Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

The meadow vole (Microtus pennsylvanicus) makes its burrows along surface runways in grasses or other herbaceous vegetation. It is the most widely distributed small grazing herbivore in North America and is found over most of the northern half of the United States. Meadow voles have been used in bioassays to indicate the presence of toxins in their foods (Kendall and Sherwood, 1975, cited in Reich, 1981; Schillinger and Elliot, 1966). Although primarily terrestrial, the meadow vole also is a strong swimmer (Johnson and Johnson, 1982).

The meadow vole measures 8.9 to 13 cm in length (head and body) and has a 3.6- to 6.6-cm tail. They weigh between 20 and 40 g depending on age, sex, and location (see table). Mature males are approximately 20 percent heavier than females (Boonstra and Rodd, 1983). Meadow voles lose weight during the winter, reaching a low around February, then regain weight during spring and summer, reaching a high around August in many populations (see table; Iverson and Turner, 1974).

The meadow vole inhabits grassy fields, marshes, and bogs (Getz, 1961a). Compared with the prairie vole, the meadow vole prefers fields with more grass, more cover, and fewer woody plants (Getz, 1985; Zimmerman, 1965). The meadow vole also tends to inhabit moist to wet habitats, whereas the prairie vole is relatively uncommon in sites with standing water (Getz, 1985).

Meadow voles consume green succulent vegetation, sedges, seeds, roots, bark, fungi, insects, and animal matter (see table). They are agricultural pests in some areas, feeding on pasture, hay, and grain (Johnson and Johnson, 1982; Burt and Grossenheider, 1980). At high population densities, the meadow vole has been known to girdle trees, which can damage orchards (Byers, 1979, cited in Reich, 1981). In seasonal habitats, meadow voles favor green vegetation when it is available and consume other foods more when green vegetation is less available (Johnson and Johnson, 1982; Riewe, 1973; Getz, 1985). Although Zimmerman (1965) found some evidence of food selection, he found that meadow voles generally ate the most common plants in their habitat. Meadow voles living on prairies consume more seeds and fewer dicots and monocots than voles in a bluegrass habitat (Lindroth and Batzli, 1984). The meadow vole's large cecum allows it to have a high digestive efficiency of 86 to 90 percent (Golley, 1960). Coprophagy (eating of feces) has been observed in this species (Ouellete and Heisinger, 1980).

  • Please refer to the original article for references and additional information.
Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

"Meadow Voles have a remarkable reproductive output: they are the world's most prolific mammals. Females can breed when they are a month old and produce litters of 3-10 pups every three weeks for the rest of their lives. A captive female produced 17 litters in one year. They are known for their boom-bust population cycles. Population density can vary from several Voles to several hundred per hectare over a 2-5 year period. Biologists have been studying - and trying to explain - these boom-bust cycles for more than half a century. At peak density, Meadow Voles are capable of real damage to farms and orchards. They are also a very important food source for many predators."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Ord, G., 1815.  in A new geographical, historical, and commercial grammar; and present state of the several kingdoms of the world (W. Guthrie, compiler), 2nd Amer. ed., Johnson and Warner, Philadelphia, 2:1-603., p. 292.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Microtus pennsylvanicus is the most widespread vole in North America. Its east to west range is continuous from central Alaska to the Atlantic coast. South of the Canadian border, its western limit is the Rocky mountains. The meadow vole is found as far south as New Mexico and Georgia (Maser and Storm 1970).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs throughout most of Canada and Alaska (United States), south through the northern half of the United States, to Oregon, northern Utah, central New Mexico, Kansas, northern Missouri, Georgia, and South Carolina; also disjunctly (by 500 km) in Florida and in Chihuahua, Mexico (Hall 1981). Its range has expanded southward in the Great Plains since the mid-1960s as the climate has become cooler and more mesic (Frey 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Occurs throughout most of Canada and Alaska south through the northern half of the U.S., to Oregon, northern Utah, central New Mexico, Kansas, northern Missouri, Georgia, and South Carolina; also disjunctly (by 500 km) in Florida and in Chihuahua, Mexico (Hall 1981). Range has expanded southward in the Great Plains since the mid-1960s as the climate has become cooler and more mesic (Frey 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Meadow voles are native to the Nearctic and the most widespread vole in North America. They are found all over Canada, into Alaska and from the Atlantic Ocean to the Rocky Mountains. They occur as far south as Georgia and New Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The meadow vole has the widest distribution of any North American
species of Microtus. It ranges from Labrador west to Alaska and south
from Labrador and New Brunswick to South Carolina and extreme
northeastern Georgia; east through Tennessee, Missouri, north-central
Nebraska, the northern half of Wyoming, and central Washington to
Alaska; south through Idaho into north-central Utah. It is excluded
only from the extreme polar regions. A disjunct subset of its range
occurs from central Colorado to northwestern New Mexico [2,48].
  • 2. Askham, Leonard R. 1992. Voles. In: Black, Hugh C., ed. Silvicultural approaches to animal damage management in Pacific Northwest forests. Gen. Tech. Rep. PNW-GTR-287. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 187-204. [23386]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
5 Columbia Plateau
6 Upper Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AK CO CT DE GA ID IL IN IA KY
ME MD MA MI MN MS MO MT NE NH
NJ NM NY NC ND OH OK OR PA RI
SC SD TN UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The total length of M. pennsylvanicus ranges from 128 to 195 mm with a tail about 40% of the body length. The dorsal surface is dark blackish brown to dark reddish brown with coarse black hairs. The ventral surface is grey or white and may be tinged with light brown. The winter pelage is duller and more grey. There is no sexual variation in size or color. The skull is moderately heavy, rather long, and slightly angular. The upper cheek tooth row is relatively long, about 7.2 mm, and the third premolar, usually a distinguishing characteristic among the voles, has an anterior complex, a posterior loop, and seven triangles in between, four lingual and three labial (Maser and Storm 1970, Jackson 1961).

Range mass: 33.0 to 65.0 g.

Average mass: 43.67 g.

Range length: 128.0 to 195.0 mm.

Sexual Dimorphism: sexes alike

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.428 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Meadow voles are small rodents can range from 128 to 195 mm in length with tail almost half as long as the body. Their backs are very dark brown to a reddish brown with long, coarse black hairs. Their bellies are grey or white. Males and females are the same size and color. As with all rodents, meadow voles have 2 pairs of incisors at the front of their mouth that are always growing.

Range mass: 33.0 to 65.0 g.

Average mass: 43.67 g.

Range length: 128.0 to 195.0 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.428 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 20 cm

Weight: 70 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 167 mm
Range: 140-195 mm

Weight:
Range: 33-65 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Microtus pennsylvanicus can be found in mainly in meadows, lowland fields, grassy marshes, and along rivers and lakes. They are also occasionally found in flooded marshes, high grasslands near water, and orchards or open woodland if grassy (Jackson 1961).

Habitat Regions: temperate

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is found in a wide variety of habitats from dry pastures and wooded swamps to marshes and orchards. Needs loose organic soils for tunneling. Builds extensive underground tunnels. Nests in these tunnels under rocks or logs, and in self-constructed grassy clumps. Breeds throughout year. Peak breeding activity occurs April-October. Gestation lasts about 21 days. Litter size is 1-9 (average 4-5). Litter size is smaller in fall than in spring/summer, there may be 5-10 litters per year.

Home range seldom exceeds 0.25 acres (Banfield 1974). Successful homing of 11 of 848 voles displaced 1.2 km indicates that dispersal distance probably is more than 1 km (Ostfeld and Manson 1996). Diet consists mainly of vegetable matter, such as grasses, roots and seeds. Active day and night throughout the year.

This species can an affect old-field succession through seedling predation (Ostfeld and Canham 1993). It may inflict serious damage on apple trees by feeding on bark and vascular tissues of lower trunks and roots (Tobin and Richmond 1993). Expanding populations apparently are displacing the southern bog lemming via competitive exclusion in southeastern Kentucky (Krupa and Haskins 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Found in a wide variety of habitats from dry pastures and wooded swamps to marshes and orchards. Needs loose organic soils for tunneling. Builds extensive underground tunnels. Nests in these tunnels under rocks or logs, and in self-constructed grassy clumps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As their name suggests, meadow voles live in meadows, fields, grassy marshes, and along rivers and lakes. They are also occasionally found in flooded marshes, high grasslands near water, and orchards.

Habitat Regions: temperate

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: formation, natural

Nests are used as nurseries, resting areas, and as protection against
weather. They are constructed of woven grass. Nests are usually
subterranean or are constructed under boards, rocks, logs, brush piles,
hay bales, fenceposts, or in grassy tussocks. Meadow voles dig shallow
burrows [31], and in burrows, nests are constructed in enlarged
chambers. In winter nests are often constructed on the ground surface
under a covering of snow, usually against some natural formation such as
a rock or log [4,31].

Meadow voles form runways or paths in dense grasses [4,31].
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: association, competition, cover, density, forbs, litter, marsh, presence, restoration, selection, shrub, succession, tree

Optimal meadow vole habitat consists of moist, dense grassland with
substantial amounts of plant litter. Habitat selection is largely
influenced by relative ground cover of grasses and forbs; soil
temperature, moisture, sodium, potassium, and pH levels; humidity; and
interspecific competition [17,50]. Meadow voles are most commonly
associated with sites having high soil moisture [46]. They are often
restricted to the wetter microsites when they occur in sympatry with
prairie voles (Microtus ochrogaster) or montane voles [17]. In an Iowa
prairie restoration project, meadow voles experienced an initial
population increase during the initial stage of vegetation succession
(old field dominated by foxtail grass [Setaria spp.], red clover
[Trifolium pratense], annual ragweed [Ambrosia artemisiifolia], alfalfa
[Medicago sativa], and thistles [Cirsium spp.]). However, meadow vole
populations reached their peak abundance during the perennial grass
stage of succession from old field to tallgrass prairie [53]. Geier and
Best [22] found meadow voles in habitat devoid of tree cover in which
grasses dominated the herb layer. They listed the meadow vole as a
species with low tolerance for habitat variation (i. e., a species that
is intolerant of variations in habitat, is restricted to few habitats,
and/or uses habitats less evenly than tolerant species) [22].

