Overview

Comprehensive Description

Description

Cairo spiny mouse vary in size from small to medium. Fur spiny extending from behind the shoulder onto rump but not present on the side. Body color varies from pale to dark brownish cinnamon on the upperparts. Head dark. Underparts and feet white. Suborbital region small and white. Snout pointed. Ears large, erect, pigmented, with white basal and posterior patches and covered with whitish hairs. Eyes prominent and bright. Tail as long as the head and body length, hairless and scaly. Tail color grayish on the dorsal side and buff on the ventral side.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Endemic to Africa. Known from Western Sahara, Mauritania, Morocco, Algeria, Libya, Egypt (including Sinai), Sudan, Eritrea, Djibouti and Ethiopia. Limits in C and S Sudan, and in Ethiopia are uncertain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs north of the Niger River in southern Mauritania, Mali, Niger, and possibly in Chad, Western Sahara and southernmost parts of Algeria. It has an altitudinal range of not higher than 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread (Nile Valley, Delta, Eastern Desert, oases, Gebel Uweinat).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Body length: 75–138 mm. Tail length: 85–138 mm. Weight: 21–64 gm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found mainly in rocky areas (Jebels), cliffs, and rocky canyons; not in sandy desert areas (although may sometimes be found in sandy habitats with date palms). Also found in gravel plains with low shrubs in the Sahel. Some populations are commensal, occupying crevices in buildings.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found mostly in rocky habitats, but also regularly in gardens and other human-related habitats, including homes (huts). One individual was found in a completely sandy habitat on the inner delta of the Niger River. All members of the genus are insectivorous unlike other rodents which are generally granivorous.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cairo spiny mouse inhabits in rocky arid regions, desert gardens, settlements, huts and houses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Nocturnal animal. Omnivorous, feeding on snails, insects, spiders, scorpions and sometimes on various plant parts. Lives in social groups. Cairo spiny mouse drinks large quantities of water because of high evaporation rate through skin and can survive without food or water for three to nine days, but cannot tolerate cold weather. The tail and large patches of dorsal skin come off easily when handled, an anti-predator device. Cairo spiny mouse breed throughout the year with peak in breeding activity from February to July. Female gives birth to litters of one to five young after a gestation period of around 42 days. The young are weaned after two weeks and reaches sexual maturity after two or three months. Cairo spiny mouse can live for three years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 5.9 years (captivity) Observations: In captivity, average longevity is about 3 years. Older mothers have larger litters (Ronald Nowak 1999). One captive specimen lived at least 5.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acomys cahirinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAATCGTTGACTTTTTTCAACTAACCACAAAGACATCGGAACCCTATACCTTATCTTCGGAGCCTGAGCTGGCATAGTGGGAACAGCCCTTAGTATTCTCATCCGAGCCGAACTGGGACAACCAGGGGCTCTATTAGGTGACGATCAAATCTACAACGTAATCGTAACCGCCCATGCATTCGTTATAATTTTCTTTATAGTCATACCCATAATAATTGGGGGCTTTGGAAACTGATTAGTACCCCTAATAATTGGTGCACCAGACATAGCCTTCCCCCGAATAAATAACATAAGTTTCTGGCTTCTTCCTCCCTCCTTCCTCCTCCTAATGGCATCATCAATAGTTGAGGCCGGAGCAGGAACCGGATGAACCGTATACCCACCCCTAGCAGGGAACCTAGCACATGCCGGAGCATCTGTAGACTTAGCTATTTTCTCTCTTCACTTAGCAGGAGTGTCATCCATTCTCGGGGCAATCAACTTTATCACCACTATTATTAATATAAAACCCCCAGCCATTACACAATACCAAACCCCTCTATTCGTCTGATCAGTCCTAATTACTGCTGTTCTCCTACTCCTCTCTCTACCCGTATTAGCAGCAGGAATTACCATATTATTAACCGACCGCAACCTAAACACAACCTTTTTCGACCCAGCTGGAGGAGGAGACCCTATCCTCTACCAACACTTATTCTGATTTTTCGGACACCCTGAAGTGTATATCCTGATTCTCCCTGGGTTTGGGATTATCTCACACATTGTTACATACTACTCAGGAAAAAAAGAACCCTTCGGCTATATGGGGATAGTCTGAGCCATGATATCCATTGGATTCCTAGGCTTTATCGTATGAGCCCACCACATGTTTACAGTGGGCTTAGACGTAGATACCCGAGCCTACTTCACATCAGCAACTATAATTATTGCTATTCCAACGGGAGTTAAAGTCTTTAGCTGATTAGCCACGCTCCACGGAGGGAATATTAAGTGATCCCCAGCCATACTATGAGCCCTTGGATTTATCTTCCTATTTACTGTAGGTGGTCTAACCGGAATTGTACTGTCAAACTCCTCACTAGATATTGTACTCCACGACACATACTACGTGGTAGCCCACTTCCACTACGTATTATCTATGGGGGCTGTATTTGCTATCATAGCAGGGTTCGTCCACTGATTTCCCCTATTCTCGGGCTACTCTCTCAATGATATGTGAGCAAAAGCTCACTTTATCGTAATATTTGTAGGAGTAAATTTAACTTTTTTTCCCCAACACTTCCTAGGCCTATCCGGCATACCTCGACGATACTCTGACTACCCAGATGCTTACACAACTTGAAACATGGTGTCCTCCATAGGCTCATTTATTTCTCTCACAGCTGTCATTATCATAATCTTTATCATCTGAGAAGCTTTCGCCTCAAAACGTGAAATCCTGTCAGTCCCCTACACAGCCACCAACCTAGAGTGACTCCACGGATGCCCTCCACCCTATCACACCTTCGAAGAACCCACCTATGTAAAAGTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acomys cahirinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Dieterlen, F., Schlitter, D. & Amori, G.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Granjon, L. & Schlitter, D.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common and widespread, and is commensal with people especially in gardens and date groves.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is very common especially in favorable habitats, as suggested by high trapping rates in rocky habitats.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures are in place or needed. It is not known if the species occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is found in several protected areas, but these are not critical for the survival of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cairo spiny mouse

