Overview

Brief Summary

Biology

Unlike other hare-wallabies, this species is sociable, often congregating in small groups. During the day, these groups shelter in 'runs' formed beneath dense scrub, and emerge only at night to feed on grasses and shrubs, usually in open areas with scattered shelter (2) (5) (6). Adults of each sex appear to live in well-defined home ranges or territories, and interactions between males are characterised by high levels of aggression, thought to be related to competition for food (2). Although sexual maturity is reached at one year of age, breeding does not usually take place until the second year (5). Young may be born anywhere between December and September, after a gestation that appears to last several months (2) (5). Females usually raise one young each year, although it is possible to produce two young in a season (5). Young spend about six months in their mother's pouch and are weaned around three months later (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The banded hare-wallaby is the only survivor of a group of at least 20 'short faced kangaroos' (subfamily Sthenurinae) that once existed across Australia. However, the distinctive transverse dark stripes on the lower back of this grey-furred wallaby, for which the species gets its common name, led to its original (erroneous) description in 1699 as 'a sort of raccoon' (4). The thick shaggy grizzled grey fur is otherwise speckled with yellow and silver, and shades to pale grey on the underbelly (4) (5). Of the two subspecies, L. f. albipilis is more reddish in colour with less pronounced stripes and a bigger hair crest on the head. The snouts of both are normally hairless and short (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to Australia, where it was formerly present on the mainland from south-western parts of the country to the lower Murray River region. It is now restricted to the offshore Bernier and Dorre Islands in Shark Bay, Western Australia (Prince and Richards 2008). A small population was recently reintroduced to Faure Island (Prince and Richards 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Lagostrophus fasciatus is found only on Dorre Island and Bernier Island in Shark Bay, 50-60 km west of the Australian mainland. On Dorre Island, the population is concentrated in the north, while on Bernier Island it is further south. The population on Dorre Island is less dense than Bernier Island. Historically, members of this species also lived on the mainland of southwestern Australia. The last recorded individual on the mainland was seen in 1906. Fossils of L. fasciatus have been found on Dirk Hartog Island, south of their current location. Current attempts are underway to reintroduce this species to the western Australian mainland. Attempts to re-introduce L. fasciatus to Dirk Hartog island failed, possibly as a result of predation by feral cats.

Biogeographic Regions: australian (Native )

Other Geographic Terms: island endemic

  • Helgen, K., T. Flannery. 2003. Taxonomy and hisorical distribution of the wallaby genus Lagostrophus . Australian Journal of Zoology, 51: 199-212.
  • Prince, R. 1983. Banded Hare-Wallaby. Pp. 201-202 in R Strahan, ed. The Australian Museum complete book of Australian mammals: the National Photographic Index of Australian Wildlife. London: Angus and Robertson.
  • Richards, J., J. Short, R. Prince, J. Friend, J. Courtenay. 2001. The biology of banded (Lagostrophus fasciatus) and rufous (Lagorchestes hirsutus) hare-wallabies (Diprotodontia: Macropodidae) on Dorre and Bernier Islands, Western Australia. Wildlife Research, 28: 311-322.
  • Short, J., B. Turner. 1992. The distribution and abundance of the banded and rufous hare-wallabies Lagostrophus fasciatus and Lagorchestes hirstus . Biological Conservation, 60: 157-166.
  • Tyndale-Biscoe, C. 1965. The Female Urogenital System and Reproduction of the Marsupial Lagostrophus fasciatus . Australian Journal of Zoology, 13: 255-267.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The banded hare-wallaby was formerly found across south-western Australia, but now remains only on the islands of Dorre and Bernier in Shark Bay, 50 to 60 kilometres off Western Australia, having last been recorded on the mainland in 1906 (6) (7). This species also occurred historically on Dirk Hartog Island, south of Dorre Island and Bernier Island, but is thought to have died out there in the 1920s, and reintroduction attempts have so far been unsuccessful (6) (7). A small, introduced population now occurs on Faure Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The head-body length of Lagostrophus fasciatus is usually 400-450 mm. Tail length ranges from 350-400 mm, and tail diameter from 13-21 mm. The distance from the knee to the foot on the hind limb ranges from 96-146 mm and the pes length from 94-121 mm. The weight varies from 1.3-3 kg, although most specimens weigh under 2 kg. The fur is thick, shaggy, long, and gray with a few yellow and silver splotches. Lagostrophus fasciatus is marked by transverse black stripes along the lower back. Ventrally the fur has a grayish-white color. The face is gray and the flanks have a reddish tint. The snouts are normally hairless and short. Canines are absent. The sexes are not dimorphic in color or size. The fifth metatarsal is partially ventral to the fourth and is cylindrical in shape. The metabolic rate is unknown. Two subspecies exist: Lagostrophus fasciatus fasciatus and Lagostrophus fasciatus baudinettei. The latter is more reddish in color with less pronounced stripes and a bigger hair crest on the head. It may also have a shorter tail.