In most areas meadow voles clearly prefer habitat with dense vegetation.
In tallgrass prairie at Pipestone National Monument, meadow voles were
positively associated with dense vegetation and litter [57]. Conley and
others [11] reported that variables important to meadow vole habitat in
Virginia include vegetative cover reaching a height of 8 to 16 inches
(20-41 cm) and presence of litter. Meadow voles appeared to be randomly
distributed within a grassland habitat in southern Quebec [26]. Grant
and Morris [26] were not able to establish any association of meadow
vole abundance with particular plant species. They were also unable to
distinguish between food and cover as the determining factor in meadow
vole association with dense vegetation.

In eastern Massachusetts meadow vole density on a mosaic of grassy
fields and mixed woods was positively correlated with decreasing
vertical woody stem density and decreasing shrub cover. Meadow vole
density was highest on plots with more forbs and grasses and less woody
cover; meadow voles preferred woody cover over sparse vegetation where
grassy cover was not available [1].

In West Virginia the only forested habitats in which meadow voles were
captured were seedling stands [9]. In South Dakota meadow voles prefer
grasslands to Rocky Mountain juniper (Juniperus scopulorum) woodlands
[55]. In New Mexico meadow voles were captured in stands of grasses,
wild rose (Rosa spp.), prickly-pear (Opuntia spp.), and various forbs;
meadow voles were also captured in wet areas with tall marsh grasses
[18].

Open habitat with a thick mat of perennial grass favors voles [39]. In
west-central Illinois meadow voles were the most common small mammals on
Indian grass (Sorghastrum nutans)-dominated and switchgrass (Panicum
virginicus)-dominated study plots. They were present in very low
numbers on orchard grass (Dactylis glomerata)-dominated plots. The most
stable population of meadow voles occurred on unburned big bluestem
(Andropogon gerardii)-dominated plots [42]. In Ontario meadow voles and
white-footed mice (Peromyscus leucopus) occur together in ecotones.
Meadow voles were the most common small mammals in oak savanna/tallgrass
prairie dominated by northern pin oak (Quercus palustris) and grasses
including bluejoint reedgrass (Calamagrostis canadensis), prairie
cordgrass (Spartina pectinata), big bluestem, switchgrass, and Indian
grass.

Effect of Habitat Alteration: In Michigan strip clearcuts in a conifer
swamp resulted in an increase in the relative abundance of meadow voles.
Meadow voles were most abundant in clearcut strip interiors and least
abundant in uncut strip interiors. Slash burning did not appear to
affect meadow vole numbers about 1.5 years after treatment [64].

Dispersal Distance: In Pennsylvania three subadult meadow voles were
captured at least 1.6 miles (2.6 km) from the nearest appreciable
suitable meadow vole habitat, suggesting that meadow voles are adapted
to long-distance dispersal [34].

Habitat Patch Shape: In Ohio the effects of patch shape and proportion
of edge were investigated by mowing strips between study plots. The
square plots were 132 feet per side (40 m x 40 m), and the rectangular
patches were 52.8 feet by 330 feet (16 m x 100 m). Square habitat
patches were not significantly different than rectangular patches in
meadow vole density. There were no apparent edge effects in patches of
this size, suggesting that meadow voles are edge-tolerant. Habitat
patch shape did affect dispersal and space use behaviors. In
rectangular patches home ranges were similar in size to those in square
patches, but were elongated [29].

Home Range: Meadow voles tend to remain in home ranges and defend at
least a portion of the home range from conspecifics. Home ranges
overlap and have irregular shapes [31]. Meadow vole home range size
depends on season, habitat, and population density: ranges are larger
in summer than winter, ranges in marshes are larger than ranges in
meadows, and ranges are smaller at higher population densities [48].
Home ranges vary in size from 0.08 to 2.3 acres (0.32-0.9 ha). Females
have smaller home ranges than males, but are more highly territorial
than males; there is often a period when juveniles from one litter are
still present in the adult female's home range when the next litter is
borne [4,31]. Female territoriality tends to determine density in
suboptimal habitats; the amount of available forage has been suggested
as the determining factor in female territory size and therefore also
determines reproductive success [32].
  • 1. Adler, Gregory H. 1988. The role of habitat structure in organizing small mammal populations and communities. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 289-299. [7118]
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 9. Brooks, Robert T.; Healy, William M. 1988. Response of small mammal communities to silvicultural treatments in eastern hardwood forests of West Virginia and Massachusetts. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 313-318. [25544]
  • 17. Birney, Elmer C.; Grant, W. E.; Baird, Donna Day. 1976. Importance of vegetative cover to cycles of Microtus populations. Ecology. 57(5): 1043-1051. [25768]
  • 18. Finley, Robert B., Jr. 1986. Distributions and habitats of voles in southeastern Colorado and northeastern New Mexico. The Southwestern Naturalist. 31(2): 263-266. [18452]
  • 22. Geier, Anthony R.; Best, Louis B. 1980. Habitat selection by small mammals of riparian communities: evaluating effects of habitat alterations. Journal of Wildlife Management. 44(1): 16-24. [25535]
  • 26. Grant, P. R.; Morris, Ralph D. 1971. The distribution of Microtus pennsylvanicus within grassland habitat. Canadian Journal of Zoology. 49(7): 1043-1052. [25826]
  • 29. Harper, Steven J.; Bollinger, Eric K.; Barrett, Gary W. 1993. Effects of habitat patch shape on population dynamics of meadow voles (Microtus pennsylvanicus). Journal of Mammalogy. 74(4): 1045-1055. [22627]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]
  • 32. Jones, Eric N. 1990. Effects of forage availability on home range and population density of Microtus pennsylvanicus. Journal of Mammalogy. 71(3): 382-389. [23790]
  • 34. Kirkland, Gordon L., Jr. 1988. Meadow voles (Microtus pennsylvanicus) on forest clearcuts: the role of long-distance dispersal. Journal of the Pennsylvania Academy of Science. 62(2): 83-85. [10099]
  • 39. M'Closkey, Robert T.; Hecnar, Stephen J. 1994. Small mammals of the Ojibway Prairie Provincial Nature Reserve, Windsor, Ontario. In: Wickett, Robert G.; Lewis, Patricia Dolan; Woodliffe, Allen; Pratt, Paul, eds. Spirit of the land, our prairie legacy: Proceedings, 13th North American prairie conference; 1992 August 6-9; Windsor, ON. Windsor, ON: Department of Parks and Recreation: 75-80. [24678]
  • 42. Moreth, Louis H.; Schramm, Peter. 1973. A comparative survey of small mammal populations in various grassland habitats with emphasis on restored prairie. In: Hulbert, Lloyd C., ed. Third Midwest prairie conference pr; 1972 September 22-23; Manhattan, KS. Manhattan, KS: Kansas State University, Division of Biology: 79-84. [18804]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]
  • 50. Schramm, Peter; Clover, Catherine A. 1994. A dramatic increase of the meadow jumping mouse (Zapus hudsonius) in a post-drought, restored, tallgrass prairie. In: Wickett, Robert G.; Lewis, Patricia Dolan; Woodliffe, Allen; Pratt, Paul, eds. Spirit of the land, our prairie legacy: Proceedings, 13th North American prairie conference; 1992 August 6-9; Windsor, ON. Windsor, ON: Department of Parks and Recreation: 81-86. [24679]
  • 53. Schwartz, Orlando A.; Whitson, Paul D. 1986. A 12-year study of vegetation and mammal succession on a reconstructed tallgrass prairie in Iowa. The American Midland Naturalist. 117(2): 240-249. [2096]
  • 55. Sieg, Carolyn Hull. 1988. The value of Rocky Mountain juniper (Juniperus scopulorum) woodlands in South Dakota as small mammal habitat. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 328-332. [7121]
  • 57. Snyder, Ellen J.; Best, Louis B. 1988. Dynamics of habitat use by small mammals in prairie communities. The American Midland Naturalist. 119(1): 128-136. [25769]
  • 64. Verme, Louis J.; Ozoga, John J. 1981. Changes in small mammal populations following clear-cutting in upper Michigan conifer swamps. Canadian Field-Naturalist. 95(3): 253-256. [25827]
  • 11. Conley, Walt; Tipton, Alan R.; Kukila, Susan. 1976. Habitat preference in Microtus pennsylvanicus: a preliminary multivariate analysis. Virginia Journal of Science. 27(2): 43. [Abstract]. [25765]
  • 46. Pendleton, G. W. 1984. Small mammals in prairie wetlands: habitat use and the effects of wetland modification. Brookings, SD: South Dakota State University. [Pages unknown]. Thesis. [26235]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, presence

Meadow voles are most commonly found in grasslands, preferring moister
areas, but are also found in wooded areas [48].

In eastern Washington and northern Idaho meadow voles are found in
relative abundance in sedge (Carex spp.) fens but not in adjacent cedar
(Thuja spp.)-hemlock (Tsuga spp.), Douglas-fir (Pseudotsuga menziesii),
or ponderosa pine (Pinus ponderosa) forests. Meadow voles are also
absent from fescue (Festuca spp.)-snowberry (Symphoricarpos spp.)
associations. It was speculated that moisture is a major factor in
habitat use; possibly the presence of free water is a deciding factor.
In southeastern Montana meadow voles were the second most abundant small
mammal (after deer mice [Peromyscus maniculatus]) in riparian areas
within big sagebrush (Artemisia tridentata)-buffalo grass (Buchloe
dactyloides) habitats [40]. Meadow voles are listed as
riparian-dependent vertebrates in the Snake River drainage of Wyoming
[52]. Raphael [47] compiled 11 studies on small mammals; meadow voles
were reported in only 3 of 29 sites in subalpine forests of the central
Rocky Mountains. Davis [12] suggested in 1939 that meadow vole range
extensions were likely to be related to irrigation practices. Meadow
voles are now common in hayfields, pastures, and along ditches in the
Rocky Mountain states [30].

