Overview

Brief Summary

Biology

Throwing itself from tree to tree over gaps of over nine metres, this tree-dwelling primate moves its forearms alternately to swing beneath the branches (3) (6). Despite exhibiting this brilliant form of locomotion, known as brachiation, the pileated gibbon is also able to move short distances by foot, and can also climb whilst moving slowly or feeding (5). The diet of the pileated gibbon consists primarily of fruits high in sugar, such as the fig (Ficus species), but it also supplements this sweet food with immature leaves, flowers and insects (5). Pileated gibbons are active during the day, spending the nights and other periods of rest in tall trees (5). They live in small family groups which consist of a breeding pair and their offspring. Single offspring are born into the group every two to three years (5) (7), and leave the group around adolescence (5). Although these apes are monogamous, polygyny has been observed where the white-handed gibbon (Hylobates lar) occurs in the same area, with some groups containing females of both species (5). Like all other gibbon species, pileated gibbons reinforce bonds between individuals in the group by social grooming, with one individual grooming another (5). Dominated by the female, the bond between breeding pairs is reinforced through 'duets'. It is believed that these vocalizations are also necessary to establish and maintain the family groups' territory (5), which they also defend with displays and threats (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Known for their graceful and impressive method of locomotion, and their beautiful and complex duets, gibbons are spectacular to behold in the wild (3). Male pileated gibbons have short black hair with white hands, feet and brow band (3) (4), and there is a white circular streak around the crown cap on the sides of the head (4). Females range in colour from buffy to silvery-grey with a black chest, cheeks and cap (3) (4) and a white brow and facial ring (4). Infants of both sexes are similar in colour to the adult female, but slightly paler silvery-buff, making the pileated gibbon the only Hylobates species in which males undergo a colour change (4). Like other gibbons, the pileated gibbon has a slender body, long forearms and no tail (3) (5). A throat sac located beneath the chin enhances the spectacular calls which both male and female pileated gibbons make. The male calls with abrupt notes and a trill after the females call. The female call is much louder and distinctive and consists of rich short rising notes lasting around 18 seconds (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The range of this species includes southeastern Thailand, a portion of southwestern Lao PDR (west of the Mekong), and western Cambodia (west of the Mekong). In Thailand, the western limit may once have been the Bang Pakong River, extending north to Khao Yai National Park, east of the Lam Takhong watershed, and all forested areas east and south of the Moon River (Geissmann 1995; Groves 2001; Marshall and Sugardjito 1986). In Khao Yai, the limit is Khao Rom Mountain and the upper reaches of the Lam Takhong river on the north side (Brockelman 1975; Marshall et al. 1972).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The distribution of Hylobates pileatus once extended from south Thailand to west of the Mekong in Cambodia, but is now found only in southeast Thailand, extreme southwestern Laos, and northwestern Cambodia. Other than one zone of sympatry with Hylobates lar in Kao Yai National Park, Thailand, the current range of H. pileatus excludes all other gibbon species.

Biogeographic Regions: oriental (Native )

