Overview

Comprehensive Description

Description

Cairo spiny mouse vary in size from small to medium. Fur spiny extending from behind the shoulder onto rump but not present on the side. Body color varies from pale to dark brownish cinnamon on the upperparts. Head dark. Underparts and feet white. Suborbital region small and white. Snout pointed. Ears large, erect, pigmented, with white basal and posterior patches and covered with whitish hairs. Eyes prominent and bright. Tail as long as the head and body length, hairless and scaly. Tail color grayish on the dorsal side and buff on the ventral side.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Cairo spiny mice are found throughout northern African, from the western Sahara in Mauritania and Morocco east to Egypt, Ethiopia, Eritrea, and Sudan.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Endemic to Africa. Known from Western Sahara, Mauritania, Morocco, Algeria, Libya, Egypt (including Sinai), Sudan, Eritrea, Djibouti and Ethiopia. Limits in C and S Sudan, and in Ethiopia are uncertain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs north of the Niger River in southern Mauritania, Mali, Niger, and possibly in Chad, Western Sahara and southernmost parts of Algeria. It has an altitudinal range of not higher than 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread (Nile Valley, Delta, Eastern Desert, oases, Gebel Uweinat).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cairo spiny mice are defined by gray-brown to sandy colored, spiny hairs that cover their backs. These hairs resemble the spines of hedgehogs. The underside of these mice is characteristically white while the upper body is brown, grey, or beige colored. These mice have a body length of 7 to 17 cm, weigh between 30 and 70 g. They are characterized by a scaly, hairless tail that varies in length from 5 to 12 cm.

Range mass: 30 to 70 g.

Range length: 7 to 17 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Body length: 75–138 mm. Tail length: 85–138 mm. Weight: 21–64 gm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Cairo spiny mice tend to live in arid, rocky habitats, such as rocky canyons, near cliffs, or near human habitation where they use crevices in buildings. They may also be found in gravelly washes, but are not generally found in sandy areas. They are found mostly on the ground and in burrows, but they occasionally climb. Generally, these spiny mice avoid altitudes above 1500 meters.

Range elevation: 1500 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is found mainly in rocky areas (Jebels), cliffs, and rocky canyons; not in sandy desert areas (although may sometimes be found in sandy habitats with date palms). Also found in gravel plains with low shrubs in the Sahel. Some populations are commensal, occupying crevices in buildings.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found mostly in rocky habitats, but also regularly in gardens and other human-related habitats, including homes (huts). One individual was found in a completely sandy habitat on the inner delta of the Niger River. All members of the genus are insectivorous unlike other rodents which are generally granivorous.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cairo spiny mouse inhabits in rocky arid regions, desert gardens, settlements, huts and houses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cairo spiny mice are omnivorous and opportunistic, eating seeds, fruits, dried plants, spiders, small insects, and even snails. This species has also been known to feed on dried Egyptian mummies. In populations that live in close contact with humans, they are known to feed on grains, stored food, and human crops.

Animal Foods: carrion ; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cairo spiny mice serve as a food source for Vulpes cana. They also are parasitized by ticks and fleas that are carriers for diseases such as typhus, Salmonella food poisoning and spotted fever.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main predators of Cairo spiny mice are Blanford's foxes (Vulpes cana). In order to avoid this predator, Acomys cahirinus uses chemical signals to communicate with other mice in their group to warn them that danger is near. Though there are no published accounts of other predators, it is likely that the Egyptian spiny mouse are preyed on by a variety of species, such as nocturnal raptors and snakes.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Cairo spiny mice seem to use chemical signals in order to communicate with each other to warn others of dangerous predators; however, there is little information regarding specific chemicals produced by this species. This species most likely also perceives the environment through their other visual, tactile and acoustic senses.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Nocturnal animal. Omnivorous, feeding on snails, insects, spiders, scorpions and sometimes on various plant parts. Lives in social groups. Cairo spiny mouse drinks large quantities of water because of high evaporation rate through skin and can survive without food or water for three to nine days, but cannot tolerate cold weather. The tail and large patches of dorsal skin come off easily when handled, an anti-predator device. Cairo spiny mouse breed throughout the year with peak in breeding activity from February to July. Female gives birth to litters of one to five young after a gestation period of around 42 days. The young are weaned after two weeks and reaches sexual maturity after two or three months. Cairo spiny mouse can live for three years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In captivity, Cairo spiny mice live up to 4 years. No information is currently available for the lifespan of this species in the wild.

Range lifespan

Status: captivity:
4 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.9 years (captivity) Observations: In captivity, average longevity is about 3 years. Older mothers have larger litters (Ronald Nowak 1999). One captive specimen lived at least 5.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little specific information on the mating system of Cairo spiny mice in the literature. However, social groups seem to be made up of a dominant male and a group of females, suggesting polgyny. Females have help from conspecifics in raising their young.

