Overview

Distribution

Range Description

This species is found in Indonesia (Barisan Mountains of west-central Sumatra), Malaysia (mountains of the Malay Peninsula south of the Perak River), and a small area of southern peninsular Thailand (Chivers 1974; Khan, 1970; O?Brien et al. 2003; Treesucon and Tantithadapitak 1997). It may have formerly occurred on the island of Bangka (Indonesia) as well. Reports of this species from Myanmar are almost certainly erroneous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Symphalangus syndactylus is found throughout the Barisan Mountains of Sumatra (Indonesia) and in the mountains of the Malay Peninsula, south of the Perak River.

(Knight, 1997)

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Malaysia, Indonesia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Symphalangus syndactylus is the largest of the gibbons, weighing between 10 and 12 kg. The head-body length ranges from 71 to 90 cm. They have a thick, black fur coat and long, slender arms. The arm length may attain 2.3 to 2.6 times the body length. Both sexes have long canine teeth, opposable thumbs, and a great toe that is deeply separated from the foot. Symphalangus syndactylus has a short-muzzled face that is nearly hairless, accompanied by a large brain case.

The most distinguishing characteristic of siamangs is the enlarged throat sac that can be as big as a human head! These throat sacs are used as a sound box to amplify their loud vocalizations.

Siamangs are syndactylous, having their 2nd and 3rd toes fused by a thin webbing of skin.

(Preuschoft, 1990; Chivers, 1979)

Range mass: 10 to 12 kg.

Range length: 71 to 90 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species lives in primary and secondary semi-deciduous and tropical evergreen forest. All levels of the canopy are used, although emergent trees are required for resting and sleeping. Siamangs occur at lower densities in secondary forest, but can persist in secondary areas. They range from the lowlands up to 1,500 m in elevation. During a short survey in southern Sumatra, siamangs appeared to be less sensitive to habitat degradation than sympatric agile gibbons, Hylobates agilis (Geissmann et al. 2006). Since Bukit Barisan Selatan National Park coffee plantations have no canopy, they provide no habitat for this species (O?Brien et al. 2004).

Though this species is primarily folivorous in mainland Asia (Chivers 1974; Raemaekers 1984), it is primarily frugivorous on Sumatra (Palombit 1992; West 1982), feeding mostly on figs (O?Brien et al. 2003). Palombit (1992) argues that these animals are flexible foragers, preferring fruit when available, but able to switch to leaves when necessary. Such flexibility may help reduce siamang vulnerability to habitat disturbance (O?Brien et al. 2003). Siamang are strictly arboreal, highly territorial, and primarily monogamous (Chivers 1974). Extra-pair copulations have been reported in Ketambe, Gunung Leuser National Park, Sumatra (Palombit 1994), and groups with more than one adult male have been reported in the Way Kambas National Park population, Sumatra (O?Brien et al. 2003; Lappan 2005, 2007). Home range has been recorded at 15-47 ha on the Malayan peninsula (Chivers 1974; Raemaekers 1977; MacKinnon and MacKinnon 1980), and dispersal distance is less than 3 km. O?Brien et al. (2003) found that monogamy and strict territoriality may limit the range of possible response to fire and other severe disturbances by this species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Siamangs are found in lowland, hill, and upper dipterocarp forest. They spend most of their time in the mid-upper canopy.

(Chivers, 1979; Preuschoft, 1990)

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Symphalangus syndactylus survives mainly on leaves and fruit, but also eats insects, bird eggs, and small vertebrates. Symphalangus syndactylus eats a far higher proportion of leaves than any other gibbon (43 to 48 percent). During much of their feeding time they are suspended by one arm.

(Preuschoft, 1990; Chivers, 1979)

Animal Foods: eggs; insects

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As frugivores, these primates are likely to be important seed dispersers.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation on these animals has not been thoroughly documented. It is likely that avian predators are a great risk to young. Carnivores and snakes may also prey upon S. syndactylus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Two forms of communication used in this species have already been discussed. First, vocal communication, involving the morning duets of mated pairs, are very important in establishing territories and pair bonds. The neck sack of both sexes acts as a resonating chamber to amplify these calls, and makes siamangs look somewhat frog-like.

In addition to vocal communication, these animals use tactile communication. Grooming and physical aggression are two examples.