  • Brockelman, W., S. Srikosamatara. 1993. Estimation of Density of Gibbon Groups by Use of Loud Songs. American Journal of Primatology, 29: 93-108.
  • Geissman, T. 1995. Gibbon systematics and species identification. International Zoo News, 42(8): 467-501.
  • Geissman, T. 1991. Sympatry between White-handed Gibbons and Pileated Gibbons in Southeastern Thailand. Primates, 32(3): 357-363.
  • Groves, C. 1972. Systematics and phylogeny of gibbons. Pp. 1-89 in D Rumbaugh, A Chiarelli, eds. Gibbon and siamang: Evolution, ecology, behavior, and captive maintenance, Vol. 1. Basel: S. Karger.
  • Nowak, R., E. Walker. 1999. Walker's primates of the world. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The pileated gibbon is found in Cambodia, Laos and south-east Thailand (1) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pileated gibbons have slender torsos, long arms, no tail, and ischial callosities. Head-and-body length ranges from 450 to 640 mm, and weight ranges between 4 to 8 kg, with an average of 5.4 kg for females and 5.5 kg for males. Both sexes are born covered in light buff-colored fur, with black spots on the top of their head and chest appearing at 10 to 12 months of age. These black spots grow continuously until sexual maturity. Adult females have a large black patch from the top of the head to the groin on the ventral surface, which forms an inverted triangle. The rest of the body remains light gray or buff. The hair above the female’s ears is white, and is long enough to hang over the temples in characteristic “Dagwood tufts” by 7 years of age. Sub-adult and young-adult females have a white brow band that decreases with age, pregnancy, or decreasing physical condition. Adult males are almost completely black with a narrow white face ring and crown ring as well as white hands, feet, and a genital tuft. Male hands and feet also have a fringe of hair halfway up their sides. Some males have lightly grizzled silver hairs on their legs and lower back. As with most other species in the genus Hylobates, the hair on the ulnar side of the forearm grows in the direction of the elbow, while hair on the radial side grows in the direction of the wrist. Infant pileated gibbons have pink skin, which darkens with age and sun exposure, turning a light gray by adolescence and, eventually, a dark charcoal gray by the time they reach sexual maturity. Females often have adult pelage by 4 years, while males have adult pelage by 6.5 years. Both males and females have hairless facial areas and very dense fur elsewhere on their bodies. Neither sex has a laryngeal sac.

The teeth of Hylobates pileatus have a distinct cingulum (i.e., a shelf-like ridge around the outside of an upper molar) on the lingual side of the upper cheekteeth, a more lateral metaconid coupled with a more lingual hypoconid, and a comparatively large third molar. The skull morphology consists of a bowed zygomatic arch, downward pointing foramen magnum, and thick orbital rim. The dental formula of H. pileatus is 2/2, 1/1, 2/2, 3/3 = 32 and is common to all Hylobatidae.

Range mass: 4 to 8 kg.

Average mass: 5.4 to 5.5 kg.

Range length: 450 to 640 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Francis, C. 2008. A Guide to the Mammals of Southeast Asia. Princeton, New Jersey: Priceton University Press.
  • MacDonald, D. 2009. The Encyclopedia of Mammals. Oxford: Oxford University Press.
  • Mootnick, A. 2006. Gibbon (Hylobatidae) Species Identification Recommended for Rescue or Breeding Centers. Primate Conservation, 21: 103-138.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in moist, seasonal evergreen and mixed deciduous-evergreen forests and have been recorded to about 1,500 m in Cambodia, and to around 1,200 m in Thailand. This species is similar to H. lar in diet and general ecology, consuming mostly fruits, shoots, and some immature leaves, as well as insects (Srikosamatara 1980, 1984). Researchers find the species somewhat shyer and more elusive than H. lar (W. Brockelman pers. comm.).

Average group size in Thailand is four individuals (Brockelman and Poonjampa unpubl. data). There has been no long-term study of behavior and life history.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hylobates pileatus can be found in tropical deciduous monsoon forests, dense evergreens, and tall moist montane forests throughout southeast Asia. They prefer old-growth forests with dense evergreen cover and avoid areas with high disturbance, patchy cover, large stands of exotic trees, and trees standing taller than the primary canopy.

Range elevation: 1,500 (high) m.

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest

  • Marshall, Jr., J., B. Ross, S. Chantharojvong. 1972. The Species of Gibbons in Thailand. Journal of Mammalogy, 53(3): 479-486.
  • Phoonjampa, R., A. Koenig, W. Brockelman, C. Borries, G. Gale, J. Carroll, T. Savini. 2011. Pileated Gibbon Density in Relation to Habitat Characteristics and Post-Logging Forest Recovery. BIOTROPICA, 43(2): 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Occurs in semi deciduous monsoon forests and tropical evergreen forests (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pileated gibbons are mostly frugivorous, with 45% of their diet consisting of soft-skinned or hard-rinded fruit and 26% consisting of figs. Figs are found in large patches and can be fed on for a longer period of time than other fruits, which are more dispersed. Thus, travel and search time significantly decrease when feeding on figs as opposed to other fruits. An additional 13% of the pileated gibbon’s diet is from young leaves and 2% is from unopened leaf shoots. THey also consume insects (15% of total diet), eggs, and small vertebrates. Pileated gibbons budget more time for fruit consumption during morning and evening hours, while leaves and insects are consumed more in the middle of the day. This pattern of behavior may be to immediately restore energy lost during the previous night's sleep and prepare for energy loss the following night, as fruits are high in carbohydrates. Pileated gibbons prefer to eat while sitting on branches in the middle and upper canopies. Pileated gibbons require open water during during the dry season.

