Overview

Brief Summary

Biology

Red squirrels do not hibernate and lay down stores of food to see them through periods when fresh food is not available. Where they are found in mixed broadleaf and coniferous woodland they have a source of food all year round, as pine seeds are present over the winter months. However, red squirrels have quite a varied diet which includes seeds, buds, flowers, leaves and fruit. They are known to take insects, fungi and birds' eggs. Red squirrels build nests, called dreys, from sticks and moss placed high in the branches. They produce two litters of three to four kittens a year, usually in March and July. The drey is often the first evidence of the presence of red squirrels in a wood. Other signs are chewed pine cone 'cores' (birds leave ragged remains), split hazel nut shells (dormice make a hole to extract the kernel), cut tree shoots and scattered droppings. Red squirrels can live for up to six years. They are chiefly active during the day and most of this time is spent foraging. Bad weather can seriously hinder this activity and, without food the squirrels can only survive for a few days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Comprehensive Description

Description

This attractive mammal has a chestnut upper body, with buff to cream underside, noticeable ear tufts and the famous fluffy tail. The red squirrel moults its coat twice a year but the ear tufts and the tail are only moulted annually. It is a smaller animal than the introduced grey squirrel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Globally, the red squirrel has a large range in the Palaearctic, extending from the United Kingdom, Ireland, Spain and Portugal in the west, through continental Europe, Russia, Mongolia, and northwest and northeast China to the Pacific coast (Panteleyev 1998, Gurnell and Wauters 1999). It is also found on the Pacific islands of Sakhalin (Russia) and Hokkaido (Japan, endemic subspecies Scuirus vulgaris orienti). It has been introduced to the Caucasus, and the Tokyo area of Japan where it may be competing with S. lis.

In Europe, it is widespread in most areas, with the exception of the Iberian peninsula (where it is absent from the south-west) and Britain (where it has almost completely disappeared from the south-east). It occurs only sporadically in the Balkans, and is absent from the majority of Mediterranean islands. It occurs in Turkish Thrace and northeastern Turkey (Yigit et al. 2006). In Portugal the range has expanded southwards. It occurs from sea level up to 3,100 m asl in the Alps (Spitzenberger 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sciurus vulgaris, also known as the Eurasian red squirrel, can be found throughout the forests of Europe and northern Asia. Over the past century S. vulgaris population densities have changed greatly. The species has remained very common in central Europe, but on Great Britain they are now extirpated from much of their range. (Nowak 1991, Parker 1990)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Across most of Europe into northern Asia and Siberia. In this part of its range the red squirrel is not threatened. In the UK it is restricted to a few sites, mainly those free from competition by grey squirrels, which is why it is classified as threatened. However, the two species share some habitats in Scotland and parts of Wales, Ireland and England.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This species has more variation in coat color than almost any other mammal in the Palearctic region. The color of these squirrels varies from light-red to black on their heads and backs. All individuals (except those that are completely melanistic), have white or creamy fur on their stomachs. Like many other tree squirrels, S. vulgaris has long tufts of hair on its ears and long furry tail. In most areas where they are common, such as central Europe, the pelage coloration of individuals varies from red to black, with individuals of many differently color morphs co-occurring. However, in some areas, whole populations may have almost identically colored coats. Examples of populations in which all of the squirrels share the same coat color can be found in Great Britain, where only red members of this species live; and in the Sila region of southern Italy, where only black individuals are found. The body hair of these squirrels changes twice annually, while the tail hair changes only once. The winter coat covers more of the soles of the feet, has longer ear tufts, and is thicker than the spring/summer coat.

Shedding and growth of hair can be delayed or prevented by a lack of food, diseases, or parasitic infestation during the spring or late fall when individuals normally grow a new coat.

The size of the skull also varies between regions. Average skull size in S. vulgaris populations increases from north to south throughout Eurasia.