Mating System: polygynous ; cooperative breeder

The main breeding season of Cairo spiny mice is between September and January, while females are reproductively inactive from February through to August. However, other sources suggest that breeding may occur year-round. The main breeding season corresponds with the onset of the rainy season, which generally begins around September and ends in April. The increase in rain and food availability is perhaps the most important factor for reproduction in female Cairo spiny mice. This species reaches sexual maturity in about 2 months. Acomys cahirinus have a gestation period of 5 to 6 weeks, about 2 weeks longer than typical in similarly sized mice, which means that the young are extremely well developed at birth. Since they live in small groups (see Behavior below), during the birthing process, females tend to help each other by chewing through the umbilical cord and licking the placenta. The young are born with enough hair to thermoregulate independently without the help of a mother and also open their eyes at birth or within the first couple days. These mice tend to produce approximately 1 to 5 offspring in a litter and in just a few days after their birth, infant mice are treated as common children where they are nursed by every mother in the group and accepted everywhere. Incredibly enough, the new mother is fertile once again the evening of the same day she gives birth.

Breeding interval: Cairo spiny mice breed 3 to 4 times during their breeding season.

Breeding season: Acomys cahirinus breeds from September to January.

Range number of offspring: 1 to 5.

Range gestation period: 5 to 6 weeks.

Range age at sexual or reproductive maturity (female): 2 (low) months.

Range age at sexual or reproductive maturity (male): 2 (low) months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Since Cairo spiny mice live in groups and care for young cooperatively, the mother is not solely responsible for parental care. Additionally, the advanced development of the young at birth and their early independence mean that the duration of parental investment is relatively short. By the third day after birth, young mice are already exploring and investigating their surroundings, and by the age of 2 months they are sexually mature.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acomys cahirinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAATCGTTGACTTTTTTCAACTAACCACAAAGACATCGGAACCCTATACCTTATCTTCGGAGCCTGAGCTGGCATAGTGGGAACAGCCCTTAGTATTCTCATCCGAGCCGAACTGGGACAACCAGGGGCTCTATTAGGTGACGATCAAATCTACAACGTAATCGTAACCGCCCATGCATTCGTTATAATTTTCTTTATAGTCATACCCATAATAATTGGGGGCTTTGGAAACTGATTAGTACCCCTAATAATTGGTGCACCAGACATAGCCTTCCCCCGAATAAATAACATAAGTTTCTGGCTTCTTCCTCCCTCCTTCCTCCTCCTAATGGCATCATCAATAGTTGAGGCCGGAGCAGGAACCGGATGAACCGTATACCCACCCCTAGCAGGGAACCTAGCACATGCCGGAGCATCTGTAGACTTAGCTATTTTCTCTCTTCACTTAGCAGGAGTGTCATCCATTCTCGGGGCAATCAACTTTATCACCACTATTATTAATATAAAACCCCCAGCCATTACACAATACCAAACCCCTCTATTCGTCTGATCAGTCCTAATTACTGCTGTTCTCCTACTCCTCTCTCTACCCGTATTAGCAGCAGGAATTACCATATTATTAACCGACCGCAACCTAAACACAACCTTTTTCGACCCAGCTGGAGGAGGAGACCCTATCCTCTACCAACACTTATTCTGATTTTTCGGACACCCTGAAGTGTATATCCTGATTCTCCCTGGGTTTGGGATTATCTCACACATTGTTACATACTACTCAGGAAAAAAAGAACCCTTCGGCTATATGGGGATAGTCTGAGCCATGATATCCATTGGATTCCTAGGCTTTATCGTATGAGCCCACCACATGTTTACAGTGGGCTTAGACGTAGATACCCGAGCCTACTTCACATCAGCAACTATAATTATTGCTATTCCAACGGGAGTTAAAGTCTTTAGCTGATTAGCCACGCTCCACGGAGGGAATATTAAGTGATCCCCAGCCATACTATGAGCCCTTGGATTTATCTTCCTATTTACTGTAGGTGGTCTAACCGGAATTGTACTGTCAAACTCCTCACTAGATATTGTACTCCACGACACATACTACGTGGTAGCCCACTTCCACTACGTATTATCTATGGGGGCTGTATTTGCTATCATAGCAGGGTTCGTCCACTGATTTCCCCTATTCTCGGGCTACTCTCTCAATGATATGTGAGCAAAAGCTCACTTTATCGTAATATTTGTAGGAGTAAATTTAACTTTTTTTCCCCAACACTTCCTAGGCCTATCCGGCATACCTCGACGATACTCTGACTACCCAGATGCTTACACAACTTGAAACATGGTGTCCTCCATAGGCTCATTTATTTCTCTCACAGCTGTCATTATCATAATCTTTATCATCTGAGAAGCTTTCGCCTCAAAACGTGAAATCCTGTCAGTCCCCTACACAGCCACCAACCTAGAGTGACTCCACGGATGCCCTCCACCCTATCACACCTTCGAAGAACCCACCTATGTAAAAGTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acomys cahirinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Cairo spiny mice are not currently considered threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Dieterlen, F., Schlitter, D. & Amori, G.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Granjon, L. & Schlitter, D.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common and widespread, and is commensal with people especially in gardens and date groves.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is very common especially in favorable habitats, as suggested by high trapping rates in rocky habitats.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures are in place or needed. It is not known if the species occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is found in several protected areas, but these are not critical for the survival of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Cairo spiny mice have been destroying crops near human habitation for thousands of years and they have been known to spread deadly diseases such as typhus, spotted fever, and Salmonella food poisoning