In Pipestone National Monument, Minnesota, meadow voles were present in
riparian shrublands, tallgrass prairie, and other habitats [57]. In
east-central Ohio meadow voles were captured in reconstructed common
cattail (Typha latifolia) wetlands [37]. In Virginia meadow voles were
least abundant in eastern redcedar (Juniperus virginiana) glades and
most abundant in fields with dense grass cover [38].
  • 30. Hoffman, George R. 1960. The small mammal components of six climax plant associations in eastern Washington and northern Idaho. Ecology. 41(3): 571-572. [12472]
  • 37. Lacki, Michael J.; Hummer, Joseph W.; Webster, Harold J. 1991. Effect of reclamation technique on mammal communities inhabiting wetlands on mined lands in east-central Ohio. Ohio Journal of Science. 91(4): 154-158. [22035]
  • 38. Linzey, Alicia V.; Cranford, Jack A. 1984. Habitat selection in the southern bog lemming, Synaptomys cooperi, and the meadow vole, Microtus pennsylvanicus, in Virginia. Canadian Field-Naturalist. 98: 463-469. [25824]
  • 40. MacCracken, James G.; Uresk, Daniel W.; Hansen, Richard M. 1985. Rodent-vegetation relationships in southeastern Montana. Northwest Science. 59(4): 272-278; 1985. [1499]
  • 47. Raphael, Martin G. 1987. Nongame wildlife research in subalpine forests of the central Rocky Mountains. In: Management of subalpine forests: building on 50 years of research: Proceedings of a technical conference; 1987 July 6-9; Silver Creek, CO. Gen. Tech. Rep. RM-149. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 113-122. [23229]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]
  • 52. Schroeder, Richard L.; Allen, Arthur W. 1992. Assessment of habitat of wildlife communities on the Snake River, Jackson, Wyoming. Resource Publication 190. Washington, DC: United States Department of the Interior, Fish and Wildlife Service. 21 p. [21296]
  • 57. Snyder, Ellen J.; Best, Louis B. 1988. Dynamics of habitat use by small mammals in prairie communities. The American Midland Naturalist. 119(1): 128-136. [25769]
  • 12. Davis, W. B. 1939. Recent mammals of Idaho. Caldwell, ID: Caxton Printers Ltd. [Pages unknown]. [25704]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

101 Bluebunch wheatgrass
102 Idaho fescue
103 Green fescue
301 Bluebunch wheatgrass-blue grama
302 Bluebunch wheatgrass-Sandberg bluegrass
303 Bluebunch wheatgrass-western wheatgrass
304 Idaho fescue-bluebunch wheatgrass
305 Idaho fescue-Richardson needlegrass
306 Idaho fescue-slender wheatgrass
307 Idaho fescue-threadleaf sedge
309 Idaho fescue-western wheatgrass
311 Rough fescue-bluebunch wheatgrass
312 Rough fescue-Idaho fescue
601 Bluestem prairie
602 Bluestem-prairie sandreed
603 Prairie sandreed-needlegrass
604 Bluestem-grama prairie
606 Wheatgrass-bluestem-needlegrass
608 Wheatgrass-grama-needlegrass
609 Wheatgrass-grama
610 Wheatgrass
611 Blue grama-buffalograss
709 Bluestem-grama
710 Bluestem prairie
802 Missouri prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K047 Fescue-oatgrass
K050 Fescue-wheatgrass
K051 Wheatgrass-bluegrass
K063 Foothills prairie
K069 Bluestem-grama prairie
K070 Sandsage-bluestem prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K083 Cedar glades
K088 Fayette prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Meadow voles feed mainly on the fresh grass, sedges, and herbs that are found locally within their range. They will also eat a variety of seeds and grains. From May until August they subsists on green and succulent vegetation. During the fall they switch to grains and seeds, and during the winter they have been known to feed on the bark and roots of shrubs and small trees. These voles will also eat tubers and bulbs when available. When this species overlaps the range of cranberries, meadow voles feed extensively on these fruits. They also eat other types of fruit. Meadow voles will eat flesh and are cannibalistic, especially on new born young. They do not show much storage behavior, but occasionally make small caches of tubers during the fall. Meadow voles are voracious eaters, consuming close to 60% of the body weight. When eating, these animals sit up and will stand to gnaw bark or a grain stalk (Jackson 1961).

Animal Foods: mammals; insects

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore , Frugivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet consists mainly of vegetable matter, such as grasses, roots and seeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Meadow voles feed mainly on the fresh grass, meadow plants, and herbs that are found close to their shelter. They will also eat a variety of seeds and grains. From May until August they live on green plants. During the fall they switch to grains and seeds, and during the winter they often feed on the bark and roots of shrubs and small trees. When meadow voles live near cranberries, they feed extensively on these fruits. They also eat other types of fruit and will take Insecta occasionally. The meadow vole consume large amounts of food. They can eat close to 60% of their body weight. When eating, they sit up and may hold food with their front paws. They will also stand to gnaw bark or a grain stalk.

Animal Foods: mammals; insects

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: density, forbs

Meadow voles eat most available species of grasses, sedges, and forbs
including many agricultural plant species [31,48]. In summer and fall
grasses are cut into match-length sections to reach the succulent
portions of the leaves and to reach seedheads. Leaves, flowers, and
fruits of forbs are also typical components of the summer diet. Fungi,
primarily endogones (Endogone spp.), have been reported in meadow vole
diets. Meadow voles occasionally consume insects and snails. Meadow
voles occasionally scavenge on animal remains, and cannibalism is
frequent in periods of high population density. Meadow voles may damage
woody vegetation by girdling when population density is high [48].

In winter meadow voles consume green basal portions of grass plants,
often hidden under snow. Other winter diet components include seeds,
roots, and bulbs. Meadow voles occasionally strip the bark from woody
plants. Seeds and tubers are stored in nests and burrows [4,31].
Evidence of coprophagy is sparse but it is thought to occur [31].

In an old-field community in Quebec, plants preferred by meadow voles
included quackgrass (Elytrigia repens), sedges, fescues (Festuca spp.),
wild strawberry (Fragaria virginiana), timothy (Phleum pratense),
bluegrasses (Poa spp.), and bird vetch (Vicia cracca) [5].
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 5. Bergeron, Jean-Marie; Jodoin, Louise. 1989. Patterns of resource use, food quality, and health status of voles (Microtus pennsylvanicus) trapped from fluctuating populations. Oecologia. 79: 306-314. [24928]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Especially because they are so abundant in the habitats where they are found, meadow voles have crucial ecosystem roles. Many predator species rely on voles to make up a significant portion of their diet, especially owls, small hawks and falcons. In addition, meadow voles consume large quantities of grass and recycle the nutrients held in the grass through their droppings. They also help to aerate and turn the soil through their digging activities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Meadow voles are aggressive and will attack when cornered or captured. They take refuge from predators in their system of burrows and grass tunnels. Below is a list of some predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Especially because they are so abundant in the habitats where they are found, meadow voles have crucial ecosystem roles. Many predator species rely on voles to make up a significant portion of their diet, especially owls, small hawks and falcons. In addition, meadow voles consume large quantities of grass and recycle the nutrients held in the grass through their droppings. They also help to aerate and turn the soil through their digging activities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Meadow voles are aggressive and will attack when cornered or captured. They take refuge from predators in their system of burrows and grass tunnels. Below is a list of some predators.

Known Predators:

  • owls (Strigiformes)
  • birds of prey (Falconiformes)
  • snakes (Serpentes)
  • red foxes (Vulpes_vulpes)
  • weasels (Mustela)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

More info for the term: relict

Meadow voles are an important prey for many hawks, owls, and mammalian
carnivores, and they are also taken by some snakes [48]. Almost all
species of raptors take microtine (Microtus spp.) rodents as prey.
Birds not usually considered predators of mice do take voles; examples
include gulls (Larus spp.), northern shrike (Larius borealis),
black-billed magpie (Pica pica), common raven (Corvus corvax), American
crow (C. brachyrhynchos), great blue heron (Ardea herodias), and
American bittern (Botaurus lentiginosus) [31]. In Ohio meadow voles
comprised 90 percent of the individual prey remains in long-eared owl
(Asio otus) pellets on a relict wet prairie [44], and in Wisconsin
meadow voles comprised 95 percent of short-eared owl (A. flammeus) prey
[14]. Most mammalian predators take microtine prey [31]. The
short-tailed shrew (Blarina brevicauda) is major predator; meadow voles
avoid areas frequented by short-tailed shrews [48]. Other major
mammalian predators include badger (Taxidea taxus), striped skunk
(Mephitis mephitis), weasels (Mustela spp.), marten (Martes americana),
and domestic cat (Felis cattus). Other animals reported to have
ingested voles include trout (Salmo spp.), Pacific giant salamander
(Dicampton ensatus), garter snake (Thamnophis spp.), yellow-bellied
racer (Coluber constrictor), gopher snake (Pituophis melanoleucas),
rattlesnake (Crotalus viridis), and rubber boa (Charina bottae) [31].