The Cairo spiny mouse (Acomys cahirinus), also known as the common spiny mouse, Egyptian spiny mouse or the Arabian Spiny Mouse, is a nocturnal species of rodent in the family Muridae. It is found in Africa north of the Sahara where its natural habitats are rocky areas and hot deserts. It is omnivorous and feeds on seeds, desert plants, snails and insects. It is a gregarious animal and lives in small family groups.

Description[edit]

The Cairo spiny mouse grows to a head and body length of about 3.75 to 5 inches (95 to 127 mm) with a tail of much the same length. Adults weigh between 1.5 and 3 ounces (43 and 85 g). The colour of the Cairo spiny mouse is sandy-brown or greyish-brown above and whitish beneath. A line of spine-like bristles run along the ridge of the back. The snout is slender and pointed, the eyes are large, the ears are large and slightly pointed and the tail is devoid of hairs.[2]

Distribution and habitat[edit]

The Cairo spiny mouse is native to northern Africa with its range extending from Mauritania, Morocco and Algeria in the west to Sudan, Ethiopia, Eritrea and Egypt in the east at altitudes up to about 1,500 metres (4,900 ft). It lives in dry stony habitats with sparse vegetation and is often found near human dwellings. It is common around cliffs and canyons and in gravelly plains with shrubby vegetation. It is not usually found in sandy habitats but may be present among date palms.[1][3]

Behaviour[edit]

Captive specimens at Birmingham Nature Centre

Cairo spiny mice are social animals and live in a group with a dominant male. Breeding mostly takes place in the rainy season, between September and April, when there is a greater availability of food.[3] The gestation period is five to six weeks which is long for a mouse, and the young are well-developed when they are born. At this time, they are already covered with short fur and their eyes are open, and they soon start exploring their surroundings. The adults in the group cooperate in caring for the young, with lactating females feeding any of the group offspring.[3] Females may become pregnant again immediately after giving birth, and have three or four litters of up to five young in a year. The juveniles become mature at two to three months of age.[3][4]

Cairo spiny mice lives burrows or rock crevices and are mostly terrestrial but they can also clamber about in low bushes. They are nocturnal and omnivorous, eating anything edible that they can find. Their diet includes seeds, nuts, fruit, green leaves, insects, spiders, molluscs and carrion. When they live in the vicinity of humans, they consume crops, grain and stored food.[3] They sometimes enter houses, especially in winter, and dislike cold weather.[2]

The fruit of the Ochradenus baccatus has pleasant tasting flesh but distasteful seeds. It has been found that the Cairo desert mouse consumes the fruits but spits the seeds out intact and thus acts as an efficient seed dispersal agent for this plant.[5]

Status[edit]

The Cairo spiny mouse has a wide distribution and occupies diverse habitats. It is common and the population size large so the IUCN, in its Red List of Threatened Species, lists it as being of "Least Concern".[1]

References[edit]

  1. ^ a b c Dieterlen, F., Schlitter, D. & Amori, G. (2008). Acomys cahirinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 February 2009.
  2. ^ a b Konig, Claus (1973). Mammals. Collins & Co. p. 139. ISBN 978-0-00-212080-7. 
  3. ^ a b c d e Regula, Clara (2012). "Acomys cahirinus: Cairo spiny mouse". Animal Diversity Web. University of Michigan. Retrieved 2013-08-28. 
  4. ^ "Egyptian spiny mouse, Cairo spiny mouse". World Association of Zoos and Aquariums. Retrieved 2013-08-28. 
  5. ^ Samuni-Blank, M; Izhaki, I; Dearing, MD; Gerchman, Y; Trabelcy, B; Lotan, A; Karasov, WH; Arad, Z (2012). "Intraspecific directed deterrence by the mustard oil bomb in a desert plant". Current Biology 22 (13): 1218–20. doi:10.1016/j.cub.2012.04.051. PMID 22704992. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Western Saharan spiny mouse

The Western Saharan spiny mouse (Acomys airensis) is a species of rodent in the family Muridae.[2] It is found in Mali, Mauritania, Niger, and possibly in Western Sahara, western Chad and southern Algeria. Its natural habitats are subtropical or tropical dry shrubland, rocky areas, arable land, rural gardens, and urban areas.

References[edit]

  1. ^ Granjon, L. & Schlitter, D. (2008). Acomys airensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 February 2009.
  2. ^ Musser, G. G.; Carleton, M. D. (2005). "Superfamily Muroidea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 894–1531. ISBN 978-0-8018-8221-0. OCLC 62265494. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!