(Nowak 1991, Parker 1990)

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

Average mass: 600 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is most abundant in large tracts of coniferous forest and also occurs in deciduous woods, mixed forest, parks, gardens, and small stands of conifers. It is found in lowland to subalpine forests. Its diet is mainly vegetarian, consisting of seeds, acorns, fungus, bark, and sapwood, although it occasionally takes animal prey (young birds and eggs). They are an important species for the reforestation process.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sciurus vulgaris lives and nests in deciduous and coniferous forests. These squirrels prefer to live in large, mature trees that can provide them with an abundant supply of food in the form of seeds or acorns. Trees chosen as nesting sites usually have hollowed out cavities or large holes in their trunks which can be used as nests. A high quality nest may be used for several years, and individuals always maintain several nests to which they can escape when being pursued by a predator. (Nowak 1991, Parker 1990)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Red squirrels prefer woodland that contains a fair proportion of conifer trees. In Europe they are found in large forests, gardens and parks and at altitudes of up to 2000 m. In the UK they are now chiefly confined to conifer forests but can live in mixed woodland that has yet to be invaded by greys.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sciurus vulgaris regularly forage on coniferous seeds, beechnuts, acorns, and nuts. They have a specialized technique for opening nuts that utilizes the power of the lower incisors. With practice they are able to open a nut in just a few seconds. The dietary habits of these squirrels varies greatly according to the region in which they live and with the availability of different foods. When their regular dietary staples are not available, these squirrels may eat mushrooms and other fungi, birds' eggs, and garden flowers and vegetables. They have also been observed peeling the bark off conifers and licking the trees' sap. Like most squirrels, this species stores food supplies by burying them in the ground or hiding them in the bark of trees. Young squirrels learn what food sources to eat from their mothers. As they get older they become more reluctant to accept new and strange food sources. The daily food intake varies depending upon the time of year. They eat the most food in the spring (80g per day), and the least in the winter (35g per day). (Gromwall et al. 1993, Moiller 1983, Nowak 1991, Parker 1990)

Animal Foods: eggs

Plant Foods: leaves; seeds, grains, and nuts; fruit; sap or other plant fluids

Other Foods: fungus

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eurasian red squirrels have an important impact on forest communities through seed predation and caching of tree seeds. Forgotten caches may end up sprouting and growing into new trees.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Eurasian red squirrels are agile in the trees and are constantly alert for the presence of predators. They are mainly preyed on by large birds of prey and arboreal mustelids like the European marten. As young in the nest they may be taken by large climbing snakes, and other small, arboreal predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Sciurus vulgaris preys on:
fungi
Aves

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Foodplant / feeds on
Sciurus vulgaris feeds on fruit of Corylus avellana

Foodplant / feeds on
Sciurus vulgaris feeds on fruit of Fagus sylvatica

Foodplant / feeds on
Sciurus vulgaris feeds on seed of Pinopsida
Other: major host/prey

Foodplant / feeds on
Sciurus vulgaris feeds on seed of Pinus sylvestris
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eurasian red squirrels have keen senses of vision, smell, touch, and hearing. They communicate with body signals, sounds, such as warning calls, and chemical cues. Within family groups touch is also used in communication.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The mortality rate of young Eurasian red squirrels is high, due to heavy predation by birds and mammals. Less than one in four survive to their first birthday. Although adults can live for 6 to 7 years in the wild, and longer in captivity, most individuals probably only live for 2-4 years.

Range lifespan

Status: wild:
7 (high) years.

Range lifespan

Status: captivity:
10 to 12 years.

Average lifespan

Status: wild:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.8 years (captivity) Observations: In the wild, these animals may live up to 12 years (Bernhard Grzimek 1990). One specimen lived over 14.8 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

When a female comes into estrous, the usually non-gregarious males gather in her home range to compete for the opportunity to mate with her. After mating occurs, male squirrels return to their home ranges.

Mating System: polygynous

Female Eurasian red squirrels give birth to an average of two litters per year, of usually 5-7 young. The gestation period is 38-39 days. The young weigh 8-12 g at birth and are born hairless and blind. Their auditory canals are unopened, and their ears are undeveloped and lay flat against their head. The young squirrels' eyes open after 30 days, at which time they become active cleaning themselves and moving around the nest. After 45 days the young voluntarily leave the nest for the first time. At this point the young also begin to eat solid food. By eight to ten weeks of age the offspring are fully weaned and independent, even though they tend to remain near their mothers for some time. Young become reproductively mature within a year. (Macdonald 1984, Nowak 1991, Parker 1990)

Breeding interval: These squirrels reproduce twice during the warm season, at approximately 13 week intervals

Breeding season: Eurasian red squirrels generally have two litters per year, one in February to March, the other from May to August

Range number of offspring: 1 to 10.

Average number of offspring: 3 to 7.

Range gestation period: 38 to 39 days.

Range time to independence: 8 to 10 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 9.25 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
320 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
296 days.