In northern prairie wetlands meadow voles are a large portion of the
diets of red fox (Vulpes vulpes), mink (Mustela vison), short-eared owl,
and northern harrier (Circus cyaneus) [20]. Voles (Microtus spp.) are
frequently taken by racers (Coluber spp.); racers and voles often use
the same burrows [41].
  • 14. Evrard, James O.; Snobl, DeWayne A.; Doeneir, Paul B.; Dechant, Jill A. 1991. Nesting short-eared owls and voles in St. Croix County. Passenger Pigeon. 53(3): 223-226. [22178]
  • 20. Fritzell, Erik K. 1989. Mammals in prairie wetlands. In: Vander Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 268-301. [15219]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]
  • 41. Madison, Dale M. 1978. Behavioral and sociochemical susceptibility of meadow voles (Microtus pennsylvanicus) to snake predators. The American Midland Naturalist. 100(1): 23-28. [25766]
  • 44. Osborn, Eric D.; Hoagstrom, Carl W. 1989. Small mammals of a relict wet prairie in Ohio. In: Bragg, Thomas B.; Stubbendieck, James, eds. Prairie pioneers: ecology, history and culture: Proceedings, 11th North American prairie conference; 1988 August 7-11; Lincoln, NE. Lincoln, NE: University of Nebraska: 247-250. [14056]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Microtus pennsylvanicus is prey of:
Tyto alba
Squamata
Strigiformes
Mustela
Vulpes vulpes
Falconiformes

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range seldom exceeds 0.25 acres (Banfield 1974). Successful homing of 11 of 848 voles displaced 1.2 km indicates that dispersal distance likely is more than 1 km (Ostfeld and Manson 1996, J. Mamm. 77:870-873).

Cyclic density fluctuations may occur every 2-5 years (Krebs and Myers 1974). High densities of 50-60 per acre not unusual; average densities probably closer to 8-10 per acre (Baker 1983).

Can affect old-field succession through seedling predation (Ostfeld and Canham 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, ferns, fire frequency, frequency, litter, marsh, prescribed fire, shrubs, wildfire

Vegetative recovery increases the available biomass on burned areas.
Fire usually benefits small mammals or causes only temporary declines in
populations [33].

Grassland/Prairie/Agricultural Areas: In western Illinois tallgrass
prairie, meadow voles were most abundant on prairie that had burned 2
years previously, and next most abundant on 3-postfire-year prairie.
They were least abundant on freshly burned prairie; prescribed fires
were conducted in April and burns were sampled from May through August
[51]. In a central Wisconsin marsh meadow vole populations were not
significantly different on postfire and unburned plots that were sampled
in August following prescribed fire in mid-March to late April [28]. In
south-central Nebraska mixed-grass prairie, meadow voles reached peak
abundance 2 years following prescribed fire, remained at about the same
abundance the third year, and began to decline the fourth year. Annual
or biennial burning is too frequent to maintain peak densities of meadow
voles. In Manitoba agricultural areas within a mosaic of wetlands,
aspen (Populus spp.) groves, and oak groves, prescribed fire is used
frequently in agricultural fields to control litter, plant diseases, and
pests. No meadow voles were caught in burned areas immediately
following burning. Only 50 were taken in unburned areas; their absence
from burned areas was attributed to lack of cover and residual
vegetation for runway construction [19].

In north-central Nebraska there were more meadow voles on unburned plots
than on burned plots by midsummer, 3 months after prescribed fire in
mixed-grass prairie [49]. Meadow voles were not present on big
bluestem-dominated plots immediately following prescribed spring fire;
adjacent unburned areas exhibited increased populations right after the
fire which suggested that the population of meadow voles on the burned
area had moved to the unburned area [42].

Forested Sites: Meadow voles in woodlands need cover after fire. In
Saskatchewan quaking aspen (Populus tremuloides) parklands, prescribed
fire is used to maintain grass cover and control quaking aspen. Meadow
voles are often the most abundant small mammal in this habitat; their
abundance is affected by fire frequency and concomitant habitat
structure. From 1975 to 1982, meadow voles were significantly reduced
(compared to unburned plots) on plots that had been burned three times
in the fall and on plots that had been burned four times in the spring.
The low number of meadow voles on the two plot types was attributed to a
sparse litter layer. Meadow vole abundance was similar on burned and
control plots in areas of ecotone in 1983 [61]. In Minnesota 2 years
after a severe wildfire in jack pine (Pinus banksiana) woodlands, meadow
voles were trapped on burned areas. Vegetation, dominated by ferns,
forbs, shrubs, and jack pine seedlings, was lush on the burned areas
[8]. Meadow voles were the third most abundant small mammal on jack
pine sites in Manitoba; they were slightly more predominant on unburned
areas for the 3 years following prescribed fire treatment. Meadow vole
numbers were fairly constant on large burned areas over the 3 years
suggesting that there was sufficient cover and food to maintain the
population but not support any increase [56]. In north-central
Pennsylvania mixed-oak stands that were clearcut and burned in spring of
1973, meadow vole numbers were very low on the burned area immediately
after the fire, but were similar on burned and unburned areas by August
1974 [16].
  • 8. Books, David J. 1972. Little Sioux Burn: year two. Naturalist. 23(3&4): 2-7. [11550]
  • 16. Fala, Robert A. 1975. Effects of prescribed burning on small mammal populations in a mixed-oak clearcut. Journal of Forestry. 73(9): 586-587. [10918]
  • 19. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 28. Halvorsen, Harvey H.; Anderson, Raymond K. 1983. Evaluation of grassland management for wildlife in central Wisconsin. In: Kucera, Clair L., ed. Proceedings, 7th North American prairie conference; 1980 August 4-6; Springfield, MO. Columbia, MO: University of Missouri: 267-279. [3228]
  • 33. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 1-36. [14071]
  • 42. Moreth, Louis H.; Schramm, Peter. 1973. A comparative survey of small mammal populations in various grassland habitats with emphasis on restored prairie. In: Hulbert, Lloyd C., ed. Third Midwest prairie conference pr; 1972 September 22-23; Manhattan, KS. Manhattan, KS: Kansas State University, Division of Biology: 79-84. [18804]
  • 49. Schramm, Peter. 1970. Effects of fire on small mammal populations in a restored tall-grass prairie. In: Schramm, Peter, ed. Proceedings of a symposium on prairie and prairie restoration; 1968 September 14-15; Galesburg, IL. Special Publication No. 3. Galesburg, IL: Knox College, Biological Field Station: 39-41. [2779]
  • 51. Schramm, Peter; Willcutts, Brian J. 1983. Habitat selection of small mammals in burned and unburned tallgrass prairie. In: Brewer, Richard, ed. Proceedings, 8th North American prairie conference; 1982 August 1-4; Kalamazoo, MI. Kalamazoo, MI: Western Michigan University, Department of Biology: 49-55. [3122]
  • 56. Sims, H. Percy; Buckner, Charles H. 1973. The effect of clear cutting and burning of Pinus banksiana forests on the populations of small mammals in southeastern Manitoba. The American Midland Naturalist. 90(1): 228-231. [14449]
  • 61. Trottier, Garry C.; Carbyn, Ludwig N.; Scotter, George W. 1989. Effects of prescribed fire on small mammals in aspen parkland. In: Bragg, Thomas A.; Stubbendieck, James, eds. Prairie pioneers: ecology, history and culture: Proceedings, 11th North American prairie conference; 1988 August 7-11; Lincoln, NE. Lincoln, NE: University of Nebraska: 179-182. [14040]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: cover, density, litter, marsh, presence

Meadow voles are active year-round [4,31].

Diurnal Activity: Meadow voles are active day or night, with no clear
24-hour rhythm in many areas [66]. Most changes in activity are imposed
by season, habitat, cover, temperature, and other factors. Meadow voles
have to eat frequently, and their active periods (every 2 to 3 hours)
are associated with food digestion [4,31]. In Canada meadow voles are
active the first 3 hours after dawn and during the 2- to 4-hour period
before sunset. Most of the nonactive period is spent in the nest [31].

Gestation and Development of Young: Gestation lasts 20 to 23 days [31].
Neonates are pink and hairless, with closed eyes and ears. Fur begins
to appear by 4 days, and young are completely furred except for the
belly by 7 days. Eyes and ears open by 8 days. Weaning occurs from 12
to 14 days. Young born in spring and early summer attain adult weight
in 12 weeks, but undergo a fall weight loss. Young born in late summer
continue growing through the fall and maintain their weight through the
winter. Maximum size is reached between 2 and 10 months [31,48].

Litter Size and Productivity: Typical meadow vole litters consist of 4
to 6 young, with extremes of 1 and 11 young. On average 2.6 young are
successfully weaned per litter. Litter size is not significantly
correlated with latitude, elevation, or population density. Fall,
winter, and spring litters tend to be smaller than summer litters.
Reich [48] found that litter size was positively correlated with body
size, and is not significantly different in primaparous and multiparous
females. Another report stated that primaparous females had fewer young
per litter than multiparous females [31]. Litter size was constant in
summer breeding periods at different population densities [48]. Female
meadow voles reach reproductive maturity earlier than males; some
ovulate and become pregnant as early as 3 weeks. Males are usually 6 to
8 weeks old before mature sperm are produced [31]. One captive female
meadow vole produced 17 litters in 1 year for a total of 83 young. One
of her young produced 13 litters (totalling 78 young) before she was 1
year old [3]. If breeding began in April, it was estimated that 100
pairs of montane voles (Microtus montanus) in 40 acres could create a
density of 8,900 voles by September [43].

