nationally critical
South Island lesser short-tailed bat Mystacina tuberculata tuberculata, nationally endangered

Fortunately, the population of Mystacina tuberculata rhyacobia on the central North Island is much bigger than originally thought. Other populations, however, cannot be considered secure such as northern and southern subspecies (C. O'Donnell pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The lesser short-tailed bat is fully protected within New Zealand and is listed as a Species of Highest Conservation Priority by the New Zealand Department of Conservation (3). The Department of Conservation Bat Recovery Plan aims to conserve all bat subspecies throughout their present range and to establish new populations where possible. Research into the complex social behaviour of this little-known mammal is also being conducted (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

New Zealand Lesser Short-tailed Bat

The Lesser Short-tailed Bat, Mystacina tuberculata or Pekapeka-tou-poto in Māori, is one of only two species of short-tailed bats in the family Mystacinidae, which is endemic to New Zealand.

It is divided into three sub-species:

A colony of around 300 Short-tailed Bats was also found in the Waiohine Valley of the Tararua Forest Park in the late 1990s. The only known population of Short-tailed Bats in the southern North Island, it is thought they are related to both the volcanic plateau and the Southern Short-tailed Bats. They became isolated during a glacial period in the centre of the North Island, and through volcanic activity, more than 90,000 years ago. Pups from this unique and isolated colony, born in captivity, have been transferred to Kapiti Island in an attempt to establish an insurance population in a predator-free environment.

The Lesser Short-tailed Bat is listed by the New Zealand Department of Conservation as a "species of highest conservation priority". It is the sole host of the New Zealand batfly, which lives in a symbiotic relationship with it.

  • Short-tailed Bats weigh 12 to 15 grams, have large pointed ears, a free tail and are a mousy-grey colour.
  • Unlike most bats, which catch their prey in the air, the Short-tailed Bat has adapted to ground hunting and is one of the few bats in the world which spends large amounts of time on the forest floor, using its folded wings as "front limbs" for scrambling around.
  • Short-tailed Bats are found in indigenous forests where they roost, singly or communally, in hollow trees. The bats go into a "torpor" in cold weather and stay in their roosts. They wake up as soon as the weather becomes warmer.
  • Short-tailed bats consume spores of true ferns[1] among other sources of food.
  • Thought to be a lek breeder, i.e. males compete for traditional "singing" posts and "sing" for a female.
  • Its diet consists of insects, fruit, nectar and pollen and it is thought to be an important pollinator of the wood rose (Dactylanthus taylorii), a threatened parasitic plant which grows on the roots of trees on the forest floor.

References

  1. ^ C.Michael Hogan. 2010
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!