Animal Foods: insects

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As a frugivorous species that travels long distances within its home range, Hylobates pileatus is an probably important seed disperser for various tree species within its home range. Dispersal of seeds away from parent trees reduces seed predation and competition between emerging conspecifics. This increases both the probability of survival for the resulting young trees and local plant diversity. Individual seeds that pass through the pileated gibbon’s digestive tract are also more likely to germinate than those that do not. In addition to seed dispersal, 15% of H. pileatus's diet consists of insects, which may help reduce the abundance of insect pests. There is limited information on parasites specific to H. pileatus, however they are potential carriers of chagas disease (also known as American trypanosomiasis) which is caused by protists Trypanosoma cruzi and hepatitis B. They are also host to a number of different endoparasites, including flatworms and roundworms.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • McConkey, K., D. Chivers. 2007. Influence of gibbon ranging patterns on seed dispersal distance and deposition site in a Bornean forest. Journal of Tropical Ecology, 23: 269-275.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is no information regard major predators of Hylobates pileatus. However, large carnivorous species such as clouded leopards and pythons do exist throughout this species range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Hylobates pileatus couples announce their territories via a unique duet song. Females begin with a “great call,” and males joins midway through the great call with a series of shorter calls. The duet concludes with a single phrase of the males shorter call. The calling female also begins a locomotor display of brachiation and branch breaking during the song, sometimes accompanied by the male. The song pattern and tones of phrases used are unique to H. pileatus and are used as a conspecific identifier. Song bouts usually occur in the morning, with more recently established groups singing more often than older groups. Pileated gibbons sing least on rainy, cloudy, and windy days.

Communication Channels: visual ; acoustic

Other Communication Modes: duets ; choruses

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest-lived Hylobates pileatus in captivity survived 31 years. Little other information exists on the lifespan of H. pileatus.

Average lifespan

Status: captivity:
31 years.

Average lifespan

Sex: female

Status: captivity:
37.9 years.

Average lifespan

Sex: male

Status: captivity:
31.0 years.

Average lifespan

Status: captivity:
34.7 years.

Average lifespan

Sex: male

Status: captivity:
36.0 years.

Average lifespan

Status: wild:
25.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 38 years (captivity) Observations: One wild born specimen was still living at about 38 years of age (Richard Weigl 2005). There is also one longevity record of 39 years (Lindenfors 2002), but this has not been confirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

All gibbons, including pileated gibbons, are monogamous and form small family groups consisting of a mating pair and young offspring. These groups occupy and defend a constant home range. At any one time, a single family group usually consists of one mating pair and two offspring of staggered ages, which eventually leave as additional offspring are born.

Mating System: monogamous

The testes of male pileated gibbons descend late in the juvenile period, as is common with most species of Hylobates. Pileated gibbon males have the shortest bacula of all Hylobates. Females reach sexual maturity at around 7.5 years of age, and males reach sexual maturity between 5 and 8 years of age. Captive pileated gibbons have reached sexual maturity earlier in both sexes, which may be due to stress, increased resource abundance, or a number of other factors.

The estrous cycle of female pileated gibbons averages 27 to 30 days with a 4 to 5 day menstruation. Average gestation lasts 6 to 7.5 months. Like most other gibbons they produce one offspring per reproductive cycle, and most young are weaned between 1 and 2 years old. Infants stay with the mother until about age 2, when they begin to move around independently. There is no known breeding season for members of the genus Hylobates.