Mortality and Longevity: Patterns of mortality apparently vary among
meadow vole populations. According to Banfield [4] the average meadow
vole lifespan is less than 1 month because of high nestling and juvenile
mortality. The average time that adults are recapturable in a given
habitat is about 2 months, suggesting that the average extended lifespan
(i.e. how much time adult meadow voles have left) is about 2 months, not
figuring in emigration [4]. Getz [23] reported mortality of 88 percent
for the first 30 days after birth. Golley [25] reported that
postnestling juveniles had the highest mortality rate (61%), followed by
young adults (58%) and older age groups (53%). He estimated that
nestlings had the lowest mortality rate (50%). Estimated mean longevity
ranges from 2 to 3 months to 10 to 16 months [48]. Banfield [4]
reported that the maximum lifespan in the wild is 16 months, and Johnson
and Johnson [31] stated that few voles live more than 2 years.

Population Density and Population Cycles: Meadow vole populations
fluctuate annually and also tend to reach peak densities at 2- to 5-year
intervals, with population declines in intervening years [4,31,35].
Breeding often ceases in January and starts again in March [31]. Over
the course of a year, meadow vole populations tend to be lowest in early
spring; the population increases rapidly through summer and fall [31].

In years of average population sizes, typical meadow vole population
density is about 15 to 45 meadow voles per acre in old-field habitat.
In peak years meadow vole population densities may reach 150 meadow
voles per acre in marsh habitat (more favorable for meadow voles than
old fields) [4]. Fritzell [20] stated that peak meadow vole abundance
can exceed 1,482 meadow voles per acre (600/ha) in northern prairie
wetlands. Meadow voles in optimal habitats in Virginia (old fields with
dense vegetation) reached densities of 983 per acre (398/ha);
populations declined to 67 per acre (27/ha) at the lowest point in the
cycle [38]. Different factors influencing population density have been
assigned primary importance by different authors. Reich [48] listed the
following factors as having been suggested by different authors: food
quality, predation, climatic events, density-related physiological
stress, and the presence of genetically determined behavioral variants
among dispersing individuals.

Normal population cycles do not occur when dispersal is prevented; under
normal conditions dispersers have been shown to be behaviorally,
genetically, and demographically different from residents [48]. Birney
and others [7] hypothesized that there is a threshold density of cover
needed for meadow vole populations to increase. Above the threshold
amount the quantity of cover influences the amplitude and possibly the
duration of the population peak. Local patches of dense cover could
serve as source populations or reservoirs to colonize less favorable
habitats with sparse cover [7].

Social Interaction: Meadow voles form extensive colonies and develop
communal latrine areas. They are socially aggressive and agonistic;
females dominate males and males fight amongst themselves [4].
  • 3. Bailey, Vernon. 1924. Breeding, feeding, and other life habits of meadow mice (Microtus). Journal of Agricultural Research. 27(8): 523-536. [25764]
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 7. Birney, Elmer C.; Grant, W. E.; Baird, Donna Day. 1976. Importance of vegetative cover to cycles of Microtus populations. Ecology. 57(5): 1043-1051. [25768]
  • 20. Fritzell, Erik K. 1989. Mammals in prairie wetlands. In: Vander Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 268-301. [15219]
  • 23. Getz, Lowell L. 1960. A population study of the vole, Microtus pennsylvanicus. The American Midland Naturalist. 64: 392-405. [25825]
  • 25. Golley, Frank B. 1961. Interaction of natality, mortality and movement during one annual cycle in a Microtus population. The American Midland Naturalist. 66(1): 152-159. [25823]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]
  • 35. Krebs, Charles J.; Myers, Judith H. 1974. Population cycles in small mammals. In: MacFadyen, A, ed. Advances in ecological research: volume 8. Advances in ecological research. London: Academic Press: 267-399. [25757]
  • 38. Linzey, Alicia V.; Cranford, Jack A. 1984. Habitat selection in the southern bog lemming, Synaptomys cooperi, and the meadow vole, Microtus pennsylvanicus, in Virginia. Canadian Field-Naturalist. 98: 463-469. [25824]
  • 43. Negus, Norman C.; Pinter, Aelita J. 1965. Litter sizes of Microtus montanus in the laboratory. Journal of Mammalogy. 46(3): 434-445. [26098]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]
  • 66. Webster, A. Bruce; Brooks, Ronald J. 1981. Daily movements and short activity periods of free-ranging meadow voles Microtus pennsylvanicus. Oikos. 37(1): 80-87. [25763]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Meadow voles have keen hearing and a good sense of smell. Vocalizations are primarily used in defensive situations.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Meadow voles have keen hearing and a good sense of smell. Vocalizations are primarily used in defensive situations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night throughout the year. At any one time half the population is active (Ambrose 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Meadow voles are short-lived, rarely living for longer than one year in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Meadow voles are short-lived, rarely living for longer than one year in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, though they have been estimated to live up to 3.9 years (Ronald Nowak and John Paradiso 1983).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating in M. pennsylvanicus is promiscuous. They breed all year round with March through November being the main breeding season. The number of young in a litter varies from two to nine with six or seven as the most common litter size. Number is correlated with the size of the female, with younger females giving birth to smaller litters. Breeding is virtually continuous and the female will mate immediately after giving birth. First mating in females occurs when they are about half grown at an age of 25 days. Males mate when they reach the age of about 45 days (Jackson 1961).

Breeding interval: Females will mate again as soon as they give birth, so they can have a large number of litters in one year. One female in captivity had 17 litters in one year.

Breeding season: Year-round

Range number of offspring: 3.0 to 10.0.

Average gestation period: 21.0 days.

Average weaning age: 14.0 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2.46 g.

Average gestation period: 21 days.

Average number of offspring: 5.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
37 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
29 days.

Baby voles are born helpless, but grow quickly. Females care for and nurse their young in the nest until they are weaned at two weeks old. Soon after weaning the young move away, or disperse, from their mother's home range.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds throughout year, if snow provides an insulating layer. Peak breeding activity occurs April-October. Gestation lasts about 21 days. Litter size is 1-9 (average 4-5); litter size is smaller in fall than in spring/summer; 5-10 litters per year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female meadow voles hold territories that can extend up to an acre. They may breed all year long with the most activity from March through November. Females can begin mating when they are 25 days old. Males are usually 45 days old before they start mating. After mating, the female carries the babies inside her body for 21 days before giving birth. The female will have her litter of babies in a nest that may be on the ground or down in a burrow.

Females can have anywhere from 2 to 9 babies in a single litter. The number of babies in a litter depends on how large the female is, and younger females tend to have fewer young.

Breeding interval: Females will mate again as soon as they give birth, so they can have a large number of litters in one year. One female in captivity had 17 litters in one year.

Breeding season: Year-round

Range number of offspring: 3.0 to 10.0.

Average gestation period: 21.0 days.

Average weaning age: 14.0 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 2.46 g.

Average gestation period: 21 days.

Average number of offspring: 5.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
37 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
29 days.

Baby voles are born helpless, but grow quickly. Females care for and nurse their young in the nest until they are weaned at two weeks old. Soon after weaning the young move away, or disperse, from their mother's home range.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Microtus pennsylvanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 106 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACCCTATATTTACTATTTGGGGCCTGAGCAGGGATAGTAGGAACAGCCCTTAGCATCCTGATTCGAGCAGAACTTGGTCAACCGGGCGCTCTGCTAGGTGATGACCAAATCTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTCATAGTTATACCAATGATAATTGGTGGTTTCGGCAACTGACTTGTTCCACTTATAATTGGAGCGCCAGATATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTCTACCACCATCATTTCTCCTCTTACTGGCATCATCAATAGTAGAAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCTCCATTAGCCGGCAATTTAGCACATGCCGGAGCATCAGTTGACCTAACTATTTTTTCATTACATTTAGCAGGTGTATCCTCAATCCTTGGGGCAATTAATTTTATTACTACCATTATTAACATAAAACCACCAGCTATAACACAATACCAAACTCCTTTATTTGTCTGATCAGTACTAATTACTGCTGTACTTTTACTTCTTTCTCTTCCTGTCCTAGCTGCAGGGATCACTATACTTCTTACGGACCGTAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGCGACCCCATCCTCTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Microtus pennsylvanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 133
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The meadow vole is very abundant and has no special status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is common and widely distributed, and there are no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in North America; common in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The meadow vole is very abundant and has no special conservation status.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

More info for the term: marsh

The Florida salt marsh vole is listed as Endangered [68].
  • 68. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Florida saltmarsh vole (M. pennsylvanicus dukecampbelli) is Vulnerable; four subspecies are Near Threatened (Microtus pennsylvanicus admiraltiae, Admiralty Island meadow vole; M. pennsylvanicus kincaidi, Potholes meadow vole; M. pennsylvanicus provectus, Block Island meadow vole; and M. pennsylvanicus shattucki, Penobscot meadow vole).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widespread in North America and common in many areas. In recent decades, its range has expanded southward in Kansas, Missouri, Illinois, and Kentucky (Krupa and Haskins 1996). High densities of 50-60 per acre are not unusual; average densities are probably closer to 8-10 per acre (Baker 1983).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its range includes several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: The most effective means of reducing damage in orchards is to reduce vole population with rodenticides (toxic baits) (Tobin and Richmond 1993). These, however, may be hazardous to nontarget species (see Swihart 1990), and proper selection, timing, and application are essential for obtaining the best results (Tobin and Richmond 1993). Regarding vole management in fruit orchards, Tobin and Richmond (1993) recommended frequent close mowing of ground vegetation during the growing season and establishment of a vegetation-free zone under the canopy to reduce vole carrying capacity.

Responded to experimental prairie fire by moving to unburned area (Clark and Kaufman 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: shrubs, tree

Meadow voles are abundant in agricultural habitats. The list of crops
that are damaged by meadow voles is long and includes root and stem
crops (asparagus, kohlrabi), tubers, leaf and leafstalks, immature
inflorescent vegetables (artichoke, broccoli), low-growing fruits
(beans, squash), the bark of fruit trees, pasture, grassland, hay, and
grains [31]. Meadow voles are listed as pests on forest plantations
[2]. In forest plantations in British Columbia an apparently abundant
(not censused) meadow vole population was associated with a high rate of
"not sufficient regeneration"; damage to tree seedlings was attributed
to meadow voles and lemmings (Synaptomys spp.) [60]. In central New
York colonization of old fields by trees and shrubs was reduced due to
seedling predation by meadow voles, particularly under the herb canopy
[24].