All primates use visual signals, such as facial expressions, body postures and gestures in their communication.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Related Hylobates species are known to have lived as long as 44 years in captivity. Because they are larger, siamangs probably do not live quite as long as other members of the genus. Lifespan in the wild is likely to be lower still.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43 years (captivity) Observations: One wild born specimen was still alive when about 43 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Symphalangus syndactylus is monogamous and highly territorial. Members of this species take their time in choosing a mate, and do not usually take another mate if the first one dies.

Mating System: monogamous

The gestation period in S. syndactylus is 230 to 235 days (7 months). Females typically give birth every 2 to 3 years to one young, but twins sometimes occur. The infant is weaned at 18 to 24 months and reaches maturity at about 6 to 7 years. An individual female rarely gives birth to more than 10 offspring in her lifetime.

(Palombit, 1995; Preuschoft, 1990)

Breeding interval: Females typically give birth to one young every 2 to 3 years.

Breeding season: Siamangs do not breed seasonally.

Range number of offspring: 1 to 2.

Range gestation period: 230 to 235 days.

Range weaning age: 18 to 24 months.

Range age at sexual or reproductive maturity (female): 6 to 7 years.

Range age at sexual or reproductive maturity (male): 6 to 7 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Offspring cling to the mother's belly constantly for their first 3 to 4 months of life. Females nurse their young until the young are about two years old. Males assist in parental care in siamangs by helping to defend young, defend the territory, and sometimes by grooming, playing with, or carrying the young. Older siblings may also help to rear younger siblings.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Symphalangus syndactylus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2975-10|AB504750|Symphalangus syndactylus| GACCGCTGGTTATTCTCCACAAACCATAAAGATATTGGAACACTATACTTACTATTTGGCGCATGAGCCGGAGTCCTAGGCACAGCCCTA---AGCCTCCTTATCCGAGCCGAACTAGGTCAACCCGGCAATCTCCTGGGCAAT---GACCACATCTATAACGTCATCGTAACAGCCCACGCGTTCGTCATAATCTTTTTCATAGTAATACCCATTATAATTGGGGGCTTTGGCAACTGACTAGTCCCTCTAATA---ATTGGAGCCCCCGACATGGCATTCCCTCGTATAAATAACATAAGCTTCTGGCTTCTCCCTCCCTCTTTCCTACTACTGCTTGCCTCCGCCATAGTAGAAGCCGGCGCCGGAACAGGATGAACAGTCTATCCCCCACTGGCAGGAAACTACTCCCACCCAGGAGCCTCTGTTGATTTA---ACCATTTTTTCTCTACACCTGGCTGGAGTATCATCTATCCTAGGAGCTATTAACTTCATTACTACAATCATCAACATAAAACCCCCAGCTATATCCCAATATCAAACACCTCTCTTTGTCTGATCCGTCCTAATTACAGCAGTCCTACTCCTTCTCTCCCTACCAGTTTTAGCCGCT---GGCATCACCATACTACTAACAGACCGTAATCTCAACACCACTTTCTTTGACCCAGCTGGAGGAGGAGACCCCATTCTATATCAACACCTATTCTGATTTTTTGGCCACCCCGAAGTTTACATTCTCATCCTACCAGGCTTCGGAATAATTTCACACATCGTAACTCACTACTCGGGAAAAAAG---GAGCCATTCGGATATATAGGCATAGTCTGAGCCATAATATCAATTGGCTTCCTAGGTTTCATTGTCTGAGCCCACCATATATTTACAGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Symphalangus syndactylus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hylobates syndactylus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Nijman, V. & Geissman, T.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Endangered as, there is reason to believe the species has declined by at least 50% over the past 40 years (three generations) due primarily to hunting for pet trade and continued rates of habitat loss (mainly as a result of expanding agriculture and road building). Although there has likely been 70-80% habitat loss of primary habitat within the past 50 years within the range of the species, this species is one of the most adaptable gibbons to habitat change. Although the species occurs in numerous protected areas and retains a number of viable populations, it could in future be considered Critically Endangered due to historic habitat loss, and should be closely monitored in the future.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although still fairly widespread, S. syndactylus is listed as endangered mainly due to destruction of their habitat for logging and agriculture. Also, many adults are killed so thay humans may have a pet baby siamang. Only 4% of their habitat is protected.