Breeding interval: Pileated gibbons have one offspring every reproductive cycle.

Breeding season: Pileated gibbons breed year round.

Average number of offspring: 1.

Range gestation period: 193 to 225 days.

Range weaning age: 12 to 24 months.

Range time to independence: 2 to 4 years.

Average age at sexual or reproductive maturity (female): 7.5 years.

Range age at sexual or reproductive maturity (male): 5 to 8 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Pileated gibbon are weaned between 1 and 2 years after birth, and infants remain with their mother until about 2 years old. As with other gibbons, juvenile pileated gibbons remain with their family group and feed within the group's home range until sexually mature. Parents increase antagonism towards sub-adult offspring and prohibit them from mating in an effort to drive them from the group and territory. The age at which a sub-adult is driven out may depend on the size of the family group and resource availability. Little is known of paternal care in pileated gibbons.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Brockelman, W., T. Geissmann, T. Timmins, C. Traeholt. 2008. "Hylobates pileatus. In: IUCN 2010." (On-line). IUCN Red List of Threatened Species. Accessed March 14, 2011 at http://www.iucnredlist.org/apps/redlist/details/10552/0.
  • Chivers, D. 1979. The Siamang and the Gibbon in the Malay Peninsula. Pp. 285-315 in R Sussman, ed. Primate Ecology: Problem-oriented Field Studies. New York: John Wiley & Sons.
  • Geissman, T. 1991. Reassessment of Age of Sexual Maturity in Gibbons (Hylobates spp.). American Journal of Primatology, 23: 11-22.
  • Groves, C. 1972. Systematics and phylogeny of gibbons. Pp. 1-89 in D Rumbaugh, A Chiarelli, eds. Gibbon and siamang: Evolution, ecology, behavior, and captive maintenance, Vol. 1. Basel: S. Karger.
  • Humphrey, S., J. Bain. 1990. Endangered animals of Thailand. Gainesville, FL, USA: Sandhill Crane Press.
  • King, N., G. Mitchell. 1987. Breeding Primates in Zoos. Pp. 219-261 in G Mitchell, J Erwin, eds. Comparative Primate Biology: Behavior, Cognition, and Motivation, Vol. 2B. New York: Alan R. Liss.
  • Marshall, Jr., J., B. Ross, S. Chantharojvong. 1972. The Species of Gibbons in Thailand. Journal of Mammalogy, 53(3): 479-486.
  • Nowak, R., E. Walker. 1999. Walker's primates of the world. Baltimore: Johns Hopkins University Press.
  • Srikosamatara, S. 1984. Ecology of Pileated Gibbons in South-East Thailand. Pp. 242-257 in H Preuschoft, ed. The Lesser Apes: Evolutionary and Behavioural Biology. Edinburgh: Edinburgh University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hylobates pileatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2880-10|NC_014045|Hylobates pileatus| GACCGCTGGTTATTCTCCACAAACCATAAAGATATTGGAACACTATACTTACTATTTGGCGCATGAGCCGGAGTCCTAGGCACGGCCCTA---AGCCTCCTCATTCGAGCTGAGCTAGGTCAACCCGGCAATCTCCTGGGCAAT---GACCATATCTACAACGTCATCGTAACAGCCCATGCATTCGTCATAATCTTCTTCATAGTAATACCCATCATAATTGGGGGCTTTGGCAACTGGCTCGTCCCTCTGATA---ATCGGTGCCCCCGATATGGCATTCCCCCGTATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCCTTCCTACTACTGCTTGCCTCCGCCATGGTAGAAGCCGGCGCCGGAACAGGGTGGACGGTCTACCCTCCACTGGCGGGAAACTACTCTCACCCAGGAGCCTCCGTTGACCTA---ACCATTTTTTCTCTACACCTAGCCGGAGTATCATCCATCCTAGGGGCTATTAACTTCATTACCACAATCATCAACATAAAACCCCCAGCCATGTCCCAATATCAAACACCCCTCTTTGTTTGATCCGTCCTAATCACAGCCGTCCTACTCCTCCTCTCCCTACCAGTCCTGGCCGCC---GGCATTACCATGCTACTAACAGACCGCAACCTCAACACTACTTTCTTTGACCCCGCTGGAGGGGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTTGGCCACCCCGAAGTTTACATTCTCATCCTACCAGGCTTCGGAATAATCTCACACATCGTAACACACTACTCAGGAAAAAAA---GAACCATTCGGATACATAGGCATAGTCTGAGCTATAATATCAATTGGCTTCCTAGGCTTCATTGTCTGAGCCCACCATATATTCACAGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hylobates pileatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Brockelman, W., Geissmann, T., Timmins, T. & Traeholt, C.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species is listed as Endangered as it is believed to be experiencing a decline of more than 50% incorporating a time frame of three generations (45 years) for the period 1970-2015, due to rampant forest loss and loss of mature individuals due to hunting.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