The skull of this species has interorbital ridges that are almost parallel, a moderately large zygomatic arch, and a mandibular condyle that is lengthened transversely. On the upper jaw, the first incisor is larger than the third incisor, which is larger than the second incisor. The lower incisors line up below the upper incisors instead of lying behind the upper incisors. The crown of the first upper incisor is not completely surrounded by enamel. Additionally, the second and third upper premolars are L-shaped. The lower premolars have a broad anterior cingulum.

Male scrotal width for Lagostrophus fasciatus ranges from 13-31 mm.

Range mass: 1.3 to 3 kg.

Range length: 350 to 400 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Flannery, T. 1983. Revision in the macropodid subfamily Sthenurinae (Marsupialia: Macropodoidea) and the relationships of the species of Troposodon and Lagostrophus.. Australian Mammalogy, 6: 15-28.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in areas of dense scrub and bushes, beneath which it forms runs and shelters (Prince and Richards 2008).
Females generally give birth annually to a single young (Richards et al. 2001). Males and females can reach sexual maturity within their first year, but typically not until the second year (Prince and Richards 2008). In the wild, Banded Hare Wallabies can live at least six years (Prince and Richards 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lagostrophus fasciatus usually lives in woodlands with thick, dense shrubs, which it uses for shelter during the day. Many of the shrubs are of the species Acacia ligulata. Additionally, banded hare-wallabies form runs under the shrubs. The islands on which they live are of a Mediterranean climate, warm with moderate rainfall and distinct wet and dry seasons.

Habitat Regions: temperate

Terrestrial Biomes: scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

On the mainland the banded hare-wallaby inhabited prickly thickets on the flats and the edges of swamps (7). On the islands, the species lives in woodlands with thick, dense shrubs, particularly those dominated by thorny Acacia ligulata scrub, being dependent upon these dense thickets for shelter (4) (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Banded hare wallabies mainly browse or occasionally graze on foliage and grasses. Individuals accumulate in areas with high densities of Acacia ligulata, A. coriacea, Heterodendrum oleifolium, and Diplolaena dampieri, using them as the main sources of food. They are also sometimes found grazing in Triodia grasslands. For hydration, individuals use dew and water from their food.

Plant Foods: leaves; wood, bark, or stems; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This species is an herbivore that may impact its communities by grazing and browsing. Competition between banded hare wallabies and similar rufous hare-wallabies (Lagorchestes hirsutus) is low due to different habitat preferences and differences in skull and teeth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Wedge-tailed eagles (Aquila audax) and other raptors are known predators of Lagostrophus fasciatus. Red foxes probably preyed on this species when it occurred on the Australian mainland. Feral cats (Felis silvestris may also prey on these small wallabies. Slow breeding and spending time in open areas during the day makes these wallabies especially vulnerable to predation.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Banded hare wallabies, like other kangaroos and wallabies, use their keen vision and senses of smell, touch, and hearing to perceive their environment. Communication between conspecifics is poorly understood, but it is likely that they use chemical and visual cues.

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Lagostrophus fasciatus can live up to six years.