(Preuschoft, 1990)

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Symphalangus syndactylus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In a study on this species in Bukit Barisan Selatan National Park, Sumatra, O?Brien et al. (2004) calculated an average group density of one group for every 2.23 km2, with an average group size of 3.9, and a population estimate of 22,390 individuals. Healthy populations persist at the southern limit of its range in Bukit Barisan Selatan National Park, and these populations should survive over the long-term if the park maintains its present forest area, and if illegal hunting and habitat degradation are stopped (O?Brien et al. 2004). While some populations of this species appear secure today, its future is uncertain and will depend on vastly improved conservation efforts, especially in Sumatra?s remaining parks and protected areas (O?Brien et al. 2004). Population densities for this species range from 2.4 to 24.6 individuals/km2 (O?Brien et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened by forest conversion and opportunistic collection for pet trade on Sumatra, where both of these threats extend to populations in national parks and protection forests (O?Brien et al. 2004). Between 1995 and 2000, almost 40% of the habitat for this species on Sumatra was damaged or destroyed by logging, road development (barrier and hunting) and conversion to agriculture or plantations (O?Brien unpubl. data). Legal logging seems to be accelerating in Sumatra (Geissmann et al. 2006). Forests, where they remain, are extremely fragmented. Coffee plantations present an increasing threat (O?Brien and Kinnaird 2003). The siamang is one of the most heavily traded gibbon species for illegal pet trade (V. Nijman pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected throughout its range, both by local laws as well as internationally through its listing on CITES Appendix I (O?Brien et al. 2004). It is known to occur in at least nine protected areas: Bukit Barisan National Park, Gunung Leuser National Park, Way Kambas National Park, West Langkat R (Indonesia); Fraser?s Hill R, Gunong Besout Forest Reserve, Krau Wildlife Reserve, Ulu Gombak Wildlife Reserve (Malaysia); Hala Bala Wildlife Sanctuary (Thailand) (M. Richardson pers. comm.). There is a large worldwide captive population, in 96 collections.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of S. syndactylus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Symphalangus syndactylus has economic importance to humans. Siamangs are kept as pets, used in studies of primate behavior, and in entertainment. Many zoos display acrobatic siamangs for human enjoyment.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Siamang

The siamang (Symphalangus syndactylus) is a tailless, arboreal, black-furred gibbon native to the forests of Malaysia, Thailand, and Sumatra. The largest of the lesser apes, the siamang can be twice the size of other gibbons, reaching 1 m in height, and weighing up to 14 kg. The siamang is the only species in the genus Symphalangus.

The siamang is distinctive for two reasons. The first is that two digits on each foot are partially joined by a membrane—hence the name "syndactylus", from the Ancient Greek sun-, "united" + daktulos, "finger". The second is the large gular sac (found in both male and female of the species), which is a throat pouch that can be inflated to the size of the siamang's head, allowing the animal to make loud, resonating calls or songs.

There may be two subspecies of the siamang. If so, they are the nominate Sumatran siamang (S. s. syndactylus) and the Malaysian siamang (S. s. continentis, in peninsular Malaysia).[3] Otherwise, the Malaysian individuals are only a population. The siamang occurs sympatrically with other gibbons; its two ranges are entirely within the combined ranges of the agile gibbon and the lar gibbon. Although the siamang is given a name different from that of other gibbons, this division is not cladistically sound, since the genus Nomascus split from the rest of the gibbons before the Symphalangus split.[4]

The siamang can live more than 30 years in captivity.

While the illegal pet trade takes a toll on wild populations, the principal threat to the siamang is habitat loss in both Malaysia and Sumatra. The palm oil production industry is clearing large swaths of forest, reducing the habitat of the siamang, along with that of other species, such as the Sumatran tiger.

Contents

Ecology

The siamang inhabits the forest remnants of Sumatra Island and the Malay Peninsula, and is widely distributed from lowland forest to montane forest—even a rainforest—and can be found at altitudes of up to 3800 m.[5] The siamang lives in groups of up to six individuals (four individuals on average) with an average home range of 23 hectares.[6][7] Their day ranges are substantially smaller than those of sympatric Hylobates species, often less than 1 km.[5] The siamang's melodious singing breaks the forest's silence in the early morning after the agile gibbons' or lar gibbons' calls. The siamang in Sumatra and the Malay Peninsula are similar in appearance, but there are some differences in behaviour between the two populations.