Eurasian red squirrels are cared for and nursed by their mother in her nest during the first few months of their lives.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sciurus vulgaris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0546-06|NC_002369|Sciurus vulgaris| AATCGTTGATTGTTCTCAACTAATCATAAAGACATCGGAACATTATATCTCTTATTTGGTGCCTGAGCTGGAATAGTAGGTACAGCCCTT---AGTTTACTAATTCGAGCTGAACTGGGTCAACCCGGAGCCTTACTAGGAGAT---GATCAAATTTATAATGTAGTTGTTACTGCACATGCATTTGTTATAATTTTCTTCATAGTTATACCTATCATAATTGGTGGATTTGGAAATTGACTAGTTCCATTGATA---ATTGGAGCCCCTGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTTCCTCCCTCATTTCTACTGCTCCTAGCATCGTCAATAGTGGAAGCAGGCGCTGGGACTGGATGAACCGTTTACCCTCCTCTAGCAGGTAATCTAGCCCATGCAGGAGCCTCAGTAGATCTA---ACTATTTTCTCACTCCACCTGGCAGGTGTTTCCTCCATCTTAGGGGCAATTAATTTTATTACTACTATTATCAATATAAAACCACCCGCTATATCCCAATATCAAACCCCCCTGTTTGTCTGATCAGTCTTAATTACAGCTGTACTGTTACTTCTTTCACTTCCAGTCCTTGCAGCA---GGAATTACCATACTTTTAACTGACCGAAATTTAAATACAACTTTCTTTGACCCGGCTGGGGGAGGAGACCCTATTCTATATCAACACTTATTTTGATTTTTTGGACACCCTGAGGTCTATATCCTTATTCTCCCAGGATTTGGCATCATTTCACATATTGTTACCTACTACTCTGGTAAAAAA---GAACCATTTGGTTATATGGGTATAGTATGAGCTATGATATCTATCGGATTCCTAGGATTTATTGTATGAGCTCACCATATATTTACTGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sciurus vulgaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Shar, S., Lkhagvasuren, D., Bertolino, S., Henttonen, H., Kryštufek, B. & Meinig, H.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because this species has a large population size and a wide distribution and there are no known widespread threats at present.

History
  • 2002
    Near Threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The number of Eurasian red squirrels has dropped dramatically in recent years in some areas. In Great Britain, the introduction of a North American species of tree squirrel, the eastern gray squirrel (Sciurus carolinensis), has led to the disappearance of native Eurasian red squirrels throughout much of the country, while in the former Soviet Union overhunting of some populations for their fur has reduced their numbers. (Nowak 1991, Parker 1990, Wilson et al. 1993)

This species is listed as "Near Threatened" by the IUCN Red List.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk - near threatened by the IUCN Red List, and listed under Appendix III of the Berne Convention. Threatened in the UK, and protected under Schedules 5 and 6 of the Wildlife and Countryside Act.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although it is described as common throughout most of its range (Gurnell and Wauters 1999), there have been well-documented population declines and range contractions in the United Kingdom, Ireland and Italy (Gurnell and Pepper 1993, Wauters et al. 1997, O'Teangana et al. 2000). Typical densities range from less than 0.1 to 1.5 individuals per hectare (Gurnell and Wauters 1999). However, it is sufficiently common in some parts of its range that it is considered a forestry pest owing to its habit of stripping bark and feeding on conifer buds.

In Mongolia the population is subject to great fluctuations, which are reflected in the fur-trade statistics. From 1958-1960 an average of over 145,000 skins/year was obtained; in 1961, 70,300 skins were obtained and in 1962, 33,135 skins were harvested. During 1965 the total rose sharply to 112,755 skins, and then declined the next year to 77,629 skins. By 1970 the number collected fell to 35,600 skins.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threats to this species are habitat loss and fragmentation, but these are not considered to pose a major threat to the species at present.

In Britain and Italy, out-competition by the introduced grey squirrel Sciurus carolinensis (Gurnell and Pepper 1993, Wauters et al. 1997, Bertolino and Genovesi 2003). Now that the grey squirrel has become established on the continent, it can be expected that it may ultimately spread throughout much of the red squirrel's range. Grey squirrels not only out-compete the smaller red squirrels, but also carry parapox virus, which is highly pathogenic to red squirrels. Grey squirrels can carry the virus without being affected, and recent (2006) UK studies have shown that 61% of apparently healthy grey squirrels have been exposed to the virus and may be carriers (C. McInnes in litt. 2006). When the virus is present, the grey squirrel can replace the red squirrel 20 times faster than normal replacement rate (Rushton et al. 2006). The virus has not yet been recorded in Italy.