Range lifespan

Status: wild:
6 (high) years.

Typical lifespan

Status: wild:
5 to 6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild these animals live about 4 years (Bernhard Grzimek 1990), maybe longer. One captive specimen lived for 6.7 years (Richard Weigl 2005), but further studies are necessary to estimate the maximum longevity of this species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The number of partners and size groups formed by Lagostrophus fasciatus in mating are unknown. Methods for finding, attracting, and defending mates are unknown as well.

Breeding females normally conceive one offspring at a time. Breeding is seasonal, beginning in the summer and peaking in autumn. However, breeding seasons are extended and may occur from February through August. Drought may change breeding patterns by delaying breeding. While most females produce only one offspring per year, some produce two. Breeding can occur as early as the end of a female’s first year and the beginning of a male’s second year. However, most individuals do not mate until the age of two. The time of weaning is normally three months. Offspring are independent after nine to ten months. The gestation period is unknown. A female gives birth and may mate immediately afterwards. The blastocyst from the second mating then undergoes a period of quiescence until the nursing young is weaned (embryonic diapause).

Breeding interval: Lagostophus fasciatus usually breeds once a year.

Breeding season: Breeding peaks in the fall.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average weaning age: 3 months.

Range time to independence: 9 to 10 months.

Average time to independence: 9 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; embryonic diapause ; post-partum estrous

Average number of offspring: 1.

Female Lagostrophus fasciatus keep offspring in their pouch for six months. Normally, the mother carries one young in the pouch at a time.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Prince, R. 1983. Banded Hare-Wallaby. Pp. 201-202 in R Strahan, ed. The Australian Museum complete book of Australian mammals: the National Photographic Index of Australian Wildlife. London: Angus and Robertson.
  • Richards, J., J. Short, R. Prince, J. Friend, J. Courtenay. 2001. The biology of banded (Lagostrophus fasciatus) and rufous (Lagorchestes hirsutus) hare-wallabies (Diprotodontia: Macropodidae) on Dorre and Bernier Islands, Western Australia. Wildlife Research, 28: 311-322.
  • Tyndale-Biscoe, C. 1965. The Female Urogenital System and Reproduction of the Marsupial Lagostrophus fasciatus . Australian Journal of Zoology, 13: 255-267.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagostrophus fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0703-06|NC_008447|Lagostrophus fasciatus| AACCGTTGATTATTTTCGACTAACCACAAAGACATTGGCACTCTATATCTACTATTTGGCGCCTGAGCAGGAATAGTAGGCACCGCCCTA---AGCTTATTAATTCGCGCAGAACTCGGTCAACCCGGTACTCTAATCGGGGAT---GATCAAATTTATAATGTCATTGTCACTGCTCATGCTTTTGTGATAATCTTCTTCATGGTAATGCCTATCATAATTGGAGGCTTTGGCAATTGACTGGTACCATTAATA---ATTGGAGCTCCCGACATGGCATTCCCTCGAATGAACAACATAAGCTTTTGACTCCTGCCACCATCTTTTCTTCTATTACTAGCCTCCTCAACAGTAGAGGCCGGTGCAGGGACTGGGTGGACAGTCTACCCACCATTAGCCGGAAACCTAGCCCACGCAGGTGCTTCTGTAGACCTA---GCAATTTTCTCCCTTCATTTAGCTGGAATTTCATCTATCCTAGGGGCTATTAATTTTATTACCACCATCATTAATATAAAACCCCCTGCCCTCTCCCAATACCAAACCCCATTATTCGTTTGATCTGTAATAATTACAGCAGTTCTCTTGCTTCTTTCACTACCAGTCCTAGCCGCT---GGCATTACAATACTTTTAACAGATCGTAACTTAAACACGACATTCTTCGACCCTGCCGGAGGAGGAGACCCTATTTTGTACCAGCACCTATTCTGATTTTTTGGTCACCCAGAAGTTTACATTCTGATTCTCCCAGGATTTGGCATAATCTCTCATATCGTAACCTACTACTCAGGTAAAAAA---GAGCCTTTCGGTTATATAGGCATAGTCTGGGCTATGATATCTATTGGGTTCCTAGGCTTTATTGTTTGAGCCCACCATATATTCACAGTCGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lagostrophus fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ac(iv)+2ac(iv)