Diet

The siamang eats mainly various parts of plants. The Sumatran siamang is more frugivorous than its Malayan relative, with fruit making up to 60% of its diet. The siamang eats at least 160 species of plants, from vines to woody plants. Its major food is figs (Ficus spp.), a member of the Moraceae family.[7][8] The siamang prefers to eat ripe rather than unripe fruit, and young rather than old leaves. It eats flowers and a few animals, mostly insects. When the siamang eats large flowers, it eats only the corollae (petals), but it will eat all parts of smaller flowers, with the small fruit collected in its hand before being consumed. When it eats big and hard seeds or seeds with sharp edges, it will peel out the fruit flesh and throw away the seed.[8] Although its diet consists of substantial portions of fruit, it is the most folivorous of all members of Hylobatidae.[5] As it is also the largest gibbon, it fits well with the general primate dietary trend in which larger primates tend to be more folivorous.[9]

Demography and population

A group of siamang normally consists of an adult dominant male, an adult dominant female, with offspring, infants and sometimes a subadult. The subadult usually leaves the group after attaining the age of six to eight years; subadult females tend to leave the group earlier than subadult males. Siamang gestation period is in between 6.2 and 7.9 months; after the infant is born, the mother takes care of the infant for the first year of its life.[10] Siamang males tend to offer more paternal care than do other members of the family Hylobatidae, taking up a major role in carrying an infant after it is about eight months old.[5] The infant typically returns to its mother to sleep and nurse. The infant begins to travel independently from its parents by its third year of life. [11]

Siamangs are generally known to have monogamous mating pairs, which have been documented to spend more time in close proximity to each other, in comparison to other gibbon species. [12] However, studies have found there are both monogamous and polyandrous groups in south Sumatra.[10] In studying these populations,infants belonging to monogamous groups were found to receive more overall male care than infants in the polyandrous groups. This reduced care is most likely due to reduced certainty of paternity in these groups. [10]

A study in relation to effect of habitat disturbance on the siamang found group composition is varied in age-sex structure between intact forest and burnt, regrown forest. The burnt, regrown forest population contained more adult and subadults than the intact forest population, which had more infants, small juveniles and large juveniles. Infant survival rates in burnt, regrown forest groups are lower than in intact forest groups. The number of individuals in the latter is higher than in the former.[7] The siamang in disturbed forests live in small groups and have a density lower than in intact forests because of lack of food resources and trees for living.

In the 1980s, the Indonesian population of the siamang in the wild was estimated to be 360,000 individuals.[13] This seems overestimated today, as an example, Bukit Barisan Selatan National Park is the third largest protected area (3,568 km²) in Sumatra, of which approximately 2,570 km² remains under forest cover inhabit by 22,390 siamangs (in 2002 censuses). According to two different research projects conducted in Sumatra, the siamang prefers to inhabit lowland forest between 500 m and 1000 m above sea level.[6]

Behavior

The siamang tends to rest for more than 50% of its waking period (from dawn to dusk), followed by feeding, moving, foraging and social activities. It takes more rest during midday, taking time to groom others or play. During resting time, it usually uses a branch of a large tree, lying on its back or stomach. Feeding behaviors, foraging, and moving are most often in the morning and after resting time. Grooming is one of the most important social interactions among family members. Grooming takes place between the adults earlier in the day, and then the adults groom the juveniles later in the day. Adult males are the most involved in grooming. [11]

A siamang group at rest - siamangs rest up to 50% of their waking hours.

In the dry season, the size of the siamang's daily range is larger than in the rainy season. The siamang in southern Sumatra undertakes less foraging than the siamang in other places because it eats more fruit and therefore consumes more nutrients, which results in less time needed for looking for food. Sometimes, the siamang will spend all of the day in one big fruiting tree, just moving out when it wants to rest and then coming back again to fruiting trees.[8]

Siamangs are a very social species of primates and exhibit a variety of tactile and visual gestures, along with actions and facial expressions to communicate and increase social bonds within their family group.[14] Siamangs are also territorial and interact with other family groups by making loud calls to let other groups know where their territory is. The calls may be asynchronous, where they are not directed at a particular neighboring group, or simultaneous group calls may take place across the territory boundary. In addition, males will chase each other across the boundary. [11]

Grooming frequency between males and females has been found to correlate to copulation frequency, as well as bouts of aggression. Pairs copulate during four to five months at intervals of two to three years. The peak of their reproductive activity is often during the time when fruit is most abundant.[11] Dorsoventral copulation is the most common type of copulation in siamangs, where the female is squatting and the male hangs by his arms and grips the female with his legs, whereas ventroventral copulation, where both primates are suspended, occurs only one in 60 times on average. [11]