In Japan, this species is frequently sold as pets, having been imported from the mainland, and so the risk of the spread of this species across Japan is high, with much resulting concern for its impact on the native Sciurus lis.

In Mongolia, unsustainable hunting for skins, for the international fur trade is a threat. Records of hunting levels between 1942 and 1960 are available in Stubbe (1965), although current hunting levels have not been established.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

There is evidence to suggest that red squirrels have fluctuated in numbers in the UK since the last ice age. In the last 50 years, however, their dramatic decline has been due to loss and fragmentation of habitat, disease and in particular, competition from the introduced grey squirrel (Sciurus carolinensis). The two species are known to coexist in some locations but while there is no evidence of aggressive behaviour by greys, competition for limited food sources tends to favour the introduced animal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention, and it occurs in many protected areas throughout its wide range. It is listed on the Chinese Red list as Near Threatened, being close to qualifying for Vulnerable A2cd+3cd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Fearing that the red squirrel would be lost as a species to central and southern England, English Nature included it in their Species Recovery Programme (SRP). In partnership with the Forestry Commission, SRP began a project to look at ways in which the red squirrel might be helped recover its population.The project is taking place in Thetford Forest in East Anglia, one of the few sites in southern England where the animal is still found. The work involves looking at changes in conifer woodland management to change the competitive balance in favour of red squirrels as well as developing new techniques in both conserving existing populations and improved re-introduction schemes. Other methods that have been developed include cage traps that catch only the heavier grey squirrel, and a captive breeding programme that aims to release animals into specially prepared sites. They are then monitored to see how well they re-colonise a particular area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sciurus vulgaris are known to occasionally eat shoots of food crop plants. They can also be a nuisance when they nest in houses or buildings because they can be quite noisy. (Nowak 1991)

Negative Impacts: crop pest; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the former Soviet Union some populations of Sciurus vulgaris are hunted for their thick and luxurious winter coats, which have commercial value on the fur market. (Nowak 1991). This species is also probably an important disperser of the seeds of some species of trees.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Squirrel

The red squirrel or Eurasian red squirrel (Sciurus vulgaris) is a species of tree squirrel in the genus Sciurus common throughout Eurasia. The red squirrel is an arboreal, omnivorous rodent.

In Great Britain and Ireland, numbers have decreased drastically in recent years, in part because of the introduction of the eastern grey squirrel (Sciurus carolinensis) from North America.[3]

Contents

Description

Profile of the Eurasian red squirrel in grey winter coat
The underparts are generally white/cream in colour

The red squirrel has a typical head-and-body length of 19 to 23 cm (7.5 to 9 in), a tail length of 15 to 20 cm (5.9 to 7.9 in) and a mass of 250 to 340 g (8.8 to 12 oz). It is not sexually dimorphic, as males and females are the same size. The red squirrel is somewhat smaller than the eastern grey squirrel which has a head-and-body length of 25 to 30 cm (9.5 to 12 in) and weighs between 400 and 800 g (14 oz to 1.8 lb). It is thought that the long tail helps the squirrel to balance and steer when jumping from tree to tree and running along branches and may keep the animal warm during sleep.

The coat of the red squirrel varies in colour with time of year and location. There are several different coat colour morphs ranging from black to red. Red coats are most common in Great Britain; in other parts of Europe and Asia different coat colours co-exist within populations, much like hair colour in some human populations. The underside of the squirrel is always white-cream in colour. The red squirrel sheds its coat twice a year, switching from a thinner summer coat to a thicker, darker winter coat with noticeably larger ear-tufts (a prominent distinguishing feature of this species) between August and November. A lighter, redder overall coat colour, along with the larger ear-tufts (in adults) and much smaller size, distinguish the Eurasian red squirrel from the American eastern grey squirrel.

The red squirrel, like most tree squirrels, has sharp, curved claws to enable it to climb and descend broad tree trunks, thin branches and even house walls. Its strong hind legs enable it to leap gaps between trees.The red squirrel also has the ability to swim.