Management of meadow vole abundance in agricultural areas includes
reduction of habitat in waste places such as roadsides and fencerows by
mowing, plowing, and herbicide application. Predators, particularly
raptors, should be protected to keep meadow vole populations in check.
Direct control methods include trapping, fencing, and poisoning;
trapping and fencing are of limited effectiveness. Poisons are
efficient. Repellents are largely ineffective at present [31]. Pauls
[45] reported that plastic mesh cylinders were effective in preventing
seedling damage by meadow voles and other rodents. Properly timed
cultivation and controlled fires are at least partially effective in
reducing meadow vole abundance.

The cycle of meadow vole abundance is an important proximate factor
affecting the life histories of its major predators. Meadow voles are
usually the most abundant small mammals in northern prairie wetlands,
often exceeding 40 percent of all individual small mammals present [20].
Numbers of short-eared owls, northern harriers, rough-legged hawks
(Buteo lagopus), coyotes (Canis latrans), and red foxes were related to
large numbers of meadow voles in a field in Wisconsin [14]. Other
authors have also stated that predator numbers are positively associated
with meadow vole abundance [31,65].

Ecto- and endoparasites have been reported for meadow voles by a number
of authors and include trematodes, cestodes, nematodes,
acanthocephalans, anoplura, siphonaptera, diptera, and acarina [31,48].

Human diesases transmitted by microtine rodents include cystic hydatid
disease, tularemia, bubonic plague, babesiasis, and giardiasis [31].
  • 2. Askham, Leonard R. 1992. Voles. In: Black, Hugh C., ed. Silvicultural approaches to animal damage management in Pacific Northwest forests. Gen. Tech. Rep. PNW-GTR-287. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 187-204. [23386]
  • 14. Evrard, James O.; Snobl, DeWayne A.; Doeneir, Paul B.; Dechant, Jill A. 1991. Nesting short-eared owls and voles in St. Croix County. Passenger Pigeon. 53(3): 223-226. [22178]
  • 20. Fritzell, Erik K. 1989. Mammals in prairie wetlands. In: Vander Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 268-301. [15219]
  • 24. Gill, David S.; Marks, P. L. 1991. Tree and shrub seedling colonization of old fields in central New York. Ecological Monographs. 61(2): 183-205. [14486]
  • 31. Johnson, Murray L.; Johnson, Sherry. 1982. Voles: Microtus species. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354. [25236]
  • 45. Pauls, Ronald W. 1986. Protection with vexar cylinders from damage by meadow voles of tree and shrub seedlings in northeastern Alberta. In: Salmon, Terrell P.; Marsh, Rex E.; Beadle, Dorothy E., eds. Proceedings--12th vertebrate pest conference; 1986 March 4-6; San Diego, CA. Davis, CA: University of California: 199-204. [4001]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]
  • 60. Sullivan, Thomas P.; Martin, Wayne L. 1991. Influence of site factors on incidence of vole and lemming feeding damage to forest plantations. Western Journal of Applied Forestry. 6(3): 64-67. [15182]
  • 65. Walley, W. J. 1972. Summer observations of the short-eared owl in the Red River Valley. Prairie Naturalist. 4(2): 39-41. [22261]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

When abundant, the meadow can be a pest. It can do considerable damage to growing grain and is also a problem in orchards and forestry plantings (Jackson 1961).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Microtus pennsylvanicus destroys many weeds especially weed grasses, and serves as food for some fur animals and other predators (Jackson 1961).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: May inflict serious damage on apple trees by feeding on bark and vascular tissues of lower trunks and roots (Sullivan and Sullivan 1988, Swihart 1990, Tobin and Richmond 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Large numbers of meadow voles can do considerable damage to growing grain and stored hay, they are also a problem in orchards and forests when they strip bark to eat in the winter.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Meadow voles destroy many weeds, especially weed grasses, and serve as food for some fur animals and other predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Expanding populations apparently are displacing the southern bog lemming via competitive exclusion in southeastern Kentucky (Krupa and Haskins 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Meadow vole

The meadow vole (Microtus pennsylvanicus), sometimes called the field mouse or meadow mouse, is a North American vole found across Canada, Alaska and the northern United States. Its range extends further south along the Atlantic coast. One subspecies, the Florida salt marsh vole (M. p. dukecampbelli), is found in Florida, and is classified as endangered. It is also found in Chihuahua, Mexico.

The meadow vole is active year-round, usually at night. It also digs underground burrows, where it stores food for the winter and females give birth to their young. Although these animals tend to live close together, they are aggressive towards one another. This is particularly evident in males during the breeding season. They can cause damage to fruit trees, garden plants and commercial grain crops.

Distribution[edit]

The meadow vole has the widest distribution of any North American species of Microtus. It ranges from Labrador west to Alaska and south from Labrador and New Brunswick to South Carolina and extreme northeastern Georgia; east through Tennessee, Missouri, north-central Nebraska, the northern half of Wyoming, and central Washington to Alaska; south through Idaho into north-central Utah. It is excluded only from the extreme polar regions. A disjunct subset of its range occurs from central Colorado to northwestern New Mexico.[2][3] The United States portion of the Souris River is alternately known as the Mouse River because of the large numbers of field mice that lived along its banks.

Plant communities[edit]

Meadow voles are most commonly found in grasslands, preferring moister areas, but are also found in wooded areas.[3]

In eastern Washington and northern Idaho, meadow voles are found in relative abundance in sedge (Carex spp.) fens but not in adjacent cedar (Thuja spp.)-hemlock (Tsuga spp.), Douglas-fir (Pseudotsuga menziesii), or ponderosa pine (Pinus ponderosa) forests. Meadow voles are also absent from fescue (Festuca spp.)-snowberry (Symphoricarpos spp.) associations. Moisture may be a major factor in habitat use; possibly the presence of free water is a deciding factor. In southeastern Montana meadow voles were the second most abundant small mammal (after deer mice (Peromyscus maniculatus)) in riparian areas within big sagebrush (Artemisia tridentata)-buffalo grass (Buchloe dactyloides) habitats.[4] Meadow voles are listed as riparian-dependent vertebrates in the Snake River drainage of Wyoming. In a compilation of 11 studies[5] on small mammals, meadow voles were reported in only three of 29 sites in subalpine forests of the central Rocky Mountains. Their range extensions were likely to be related to irrigation practices.[6] They are now common in hayfields, pastures, and along ditches in the Rocky Mountain states.[7]

Meadow vole

In Pipestone National Monument, Minnesota, meadow voles were present in riparian shrublands, tallgrass prairie, and other habitats.[8] In east-central Ohio, meadow voles were captured in reconstructed common cattail (Typha latifolia) wetlands.[9] In Virginia, meadow voles were least abundant in eastern red cedar (Juniperus virginiana) glades and most abundant in fields with dense grass cover.[10]

Habits[edit]

Meadow voles are active year-round[11][12] and day or night, with no clear 24-hour rhythm in many areas.[13] Most changes in activity are imposed by season, habitat, cover, temperature, and other factors. Meadow voles have to eat frequently, and their active periods (every two to three hours) are associated with food digestion.[11][12] In Canada, meadow voles are active the first few hours after dawn and during the two- to four-hour period before sunset. Most of the inactive period is spent in the nest.[12]

Reproduction[edit]

Gestation lasts 20 to 23 days.[12] Neonates are pink and hairless, with closed eyes and ears. Fur begins to appear by three days, and young are completely furred except for the belly by seven days. Eyes and ears open by eight days. Weaning occurs from 12 to 14 days. Young born in spring and early summer attain adult weight in 12 weeks, but undergo a fall weight loss. Young born in late summer continue growing through the fall and maintain their weight through the winter. Maximum size is reached between two and 10 months.[3][12]

Typical meadow vole litters consist of four to six young, with extremes of one and 11 young. On average 2.6 young are successfully weaned per litter. Litter size is not significantly correlated with latitude, elevation, or population density. Fall, winter, and spring litters tend to be smaller than summer litters. Litter size was positively correlated with body size, and is not significantly different in primaparous and multiparous females.[3] Primaparous females had fewer young per litter than multiparous females.[12] Litter size was constant in summer breeding periods at different population densities.[3] Female meadow voles reach reproductive maturity earlier than males; some ovulate and become pregnant as early as three weeks old. Males are usually six to eight weeks old before mature sperm are produced.[12] One captive female produced 17 litters in one year for a total of 83 young. One of her young produced 13 litters (totalling 78 young) before she was a year old.,[14] !-- not this species If breeding began in April, an estimated 100 pairs of montane voles (Microtus montanus) in 40 acres could create a density of 8,900 voles by September.[15]

A young meadow vole in the open

Patterns of mortality apparently vary among meadow vole populations. The average meadow vole lifespan is less than one month because of high nestling and juvenile mortality.[11] The average time adults are recapturable in a given habitat is about two months, suggesting the average extended lifespan (i.e. how much time adult meadow voles have left) is about two months, not figuring in emigration.[11] Mortality was 88% for the first 30 days after birth,.[16] and postnestling juveniles had the highest mortality rate (61%), followed by young adults (58%) and older age groups (53%).[17] Nestlings were estimated to have the lowest mortality rate (50%). Estimated mean longevity ranges from two to 16 months.[3] The maximum lifespan in the wild is 16 months,[11] and few voles live more than two years.[12]

Meadow vole populations fluctuate annually and also tend to reach peak densities at two- to five-year intervals, with population declines in intervening years.[11][12][18] Breeding often ceases in January and starts again in March.[12] Over the course of a year, meadow vole populations tend to be lowest in early spring; the population increases rapidly through summer and fall.[12]

In years of average population sizes, typical meadow vole population density is about 15 to 45 meadow voles per acre in old-field habitat. In peak years, their population densities may reach 150 per acre in marsh habitat (more favorable for meadow voles than old fields).[11] Peak meadow vole abundance can exceed 1,482 meadow voles per acre (600/ha) in northern prairie wetlands.[19] Meadow voles in optimal habitats in Virginia (old fields with dense vegetation) reached densities of 983 per acre (398/ha); populations declined to 67 per acre (27/ha) at the lowest point in the cycle.[10] Different factors influencing population density have been assigned primary importance by different authors. Reich[3] listed the following factors as having been suggested by different authors: food quality, predation, climatic events, density-related physiological stress, and the presence of genetically determined behavioral variants among dispersing individuals.