All gibbons are threatened by hunting and habitat destruction. Hylobates pileatus is listed as an endangered on the IUCN's Red List of Threatened Species, with an estimated population of 65,000 individuals in Thailand and Cambodia, combined. Slash-and-burn agriculture in Thailand has destroyed forest habitats, and hunting pileated gibbons for sustenance is still practiced. In Cambodia, deforestation continues to reduce available land habitable by H. pileatus. The habitat of H. pileatus is not only becoming reduced in overall area, but is also becoming fragmented, separating populations ecologically and reproductively. These small, fragmented patches of land have low prospects for population maintenance. Although many areas currently inhabited by H. pileatus are protected, enforcement of conservation based laws is weak and numbers continue to decrease as a result.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1) and listed on Appendix I of CITES (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Cambodia, the primary area of importance is the Cardamom Mountains, in the south-western part which is relatively intact, where densities are on the order of 1-2 groups/km2, with an estimated 20,000 individuals (Traeholt et al. 2005). Populations in the north, where the habitat is similar but more open, with a very small percentage of evergreen forest, are smaller. Bokor National Park in southwestern Cambodia has an estimated 1,000 groups and is likely to be isolated from the remainder of the range (Traeholt et al. 2005). Pileated gibbons might number more than 35,000 individuals in Cambodia in total (Traeholt et al. 2005).

In Lao PDR the population is significantly smaller, mainly since it comprises a smaller part of the range (Duckworth et al. 1999).

In Thailand, there are an estimated 12,000 individuals (3,000 breeding groups) surviving in the four largest forest areas including five major protected areas (Khao Yai National Park, Thap Lan National Park, Khao Ang Ru Nai Sanctuary and Khao Soi Dao Sanctuary), based on an auditory census in 2004–2005, plus around 1,000 to 2,000 individuals in 15 other scattered and highly fragmented smaller protected areas (Phoonjampa and Brockelman unpub. data). Population densities are generally low, averaging close to one group (average 4 individuals)/km2, with pockets of higher density populations in some remote mountain areas (Brockelman and Srikosamatara 1993). An earlier study generated a total population estimate of 30,000 pileated gibbons for Thailand (Tunhikorn et al. 1994).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is threatened by both hunting, primarily for subsistence, and severe habitat fragmentation and degradation (Duckworth et al. 1999; Traeholt et al. 2005). In Thailand all populations are now within protected conservation areas and the era of logging and slash-and-burn agriculture (Brockelman 1983) is now mostly over. Nevertheless, severe encroachment has occurred in eastern Khao Yai Park and other major protected areas, and subsistence hunting by minor forest product collectors is still uncontrolled (Phoonjampa and Brockelman unpubl. data). In Cambodia, however, habitat destruction is a more immediate threat than poaching, especially in remote areas. Most populations are not yet secured in protected areas, and the main threats are habitat loss due to logging, agricultural conversion, hydroelectric development, and new human settlements (W. Brockelman pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The pileated gibbon has undergone a population decline since deforestation began in Southeast Asia (3) (8), and it is thought that the species is near extinction over large parts of its range (3). The additional pressure of hunting, for both food and for the pet trade, is adding to the problem (8). It is thought that up to ten animals will have died during capture or transit for every baby gibbon sold as a pet (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed in CITES Appendix I. In Cambodia the major stronghold is three contiguous protected areas, including Samkos and Aural Wildlife Sanctuaries, and the Central Cardamom Protected Forest. This last area contains about 3,350 km2 of gibbon habitat and a population of nearly 7,000 groups. This potentially could ensure the long-term survival of the species if effectively managed. The Cambodian Forestry Administration in collaboration with Conservation International is developing a management plan for this area, and ranger units have been established to stop illegal poaching and logging. Gibbons also occur in Bokor National Park (1,220 km2 of habitat), which is generally well managed. As in Thailand, numerous smaller fragmented areas also contain pileated gibbons, most with low long-term prospects. In Cambodia there is a need to strengthen protected area administration and protection activities, and to halt logging and development activities in important conservation areas (Brockelman pers comm.; Traeholt et al. 2005).