Role of calling

The siamang starts its day by calling in the early morning; it calls less after midday, with the peak of the calls around 9:00 am to 10:00 am. Most of the siamang's calls are directed to its neighbours rather than to inside its home range. This means the siamang's calling is in response to disturbances and to defend its territory. Calls in the late morning typically happen when it meets or sees another siamang group. The edge of the siamang's home range, which may overlap another, is often the place where calling is made. Counter (co-response) calling occasionally happens near the border or in the overlap area. Calls are numerous when fruit is more abundant rather than when it is less available. Branch shaking, swinging, and moving around the tree crowns accompany the calling. This movement might be to show the other groups where they are.

The siamang prefers calling in the living, high and big trees, possibly where another group is easy to see. Besides that, living, big, and tall trees can support siamang movement. Calling trees are usually near feeding trees, but sometimes they call in the feeding trees.[8][15]

Mated pairs produce loud, well-patterned calling bouts, which is referred to as duetting. These calls function to advertise the presence and status of a mated pair.[3] Newly formed pairs spend more time singing than an established pair. Advertising the presence of a strong bond is advantageous in territorial defense. [16] Siamang duetting differs from other species because it has a particularly complex vocal structure. Four distinct classes of vocalizations have been documented: booms, barks, ululating screams and bitonal screams. Females typically produce long barks and males generally produce bitonal screams, but both sexes have been known to produce all four classes of vocalization. [17]

Seeding

As a frugivorous animal, the siamang disperses seeds through defecation as it travels across its territory. The siamang can carry seed and defecate over 300 m with the shortest distance being 47.6 m from the seed resource, which supports the forest regeneration and succession.[18]

Threats and conservation

The siamang, as an arboreal primate, absolutely depends on the forest for existence, so is facing a population decrease due to habitat loss,[6] poaching and hunting.[13][19]

Habitat loss

Siamang, Tierpark Hellabrunn, Munich, Germany

A major threat to the siamang is habitat loss due to plantation, forest fire, illegal logging, encroachment, and human development. Firstly, palm oil plantations have removed large areas of the siamang's habitat in the last four decades. Since 2002, 107,000 square kilometres of oil palm have been planted,[20] which has replaced much rainforest in Indonesia and Malaysia, where the siamang originally used to live. Secondly, in the last two decades, forest fire destroyed more than 20,000 km² of Sumatran rainforest, mainly in the lowland area where most of the siamangs live. Thirdly, the rate of illegal logging in Indonesia increased from 1980 to 1995 and even more rapidly after the reformation era beginning in 1998.[20] These illegal activities devastated the remaining tropical rainforest, especially in Sumatra. Fourthly, forest encroachments change forest cover into cultivated land; for example, the rising price of coffee in 1998 has been encouraging people in Sumatra to replace the forest with coffee plantation.[21] Fifthly, development in many areas needs infrastructure, such as roads, which now divide conservation areas and have been caused forest fragmentation and edge effects.

Poaching and hunting

Unlike other parts of Asia, primates are not hunted for their meat in Indonesia (the exception is Chinese restaurants in Indonesia, which sometimes serve macaque). They are poached and hunted for the illegal pet trade, mostly for infant siamangs. Poachers often kill the mothers first, since siamang females are highly protective of their infants, and it is difficult to remove the infant without first killing the mother. Most siamangs on the market are infants, which often die during transportation.[13][19]