Normal population cycles do not occur when dispersal is prevented; under normal conditions, dispersers have been shown to be behaviorally, genetically, and demographically different from residents.[3] A threshold density of cover is thought to be needed for meadow vole populations to increase.[20] Above the threshold amount, the quantity of cover influences the amplitude and possibly the duration of the population peak. Local patches of dense cover could serve as source populations or reservoirs to colonize less favorable habitats with sparse cover.[20]

Meadow voles form extensive colonies and develop communal latrine areas. They are socially aggressive and agonistic; females dominate males and males fight amongst themselves.[11]

Habitat[edit]

Optimal meadow vole habitat consists of moist, dense grassland with substantial amounts of plant litter. Habitat selection is largely influenced by relative ground cover of grasses and forbs; soil temperature, moisture, sodium, potassium, and pH levels; humidity; and interspecific competition.[20][21] Meadow voles are most commonly associated with sites having high soil moisture.[22] They are often restricted to the wetter microsites when they occur in sympatry with prairie voles (Microtus ochrogaster) or montane voles.[20] In an Iowa prairie restoration project, meadow voles experienced an initial population increase during the initial stage of vegetation succession (old field dominated by foxtail grass (Setaria spp.), red clover (Trifolium pratense), annual ragweed (Ambrosia artemisiifolia), alfalfa (Medicago sativa), and thistles Cirsium spp.). However, populations reached their peak abundance during the perennial grass stage of succession from old field to tallgrass prairie.[23] Meadow vole habitat devoid of tree cover and grasses dominated the herb layer.[24] with low tolerance for habitat variation (i. e., a species that is intolerant of variations in habitat, is restricted to few habitats, and/or uses habitats less evenly than tolerant species).[24]

Meadow vole on the ground amid strands of grass in Virginia, USA

In most areas, meadow voles clearly prefer habitat with dense vegetation. In tallgrass prairie at Pipestone National Monument, they were positively associated with dense vegetation and litter.[8] The variables important to meadow vole habitat in Virginia include vegetative cover reaching a height of 8 to 16 inches (20–41 cm) and presence of litter.[25] Meadow voles appeared to be randomly distributed within a grassland habitat in southern Quebec.[26] Grant and Morris[26] were not able to establish any association of meadow vole abundance with particular plant species. They were also unable to distinguish between food and cover as the determining factor in meadow vole association with dense vegetation.

In eastern Massachusetts, meadow vole density on a mosaic of grassy fields and mixed woods was positively correlated with decreasing vertical woody stem density and decreasing shrub cover. Density was highest on plots with more forbs and grasses and less with woody cover; meadow voles preferred woody cover over sparse vegetation where grassy cover was not available.[27]

In West Virginia, the only forested habitats in which meadow voles were captured were seedling stands.[28] In South Dakota, meadow voles prefer grasslands to Rocky Mountain juniper (Juniperus scopulorum) woodlands.[29] In New Mexico, meadow voles were captured in stands of grasses, wild rose (Rosa spp.), prickly pear (Opuntia spp.), and various forbs; meadow voles were also captured in wet areas with tall marsh grasses.[30]

Open habitat with a thick mat of perennial grass favors voles.[31] In west-central Illinois, they were the most common small mammals on Indian grass (Sorghastrum nutans)-dominated and switchgrass (Panicum virginicus)-dominated study plots. They were present in very low numbers on orchard grass (Dactylis glomerata)-dominated plots. The most stable population occurred on unburned big bluestem (Andropogon gerardii)-dominated plots.[32] In Ontario, meadow voles and white-footed mice (Peromyscus leucopus) occur together in ecotones. Meadow voles were the most common small mammals in oak savanna/tallgrass prairie dominated by northern pin oak (Quercus palustris) and grasses including bluejoint reedgrass (Calamagrostis canadensis), prairie cordgrass (Spartina pectinata), big bluestem, switchgrass, and Indian grass.

In Michigan, strip clearcuts in a conifer swamp resulted in an increase in the relative abundance of meadow voles. They were most abundant in clearcut strip interiors and least abundant in uncut strip interiors. Slash burning did not appear to affect meadow vole numbers about 1.5 years after treatment.[33]

In Pennsylvania, three subadult meadow voles were captured at least 1.6 miles (2.6 km) from the nearest appreciable suitable meadow vole habitat, suggesting they are adapted to long-distance dispersal.[34]

In Ohio, the effects of patch shape and proportion of edge were investigated by mowing strips between study plots. The square plots were 132 feet per side (40 m x 40 m), and the rectangular patches were 52.8 feet by 330 feet (16 m x 100 m). Square habitat patches were not significantly different from rectangular patches in meadow vole density. Edge effects in patches of this size were not found, suggesting meadow voles are edge-tolerant. Habitat patch shape did affect dispersal and space use behaviors. In rectangular patches, home ranges were similar in size to those in square patches, but were elongated.[35]

Meadow voles tend to remain in home ranges and defend at least a portion of their home ranges from conspecifics. Home ranges overlap and have irregular shapes.[12] Home range size depends on season, habitat, and population density: ranges are larger in summer than winter, those in marshes are larger than in meadows, and are smaller at higher population densities.[3] Home ranges vary in size from 0.08 to 2.3 acres (0.32-0.9 ha). Females have smaller home ranges than males, but are more highly territorial than males; often, juveniles from one litter are still present in the adult female's home range when the next litter is born.[11][12] Female territoriality tends to determine density in suboptimal habitats; the amount of available forage may be the determining factor in female territory size, so determines reproductive success.[36]

Cover requirements[edit]

Nests are used as nurseries, resting areas, and as protection against weather. They are constructed of woven grass; they are usually subterranean or are constructed under boards, rocks, logs, brush piles, hay bales, fenceposts, or in grassy tussocks. Meadow voles dig shallow burrows,[12] and in burrows, nests are constructed in enlarged chambers. In winter, nests are often constructed on the ground surface under a covering of snow, usually against some natural formation such as a rock or log.[11][12]

Meadow voles form runways or paths in dense grasses.[11][12]

Diets[edit]

Meadow voles eat most available species of grasses, sedges, and forbs, including many agricultural plant species.[3][12] In summer and fall, grasses are cut into match-length sections to reach the succulent portions of the leaves and seedheads. Leaves, flowers, and fruits of forbs are also typical components of the summer diet. Fungi, primarily endogones (Endogone spp.), have been reported in meadow vole diets. They occasionally consume insects and snails, and occasionally scavenge on animal remains; cannibalism is frequent in periods of high population density. Meadow voles may damage woody vegetation by girdling when population density is high.[3]

In winter, meadow voles consume green basal portions of grass plants, often hidden under snow. Other winter diet components include seeds, roots, and bulbs. They occasionally strip the bark from woody plants. Seeds and tubers are stored in nests and burrows.[11][12] Evidence of coprophagy is sparse, but thought to occur.[12]

In an old-field community in Quebec, plants preferred by meadow voles included quackgrass (Elytrigia repens), sedges, fescues (Festuca spp.), wild strawberry (Fragaria virginiana), timothy (Phleum pratense), bluegrasses (Poa spp.), and bird vetch (Vicia cracca).[37]

Predators[edit]

Meadow voles are an important prey for many hawks, owls, and mammalian carnivores, and they are also taken by some snakes.[3] Almost all species of raptors take microtine (Microtus spp.) rodents as prey. Birds not usually considered predators of mice do take voles; examples include gulls (Larus spp.), northern shrike (Larius borealis), black-billed magpie (Pica pica), common raven (Corvus corvax), American crow (C. brachyrhynchos), great blue heron (Ardea herodias), and American bittern (Botaurus lentiginosus).[12] In Ohio, meadow voles comprised 90% of the individual prey remains in long-eared owl (Asio otus) pellets on a relict wet prairie,[38] and in Wisconsin, meadow voles comprised 95% of short-eared owl (A. flammeus) prey.[39] Most mammalian predators take microtine prey.[12] The American short-tailed shrew (Blarina brevicauda) is major predator; meadow voles avoid areas frequented by short-tailed shrews.[3] Other major mammalian predators include the badger (Taxidea taxus), striped skunk (Mephitis mephitis), weasels (Mustela spp.), marten (Martes americana), and domestic cat (Felis catus). Other animals reported to have ingested voles include trout (Salmo spp.), Pacific giant salamander (Dicampton ensatus), garter snake (Thamnophis spp.), yellow-bellied racer (Coluber constrictor flaviventris), gopher snake (Pituophis melanoleucas), rattlesnake (Crotalus viridis), and rubber boa (Charina bottae).[12]

In northern prairie wetlands, meadow voles are a large portion of the diets of red fox (Vulpes vulpes), mink (Mustela vison), short-eared owl, and northern harrier (Circus cyaneus).[19] Voles (Microtus spp.) are frequently taken by racers (Coluber spp.); racers and voles often use the same burrows.[40]

Management[edit]

Meadow voles are abundant in agricultural habitats. The list of crops damaged by meadow voles includes root and stem crops (asparagus, kohlrabi), tubers, leaf and leafstalks, immature inflorescent vegetables (artichoke, broccoli), low-growing fruits (beans, squash), the bark of fruit trees, pasture, grassland, hay, and grains.[12] Meadow voles are listed as pests on forest plantations.[41] In forest plantations in British Columbia, an apparently abundant (not measured) meadow vole population was associated with a high rate of "not sufficient regeneration"; damage to tree seedlings was attributed to meadow voles and lemmings (Synaptomys spp.).[42] In central New York, colonization of old fields by trees and shrubs was reduced due to seedling predation by meadow voles, particularly under the herb canopy.[43]

Management of meadow vole populations in agricultural areas includes reduction of habitat in waste places such as roadsides and fencerows by mowing, plowing, and herbicide application. Predators, particularly raptors, should be protected to keep meadow vole populations in check. Direct control methods include trapping, fencing, and poisoning; trapping and fencing are of limited effectiveness. Poisons are efficient. Repellents are largely ineffective at present.[12] Plastic mesh cylinders were effective in preventing seedling damage by meadow voles and other rodents.[44] Properly timed cultivation and controlled fires are at least partially effective in reducing populations.