Version
3.1

Year Assessed
2008

Assessor/s
Richards, J., Morris, K., Burbidge, A. & Friend, T.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Endangered in view of its extent of occurrence of less than 5,000 km2 and area of occupancy of less than 500 km2, with all individuals in fewer than six locations, and extreme fluctuations in the number of mature individuals due to periods of severe drought. Additional potential threats that are major include: the accidental introduction of predators (introduced cats and foxes), extensive fire, and disease.

History
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Rare
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lagostrophus fasciatus is considered vulnerable by ANZECC and the IUCN. Human clearing of land for agriculture, competition with introduced sheep and rabbits, and predation by introduced predators are likely to have caused extinction on the Australian mainland.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Lagostrophus fasciatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3). Subspecies: Lagostrophus fasciatus fasciatus is classified as Vulnerable (VU) and Lagostrophus fasciatus albipilis is classified as Extinct (EX) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no recent population estimates for this species. Surveys in 1988/89 indicated a total population of about 7,700 animals, equally divided between the two islands (Short and Turner 1992), and 9,700 in 1991/92 (Short et al. 1997). It is a reasonably long lived species. The population fluctuates with rainfall. Two recent translocation attempts to the mainland failed due to cat predation and drought (Prince and Richards 2008). A small population was recently reintroduced to Faure Island, and it is showing signs of success (Prince and Richards 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The current major threats to the populations of the species include: the accidental introduction of predators (introduced cats and foxes), fire, and disease (Richards 2005). Introduced rats and mice are also a concern, but to a lesser degree than introduced predators. Extreme fluctuations in populations on islands are a threat, but this threat is seen as minor relative to the risk exotic predators being introduced (Short et al. 1997). With weather events becoming ever more unpredictable and all locations for the species being located in Shark Bay, these fluctuations are a cause for concern. The species presumably was extirpated from mainland Australia by a combination of habitat loss and predation by introduced feral cats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The disappearance of the banded hare-wallaby on the Australian mainland is thought to be the combined result of clearing of vegetation for agriculture, competition for food with introduced sheep and rabbits, and predation by introduced predators such as cats (6) (7). Although these factors have caused a dramatic decline in numbers of the banded hare-wallaby, causing their extinction on the mainland, those that remain on the uninhabited islands of Dorre and Bernier thankfully remain relatively secure (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed as a threatened species under Australian law. Bernier and Dorre Islands are both protected areas, as are all the areas where the species has been reintroduced. Regular monitoring of populations is needed (annually or biannually). It is listed on CITES Appendix I.

A recovery plan for the species has been developed for the 2005-2010 period (Richards 2005). Recommendations in this plan include: protect wild populations and their habitat so that the species does not fall below the level of natural fluctuations; maintain captive populations; use of population viability analysis to compare the viability of wild, current and potential reintroduced populations, and; enhance community participation and education. The recovery plan also recommends initiating three reintroductions to the mainland within a five year period (2005-2010) (Richards 2005). Some of these, like the reintroduction to Arid Recovery, should be established "in different regions where climatic fluctuations may be out of synchrony" (Short et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Unfortunately, attempts made to reintroduce this species to Dirk Hartog Island in the 1970s and to Peron Peninsula at Shark Bay in 2001, failed. Cat predation played an important part in these failures, as well as intensive browsing by sheep and goats, and a period of drought over the summer of 1979/80 on Dirk Hartog, resulting in the loss of 30 to 40 percent of the Acacia shrub cover. Captive populations are currently held at the Peron Captive Breeding Facility and the Dryandra Captive Breeding Facility, though the latter has experienced problems with aerial predation by the wedge-tailed eagle (8). At last, in 2003 and 2004, banded hare-wallabies from Peron Captive Breeding Facility and the Shark Bay Islands were successfully reintroduced to Faure Island, after the removal of goats from the island (8) (9). This population is now thriving and represents a remarkable victory for conservation. Banded hare-wallabies have been so successful in adapting to their new environment that they bred in the first year after release, providing fresh hope for the long-term survival of this relic species of 'short faced kangaroo' (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Banded hare wallabies currently live on uninhabited islands, so they have little interaction with humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Banded hare wallabies currently live on uninhabited islands, so they have little interaction with humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Banded hare-wallaby