Conservation

The siamang is known to occur in nine protected areas: Bukit Barisan Selatan National Park, Gunung Leuser National Park, Way Kambas National Park and West Langkat Reserve in Indonesia, Fraser's Hill Reserve, Gunong Besout Forest Reserve, Krau Wildlife Reserve and Ulu Gombak Wildlife Reserve in Malaysia and the Hala Bala Wildlife Sanctuary in Thailand.[2]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 181. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b Nijman, V. & Geissmann, T. (2008). Symphalangus syndactylus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ a b Geissmann, Thomas. "Gibbon Systematics and Species Identification". http://gibbons.de/main/system/intro.html. Retrieved 2006-04-13. 
  4. ^ Tokacs Z, Morales JC, Geissman T, Melnick DJ. 2005. A Complete Species-level Phylogeny of the "Hylobatidae" based onMitochondrial "ND3-ND4" Gene Sequences. "Molecular Phylogeny and Evolution" 36:456-457.
  5. ^ a b c d Rowe, Noel. (1996) "Pictorial Guide to the Living Primates" Charlestown, RI: Pagonia Press
  6. ^ a b c O'Brien, T.G., M.F. Kinnaird, A. Nurcahyo, M. Iqbal and M. Rusmanto (2004). "Abundance and Distribution of Sympatric Gibbons in a Threatened Sumatran Rainforest". International Journal of Primatology 25 (2): 267–284. doi:10.1023/B:IJOP.0000019152.83883.1c. 
  7. ^ a b c O'Brien, T. G., M. F. Kinnaird, A. Nurcahyo, M. Prasetyaningrum, Dan M. Iqbal (2003). "Fire, demography and persistence of siamangs (Symphalangus syndactylus: Hylobatidae) in a Sumatran rainforest". Animal Conservation 6 (2): 115. doi:10.1017/S1367943003003159. 
  8. ^ a b c d Nurcahyo, A. (2001). Daily Ranging, Home-Range, Foods, Feeding and Calling in Siamang (Hylobates syndactylus). In WCS-IP 2001. Bukit Barisan Selatan National Park in Space and Time. 2000 -2001 Research Report. WCS-IP/ PHKA, Bogor. 35-52. (In Indonesian)
  9. ^ Fleagle J. G. (1988). Size and Adaptation in Primates. In Jungers WL (ed). "Size and Scaling in Primate Biology". New York: Plenum Press.
  10. ^ a b c Lappan, Susan. (2008). “Male Care of Infants in a Siamang (Symphalangus syndactylus) Population including Socially Monogamous and Polyandrous Groups”. Behavioral Ecology and Sociobiology. 62(8): 1307-1317.
  11. ^ a b c d e Chivers, David J. (1976). Communication within and between family groups of siamang (Symphalangus syndactylus). Behaviour 57 (1-2): 116-135.
  12. ^ Palombit, Ryne A. (1996). “Pair Bonds in Monogamous Apes: A Comparision of the Siamang ,Hylobates syndactylus, and the White-Handed Gibbon Hylobates lar. Behaviour. 133 (5) 321-356.
  13. ^ a b c Nijman,V. (2005). In Full Swing: An Assessment of Trade in Orang-Utans and Gibbons on Java and Bali, Indonesia. A Traffict Southeast Asia Report. Traffic Southeast Asia
  14. ^ Liebal, Pika, and Tomasello. (2004). “Social Communication in Siamangs (Symphalangus syndactylus): use of gestures and facial expressions” Primates. 45(1): 41-57.
  15. ^ Kinnaird, M. F., O’Brien, T. G., Nurcahyo, A. and Prasetyaningrum, M. (2002). "Intergroup spacing and the role of calling among siamangs". Proceedings of the XIX Congrees of the International Primatological Society (abstract). 
  16. ^ Geissmann, Thomas (1986). "Mate Change Enhances Duetting Activity in the Siamang Gibbon (Hylobates syndactylus)". Behavior 1 (96): 17-27. 
  17. ^ Geissmann, Thomas (1999). "Duet Songs of the Siamang, Hylobates Syndactylus: II. Testing the Pair-Bonding Hypothesis during a Partner Exchange". Behaviour 8 (136): 1005-1039. 
  18. ^ Rusmanto, M. (2001). Seed dispersal by siamang (Hylobates syndactylus). In WCS-IP 2001. Bukit Barisan Selatan National Park in Space and Time. 2000 -2001 Research Report. WCS-IP/ PHKA, Bogor. 53-64. (In Indonesian)
  19. ^ a b Nursahid, R. and Bakdiantoro, H. (2005). Illegal Primate Trade in Indonesia. Profauna Indonesia. Presentation in SEAPA 1st Congress.
  20. ^ a b Palmer, C. E. The Extent and Causes of Illegal Logging: An Analysis of a Major Cause of Tropical Deforestation in Indonesia. CSERGE Working Paper.
  21. ^ Kinnaird, M.F., Sanderson, E.W., O'Brien, T.G., Wibisono, H.T., and Woolmer, G. (2003). "Deforestation trends in a tropical landscape and implications for endangered mammals". Cons. Biol. 17: 245–257. doi:10.1046/j.1523-1739.2003.02040.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!