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cairo spiny mice have been widely used as laboratory animals for research in the areas of medicine and biology, including genetics, virology, pharmaceutical development, and cancer research.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cairo spiny mouse

The Cairo spiny mouse (Acomys cahirinus), also known as the common spiny mouse, Egyptian spiny mouse or the Arabian Spiny Mouse, is a nocturnal species of rodent in the family Muridae. It is found in Africa north of the Sahara where its natural habitats are rocky areas and hot deserts. It is omnivorous and feeds on seeds, desert plants, snails and insects. It is a gregarious animal and lives in small family groups.

Description[edit]

The Cairo spiny mouse grows to a head and body length of about 3.75 to 5 inches (95 to 127 mm) with a tail of much the same length. Adults weigh between 1.5 and 3 ounces (43 and 85 g). The colour of the Cairo spiny mouse is sandy-brown or greyish-brown above and whitish beneath. A line of spine-like bristles run along the ridge of the back. The snout is slender and pointed, the eyes are large, the ears are large and slightly pointed and the tail is devoid of hairs.[2]

Distribution and habitat[edit]

The Cairo spiny mouse is native to northern Africa with its range extending from Mauritania, Morocco and Algeria in the west to Sudan, Ethiopia, Eritrea and Egypt in the east at altitudes up to about 1,500 metres (4,900 ft). It lives in dry stony habitats with sparse vegetation and is often found near human dwellings. It is common around cliffs and canyons and in gravelly plains with shrubby vegetation. It is not usually found in sandy habitats but may be present among date palms.[1][3]

Behaviour[edit]

Captive specimens at Birmingham Nature Centre

Cairo spiny mice are social animals and live in a group with a dominant male. Breeding mostly takes place in the rainy season, between September and April, when there is a greater availability of food.[3] The gestation period is five to six weeks which is long for a mouse, and the young are well-developed when they are born. At this time, they are already covered with short fur and their eyes are open, and they soon start exploring their surroundings. The adults in the group cooperate in caring for the young, with lactating females feeding any of the group offspring.[3] Females may become pregnant again immediately after giving birth, and have three or four litters of up to five young in a year. The juveniles become mature at two to three months of age.[3][4]

Cairo spiny mice lives burrows or rock crevices and are mostly terrestrial but they can also clamber about in low bushes. They are nocturnal and omnivorous, eating anything edible that they can find. Their diet includes seeds, nuts, fruit, green leaves, insects, spiders, molluscs and carrion. When they live in the vicinity of humans, they consume crops, grain and stored food.[3] They sometimes enter houses, especially in winter, and dislike cold weather.[2]

The fruit of the Ochradenus baccatus has pleasant tasting flesh but distasteful seeds. It has been found that the Cairo desert mouse consumes the fruits but spits the seeds out intact and thus acts as an efficient seed dispersal agent for this plant.[5]

Status[edit]

The Cairo spiny mouse has a wide distribution and occupies diverse habitats. It is common and the population size large so the IUCN, in its Red List of Threatened Species, lists it as being of "Least Concern".[1]

References[edit]

  1. ^ a b c Dieterlen, F., Schlitter, D. & Amori, G. (2008). Acomys cahirinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 February 2009.
  2. ^ a b Konig, Claus (1973). Mammals. Collins & Co. p. 139. ISBN 978-0-00-212080-7. 
  3. ^ a b c d e Regula, Clara (2012). "Acomys cahirinus: Cairo spiny mouse". Animal Diversity Web. University of Michigan. Retrieved 2013-08-28. 
  4. ^ "Egyptian spiny mouse, Cairo spiny mouse". World Association of Zoos and Aquariums. Retrieved 2013-08-28. 
  5. ^ Samuni-Blank, M; Izhaki, I; Dearing, MD; Gerchman, Y; Trabelcy, B; Lotan, A; Karasov, WH; Arad, Z (2012). "Intraspecific directed deterrence by the mustard oil bomb in a desert plant". Current Biology 22 (13): 1218–20. doi:10.1016/j.cub.2012.04.051. PMID 22704992. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Western Saharan spiny mouse

The Western Saharan spiny mouse (Acomys airensis) is a species of rodent in the family Muridae.[2] It is found in Mali, Mauritania, Niger, and possibly in Western Sahara, western Chad and southern Algeria. Its natural habitats are subtropical or tropical dry shrubland, rocky areas, arable land, rural gardens, and urban areas.

References[edit]

  1. ^ Granjon, L. & Schlitter, D. (2008). Acomys airensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 February 2009.
  2. ^ Musser, G. G.; Carleton, M. D. (2005). "Superfamily Muroidea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 894–1531. ISBN 978-0-8018-8221-0. OCLC 62265494. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!