The banded hare-wallaby or mernine (Lagostrophus fasciatus) is a marsupial that is currently found on the Islands of Bernier and Dorre off western Australia. A small population has recently been established on Faure Island and it appears to have been successful. Evidence suggested[4] that the mernine was the only living member of the Sthenurine subfamily, and a recent osteology-based phylogeny of Macropodids found that the banded hare-wallaby was indeed a bastion of an ancient lineage, agreeing with other (molecular) appraisals of the evolutionary history of L. fasciatus.[3] However, the authors analysis did not support the placement of the mernine within Sthenurinae, but suggest it belongs to a plesiomorphic clade which branched off from other Macropodids in the early Miocene and put forward the new subfamily Lagostrophinae.[3] This new subfamily includes the banded hare-wallaby and the fossil genus Troposodon.[3]

Contents

Behavior

The banded hare-wallaby is nocturnal and tends to live in groups at nesting sites; this species is quite social. Nesting occurs in thickets under very dense brush. This macropod prefers to live in Acacia ligulata scrub. Males are extremely aggressive. The average banded hare-wallaby weighs 1.7 kg, with females weighing more than males. It measures about 800mm from the head to the end of the tail, with the tail almost the same length (averaging 375mm) as the body. The banded hare-wallaby has a short nose. Long, grey fur is speckled with yellow and silver and fades into a light grey on the underbelly. There is no color variation on the face or head, the coloring is solid grey. Dark, horizontal stripes of fur start at the middle of the back and stop at the base of the tail.

Distribution

The species were once found on the mainland, in the southwest of Western Australia and South Australia, but they are now restricted in their distribution to Bernier Island and Dorre Island in Western Australia.[1] Although the banded hare-wallaby was once found across the south-western portion of Australia, it is believed to have been extinct on the mainland since 1963, and the last recorded evidence of the banded hare-wallaby on the Australian mainland was in 1906. It is possible that the devastation of the species can be attributed to the loss of habitat to the clearing of vegetation, the loss of food (due to competition with other animals), and predators.

Diversity

Two subspecies are recognized.[1]

Feeding

This diprotodontian is a vegetarian and receives most of its water from food. This species prefers to eat various grasses, fruit, and other vegetation. Male aggression is usually brought out in competition for food with other males and is very rarely expressed toward females.

Reproduction

Mating season starts in December and ends in September. The banded hare-wallaby reaches maturity at one year of age, breeding usually starts in the second year. Gestation appears to last several months and mothers generally raise one young each year, although it is possible for females to produce two young per year. Young remain in their mother's pouch for six months and continue to be weaned for another three months. In situations where a mother's young dies, some mothers have an extra embryo to possibly rear another.

References

  1. ^ a b c Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 59. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Richards, J., Morris, K., Burbidge, A. & Friend, T. (2008). Lagostrophus fasciatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as endangered
  3. ^ a b c d Prideaux, G. J. and Warburton, N. M. (2010), 'An osteology-based appraisal of the phylogeny and evolution of kangaroos and wallabies (Macropodidae: Marsupialia)', Zoological Journal of the Linnean Society, 159 (4), 954–87. http://dx.doi.org/10.1111/j.1096-3642.2009.00607.x
  4. '^ Flannery, T. F. (1983), 'Revision in the subfamily Sthenurinae (Marsupialia: Macropodoidea) and the relationships of the species of Troposodon and Lagostrophus, Australian Mammalogy, 6 (1), 15–28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!