In southeast Thailand, all populations are included within protected areas, but more effort needs to be made to change the behavior of local villagers who hunt. The largest protected forest areas are the Tab Lan National Park, Pang Sida National Park, Ta Phraya National Park, Khao Ang Ru Nai Sanctuary, and Khao Soi Dao Sanctuary, totaling greater than 3,000 km2 of forest habitat in three blocks (Phoonjampa and Brockelman unpubl. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The pileated gibbon is protected from international trade by its listing on Appendix I of the Convention on International trade in endangered Species (CITES) (2). The World Association of Zoos and Aquariums (WAZA) established an International Studbook in 1990 for the pileated gibbon, and conservation breeding programmes were set up to ensure there is a viable reserve population (9). The Cardomom Project was set up with Fauna & Flora International (FFI) to preserve the Cardomom Mountains region in south west Cambodia to protect both the habitat from destruction and the wildlife from hunters. It is hoped that species such as the pileated gibbon will benefit from the work carried out by this project (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Pileated gibbons are naturally susceptible to a hepatitis B virus similar to that which affects humans. It has been postulated that this disease could be transferred to humans, although there have been no such reports thus far.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hylobates pileatus is hunted by humans for food and captured for the pet trade throughout their range. Analysis of the hepatitis B virus that occurs in wild H. pileatus populations can help with further understanding human-associated hepatitis B, its possible origins, and its host-virus interactions in terms of infection and disease.

Positive Impacts: pet trade ; food ; research and education

  • Aiba, N., H. Nishimura, Y. Arakawa, K. Abe. 2003. Complete Nucleotide Sequence and Phylogenetic Analysis of Hepatitis B Virus Isolated from Two Pileated Gibbons. Virus Genes, 27:3: 219-226.
  • Burton, J., V. Burton. 1988. Collins guide to the rare mammals of the world. Lexington, Massachusetts: S. Greene Press.
  • Sall, A., S. Starkman, J. Reynes, S. Lay, T. Nhim, M. Hunt, N. Marx, P. Simmonds. 2005. Frequent infection of Hylobates pileatus (pileated gibbon) with species-associated variants of hepatitis B virus in Cambodia. Journal of General Virology, 86: 333-337.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pileated gibbon

The pileated gibbon (Hylobates pileatus) is a primate in the Hylobatidae or gibbon family.

The pileated gibbon has sexual dimorphism in fur coloration: males have a purely black fur, while the females have a white-grey colored fur with only the belly and head black. The white and often shaggy hair ring around the head is common to both sexes.

The range of the pileated gibbon is eastern Thailand, western Cambodia and southwest Laos. Its lifestyle is much like other gibbons: diurnal and arboreal, it lives together in a monogamous pair, brachiates through the trees with its long arms, and predominantly eats fruits, leaves and small animals. Reproduction habits are not well known, but are presumed to be similar to the other gibbons.

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 180. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Brockelman, W., Geissmann, T., Timmins, T. & Traeholt, C. (2008). Hylobates pileatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!