Reproduction and mortality

Mating can occur in late winter during February and March and in summer between June and July. Up to two litters a year per female are possible. Each litter usually contains three or four young although as many as six may be born. Gestation is about 38 to 39 days. The young are looked after by the mother alone and are born helpless, blind and deaf and weigh between 10 and 15 g. Their body is covered by hair at 21 days, their eyes and ears open after three to four weeks, and they develop all their teeth by 42 days. Juvenile red squirrels can eat solids around 40 days following birth and from that point can leave the nest on their own to find food; however, they still suckle from their mother until weaning occurs at 8 to 10 weeks.

During mating, males detect females that are in œstrus by an odor that they produce, and although there is no courtship the male will chase the female for up to an hour prior to mating. Usually multiple males will chase a single female until the dominant male, usually the largest in the group, mates with the female. Males and females will mate multiple times with many partners. Females must reach a minimum body mass before they enter œstrus, and heavy females on average produce more young. If food is scarce breeding may be delayed. Typically a female will produce her first litter in her second year.

A two-week-old red squirrel

Red squirrels that survive their first winter have a life expectancy of 3 years. Individuals may reach 7 years of age, and 10 in captivity. Survival is positively related to availability of autumn–winter tree seeds; on average, 75–85% of juveniles die during their first winter, and mortality is approximately 50% for winters following the first.[4]

Ecology and behaviour

Red squirrel

The red squirrel is found in both coniferous forest and temperate broadleaf woodlands. The squirrel makes a drey (nest) out of twigs in a branch-fork, forming a domed structure about 25 to 30 cm in diameter. This is lined with moss, leaves, grass and bark. Tree hollows and woodpecker holes are also used. The red squirrel is a solitary animal and is shy and reluctant to share food with others. However, outside the breeding season and particularly in winter, several red squirrels may share a drey to keep warm. Social organization is based on dominance hierarchies within and between sexes; although males are not necessarily dominant to females, the dominant animals tend to be larger and older than subordinate animals, and dominant males tend to have larger home ranges than subordinate males or females.[5]

The red squirrel eats mostly the seeds of trees, neatly stripping conifer cones to get at the seeds within.[citation needed] Fungi, nuts (especially hazelnuts but also beech and chestnuts), berries, young shoots, and bird eggs are occasionally eaten.[6] Often the bark of trees is removed to allow access to sap.[citation needed] Between 60% and 80% of its active period may be spent foraging and feeding.[7] Excess food is put into caches, either buried or in nooks or holes in trees, and eaten when food is scarce. Although the red squirrel remembers where it created caches at a better-than-chance level, its spatial memory is substantially less accurate and durable than that of grey squirrel;[8] it therefore will often have to search for them when in need, and many caches are never found again. No territories are maintained, and the feeding areas of individuals overlap considerably.

Red squirrel

The active period for the red squirrel is in the morning and in the late afternoon and evening. It often rests in its nest in the middle of the day, avoiding the heat and the high visibility to birds of prey that are dangers during these hours. During the winter, this mid-day rest is often much more brief, or absent entirely, although harsh weather may cause the animal to stay in its nest for days at a time.

Arboreal predators include small mammals including the pine marten, wild cats, and the stoat, which preys on nestlings; birds, including owls and raptors such as the goshawk and buzzards, may also take the red squirrel. The red fox, cats and dogs can prey upon the red squirrel when it is on the ground. Humans influence the population size and mortality of the red squirrel by destroying or altering habitats, by causing road casualties, and by controlling populations of grey squirrels.

Conservation

A red squirrel with a brown coat

The red squirrel is protected in most of Europe, as it is listed in Appendix III of the Bern Convention; it is listed as Least Concern on the IUCN Red List. In some areas it is abundant and is hunted for its fur. Although not thought to be under any threat worldwide, the red squirrel has drastically reduced in number in the United Kingdom. Fewer than 140,000 individuals are thought to be left,[9] approximately 85% of which are in Scotland. This population decrease is often ascribed to the introduction of the eastern grey squirrel from North America,[10] but the loss and fragmentation of its native woodland habitat has also played a major role.

Eradication of the grey squirrel from the North Wales Island of Anglesey began in January of 1998. This facilitated the natural recovery of the small remnant red squirrel population and was followed by the successful reintroduction of the red squirrel into the pine stands of Newborough Forest.[11] Subsequent reintroductions into broadleaved woodland followed and today the island has the single largest red squirrel population in Wales.

Mainland initiatives in Southern Scotland and the North of England also rely upon grey squirrel control as the cornerstone of red squirrel conservation strategy. A local programme known as the "North East Scotland Biodiversity Partnership", an element of the national Biodiversity Action Plan has subsequently been established. This programme is administered by the Grampian Squirrel Society, with an aim of protecting the red squirrel; the programme centres on the Banchory and Cults areas. In 2008, the Scottish Wildlife Trust announced a four year project which commenced in the spring of 2009 called "Saving Scotland's Red Squirrels".[12]

Other notable projects include red squirrel projects in the Greenfield Forest, including the buffer zones of Mallerstang, Garsdale and Widdale;[13] the Northumberland Kielder Forest Project; and within the National Trust reserve in Formby. These projects were originally part of the Save Our Squirrels campaign that aimed to protect Red Squirrels in the north of England.[14] but now form part of a five year Government project called ‘Red Squirrels Northern England’. Outside the UK and Ireland, the threat from the eastern grey squirrel comes from a population in Piedmont, Italy, where two pairs escaped from captivity in 1948. A significant drop in red squirrel populations in the area has been observed since 1970, and it is feared that the eastern grey squirrel may expand into the rest of Europe.

Eurasian red squirrel in Turku, Finland

The eastern grey squirrel population appears to be able to out-compete the red squirrel for various reasons:

  • The eastern grey squirrel can easily digest acorns, while the red squirrel cannot.
  • The eastern grey squirrel carries a disease, the squirrel parapoxvirus, that does not appear to affect their health but will often kill the red squirrel. It was revealed in 2008 that the numbers of red squirrels at Formby have recently declined by 80% as a result of this disease.[15]
  • When the red squirrel is put under pressure, it will not breed as often.

The eastern grey squirrel and the red squirrel are not directly antagonistic, and violent conflict between these species is not a factor in the decline in red squirrel populations.

Research undertaken in 2007 in the UK credits the Pine Marten with reducing the population of the invasive eastern grey squirrel. Where the range of the expanding Pine Marten population meets that of the eastern grey squirrel, the population of these squirrels retreats. It is theorised that because the grey squirrel spends more time on the ground than the red, that they are far more likely to come in contact with this predator.[16]

On 17th February 2011, HRH the Prince of Wales launched a brand new conservation project Red Squirrels Northern England. This project branches off of the major charity Red Squirrel Survival Trust and has a budget of £3 million over 5 years with more funding to come.

Cultural and economic significance

In Norse mythology, Ratatosk is a red squirrel who runs up and down with messages in the world tree, Yggdrasill, and spreads gossip. In particular, he ferried insults between the eagle Veðrfölnir at the top of Yggdrasill and the dragon Níðhöggr beneath its roots.

The red squirrel used to be widely hunted for its pelt. In Finland squirrel pelts were used as currency in ancient times, before the introduction of coinage.[citation needed] The expression "squirrel pelt" is still widely understood there to be a reference to money.

In the United Kingdom, children are familiar with a character named Squirrel Nutkin, a character Beatrix Potter always illustrated as a red squirrel.

Taxonomy and distribution

Juvenile red squirrel
Sciurus vulgaris mantchuricus

There have been over 40 described subspecies of the red squirrel, but the taxonomic status of some of these is uncertain. A study published in 1971 recognises 16 subspecies and has served as a basis for subsequent taxonomic work.[17][18] At present, there are 23 recognized subspecies.[19]

  • S. v. alpinus. Desmarest, 1822. (Synonyms: S. v. baeticus, hoffmanni, infuscatus, italicus, meridionalis, numantius, segurae or silanus.)
  • S. v. altaicus. Serebrennikov, 1928.
  • S. v. anadyrensis. Ognev, 1929.
  • S. v. arcticus. Trouessart, 1906. (Synonym: S. v. jacutensis.)
  • S. v. balcanicus. Heinrich, 1936. (Synonyms: S. v. istrandjae or rhodopensis.)
  • S. v. chiliensis. Sowerby, 1921.
  • S. v. cinerea. Hermann, 1804.
  • S. v. dulkeiti. Ognev, 1929.
  • S. v. exalbidus. Pallas, 1778. (Synonyms: S. v. argenteus or kalbinensis.)
  • S. v. fedjushini. Ognev, 1935.
  • S. v. formosovi. Ognev, 1935.
  • S. v. fuscoater. Altum, 1876. (Synonyms: S. v. brunnea, gotthardi, graeca, nigrescens, russus or rutilans.)
  • S. v. fusconigricans. Dvigubsky, 1804
  • S. v. leucourus. Kerr, 1792.
  • S. v. lilaeus. Miller, 1907. (Synonyms: S. v. ameliae or croaticus.)
  • S. v. mantchuricus. Thomas, 1909. (Synonyms: S. v. coreae or coreanus.)
  • S. v. martensi. Matschie, 1901. (Synonym: S. v. jenissejensis.)
  • S. v. ognevi. Migulin, 1928. (Synonyms: S. v. bashkiricus, golzmajeri or uralensis.)
  • S. v. orientis. Thomas, 1906.
  • S. v. rupestris. Thomas, 1907
  • S. v. ukrainicus. Migulin, 1928. (Synonym: S. v. kessleri.)
  • S. v. varius. Gmelin, 1789.
  • S. v. vulgaris. Linnaeus, 1758.[20] (Synonyms: S. v. albonotatus, albus, carpathicus, europaeus, niger, rufus or typicus.)

References

  1. ^ Shar, S., Lkhagvasuren, D., Bertolino, S., Henttoten, H., Kryštufek, B. & Meinig, H. (2008). Sciurus vulgaris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 6 January 2009.
  2. ^ Thorington, R.W., Jr.; Hoffmann, R.S. (2005). "Sciurus (Sciurus) vulgaris". In Wilson, D.E.; Reeder, D.M. Mammal Species of the World: a taxonomic and geographic reference (3rd ed.). The Johns Hopkins University Press. pp. 754–818. ISBN 0-8018-8221-4. OCLC 26158608. http://www.bucknell.edu/msw3/browse.asp?s=y&id=12400219. 
  3. ^ "Fight to save Red Squirrel impeded by lack of funds": article by Graham Tibbetts on page 17 of issue 47,381, Daily Telegraph (Friday 5th October 2007)
  4. ^ Gurnell, J. 1983, Squirrel numbers and the abundance of tree seeds. Mammal Review. 13:133–148
  5. ^ Wauters, L., C. Swinnen, and A. A. Dhondt. 1992, Activity budget and foraging behaviour or red squirrels (Sciurus vulgaris) in coniferous and deciduous habitats. Journal of Zoology 227:71–86
  6. ^ Forestry Commission - Red Squirrels
  7. ^ Wauters, L.A., and A.A. Dhondt. 1992, Spacing behaviour of red squirrels, Sciurus vulgaris: variation between habitats and the sexes. Animal Behaviour 43:297–311
  8. ^ Macdonald, I. M. V. (1997). Field experiments on duration and precision of grey and red squirrel spatial memory. Animal Behaviour 54:879-891
  9. ^ UK Forestry Commission - Red Squirrels
  10. ^ "Black squirrels set to dominate". BBC News. 2009-01-20. http://news.bbc.co.uk/1/hi/england/7839653.stm. Retrieved 2009-04-26. 
  11. ^ Red squirrel conservation, squirrel ecology and grey squirrel management
  12. ^ "A new era for Scotland's red squirrels?" in Scottish Wildlife (November 2008) No. 66. Edinburgh.
  13. ^ "Greenfield Forest declared England’s newest Red Squirrel Reserve" daelnet.co.uk. Retrieved 24 Jan 2011
  14. ^ "Home page" saveoursquirrels.org. Retrieved 24 Jan 2011
  15. ^ Country File, BBC, 28.89.2008
  16. ^ Watson, Jeremy (30 December 2007) "Tufty's saviour to the rescue". Scotland on Sunday. Edinburgh.
  17. ^ Sidorowicz, J. 1971, Problems of subspecific taxonomy of squirrel (Sciurus vulgaris L.) in Palaearctic: Zoologischer Anzeiger. 187:123–142.
  18. ^ Lurz, P.W.W. et al. 2005. Sciurus vulgaris. Mammalian Species 769:1–10
  19. ^ Wilson, D. E. & Reeder, D. M. (editors). 2005. Mammal Species of the World. A Taxonomic and Geographic Reference (3rd ed).
  20. ^ Linnaeus, Carolus (1758) (in Latin). Systema naturae per regna tria naturae :secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. (10th edition ed.). Holmiae (Laurentii Salvii). http://www.biodiversitylibrary.org/bibliography/542. Retrieved 2010-03-08. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!