The cycle of meadow vole abundance is an important proximate factor affecting the life histories of its major predators. Meadow voles are usually the most abundant small mammals in northern prairie wetlands, often exceeding 40% of all individual small mammals present.[19] Numbers of short-eared owls, northern harriers, rough-legged hawks (Buteo lagopus), coyotes (Canis latrans), and red foxes were related to large numbers of meadow voles in a field in Wisconsin.[39] Predator numbers are positively associated with meadow vole abundance.[12][45]

Ecto- and endoparasites have been reported to include trematodes, cestodes, nematodes, acanthocephalans, lice (Anoplura), fleas (Siphonaptera), Diptera, and ticks and mites (Acari).[3][12]

Human diseases transmitted by microtine rodents include cystic hydatid disease, tularemia, bubonic plague, babesiosis, giardiasis[12] and the Lyme disease spirochete Borrelia burgdorferi. [46]

Ecological importance[edit]

As with many other small mammal species, M. pennsylvanicus plays important ecological roles.[47] The meadow vole is an important food source for many predators, and disperses mycorrhizal fungi. It is a major consumer of grass and disperses grass nutrients in its feces.[47] After disruptive site disturbances such as forest or meadow fires, the meadow vole's activities contribute to habitat restoration.[47] It prefers open, nonforest habitats and colonizes such open areas created by fire or other clearing disturbances. Very few meadow voles are found in forest or woodland areas. In newly opened areas, it is quite abundant.[47] In these new open areas, the vole quickly becomes a food source for predators.[48]

See also[edit]

Notes[edit]

 This article incorporates public domain material from the United States Department of Agriculture document "Microtus pennsylvanicus".

  1. ^ Linzey, A.V. & Hammerson, G. (2008). "Microtus pennsylvanicus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 4 February 2010. 
  2. ^ Askham, Leonard R. 1992. Voles. In: Black, Hugh C., ed. "Silvicultural approaches to animal damage management in Pacific Northwest forests". Gen. Tech. Rep. PNW-GTR-287. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 187-204.
  3. ^ a b c d e f g h i j k l m n Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8.
  4. ^ MacCracken, James G.; Uresk, Daniel W.; Hansen, Richard M. 1985. "Rodent-vegetation relationships in southeastern Montana". Northwest Science. 59(4): 272-278; 1985.
  5. ^ Raphael, Martin G. 1987. "Nongame wildlife research in subalpine forests of the central Rocky Mountains". In: Management of subalpine forests: building on 50 years of research: Proceedings of a technical conference; 1987 July 6–9; Silver Creek, CO. Gen. Tech. Rep. RM-149. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 113-122.
  6. ^ Davis, W. B. 1939. Recent mammals of Idaho. Caldwell, ID: Caxton Printers Ltd.
  7. ^ Hoffman, George R. 1960. "The small mammal components of six climax plant associations in eastern Washington and northern Idaho". Ecology. 41(3): 571-572.
  8. ^ a b Snyder, Ellen J.; Best, Louis B. 1988. "Dynamics of habitat use by small mammals in prairie communities". The American Midland Naturalist. 119(1): 128-136.
  9. ^ Lacki, Michael J.; Hummer, Joseph W.; Webster, Harold J. 1991. "Effect of reclamation technique on mammal communities inhabiting wetlands on mined lands in east-central Ohio". Ohio Journal of Science. 91(4): 154-158.
  10. ^ a b Linzey, Alicia V.; Cranford, Jack A. 1984. "Habitat selection in the southern bog lemming, Synaptomys cooperi, and the meadow vole, Microtus pennsylvanicus, in Virginia". Canadian Field-Naturalist. 98: 463-469.
  11. ^ a b c d e f g h i j k l Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press.
  12. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa Johnson, Murray L.; Johnson, Sherry. 1982. "Voles: Microtus species". In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 326-354.
  13. ^ Webster, A. Bruce; Brooks, Ronald J. 1981. "Daily movements and short activity periods of free-ranging meadow voles Microtus pennsylvanicus". Oikos. 37(1): 80-87.
  14. ^ Bailey, Vernon. 1924. "Breeding, feeding, and other life habits of meadow mice (Microtus)". Journal of Agricultural Research. 27(8): 523-536.
  15. ^ Negus, Norman C.; Pinter, Aelita J. 1965. "Litter sizes of Microtus montanus in the laboratory". Journal of Mammalogy. 46(3): 434-445.
  16. ^ Getz, Lowell L. 1960. A population study of the vole, Microtus pennsylvanicus. The American Midland Naturalist. 64: 392-405.
  17. ^ Golley, Frank B. 1961. Interaction of natality, mortality and movement during one annual cycle in a Microtus population. The American Midland Naturalist. 66(1): 152-159.
  18. ^ Krebs, Charles J.; Myers, Judith H. 1974. "Population cycles in small mammals". In: MacFadyen, A, ed. Advances in ecological research: volume 8. Advances in ecological research. London: Academic Press: 267-399.
  19. ^ a b c Fritzell, Erik K. 1989. "Mammals in prairie wetlands". In: Vander Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 268-301.
  20. ^ a b c d Birney, Elmer C.; Grant, W. E.; Baird, Donna Day. 1976. "Importance of vegetative cover to cycles of Microtus populations". Ecology. 57(5): 1043-1051.
  21. ^ Schramm, Peter; Clover, Catherine A. 1994. "A dramatic increase of the meadow jumping mouse (Zapus hudsonius) in a post-drought, restored, tallgrass prairie". In: Wickett, Robert G.; Lewis, Patricia Dolan; Woodliffe, Allen; Pratt, Paul, eds. Spirit of the land, our prairie legacy: Proceedings, 13th North American prairie conference; 1992 August 6–9; Windsor, ON. Windsor, ON: Department of Parks and Recreation: 81-86.
  22. ^ Pendleton, G. W. 1984. Small mammals in prairie wetlands: habitat use and the effects of wetland modification. Brookings, SD: South Dakota State University. Thesis
  23. ^ Schwartz, Orlando A.; Whitson, Paul D. 1986. "A 12-year study of vegetation and mammal succession on a reconstructed tallgrass prairie in Iowa". The American Midland Naturalist. 117(2): 240-249.
  24. ^ a b Geier, Anthony R.; Best, Louis B. 1980. "Habitat selection by small mammals of riparian communities: evaluating effects of habitat alterations". Journal of Wildlife Management. 44(1): 16-24.
  25. ^ Conley, Walt; Tipton, Alan R.; Kukila, Susan. 1976. "Habitat preference in Microtus pennsylvanicus: a preliminary multivariate analysis". Virginia Journal of Science. 27(2): 43.
  26. ^ a b Grant, P. R.; Morris, Ralph D. 1971. "The distribution of Microtus pennsylvanicus within grassland habitat". Canadian Journal of Zoology. 49(7): 1043-1052.
  27. ^ Adler, Gregory H. 1988. "The role of habitat structure in organizing small mammal populations and communities". In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19–21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 289-299.
  28. ^ Brooks, Robert T.; Healy, William M. 1988. "Response of small mammal communities to silvicultural treatments in eastern hardwood forests of West Virginia and Massachusetts". In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America; 1988 July 19–21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 313-318.
  29. ^ Sieg, Carolyn Hull. 1988. "The value of Rocky Mountain juniper (Juniperus scopulorum) woodlands in South Dakota as small mammal habitat". In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19–21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 328-332.
  30. ^ Finley, Robert B., Jr. 1986. "Distributions and habitats of voles in southeastern Colorado and northeastern New Mexico". The Southwestern Naturalist. 31(2): 263-266.
  31. ^ M'Closkey, Robert T.; Hecnar, Stephen J. 1994. "Small mammals of the Ojibway Prairie Provincial Nature Reserve, Windsor, Ontario". In: Wickett, Robert G.; Lewis, Patricia Dolan; Woodliffe, Allen; Pratt, Paul, eds. Spirit of the land, our prairie legacy: Proceedings, 13th North American prairie conference; 1992 August 6–9; Windsor, ON. Windsor, ON: Department of Parks and Recreation: 75-80.
  32. ^ Moreth, Louis H.; Schramm, Peter. 1973. "A comparative survey of small mammal populations in various grassland habitats with emphasis on restored prairie". In: Hulbert, Lloyd C., ed. Third Midwest prairie conference pr; 1972 September 22–23; Manhattan, KS. Manhattan, KS: Kansas State University, Division of Biology: 79-84.
  33. ^ Verme, Louis J.; Ozoga, John J. 1981. "Changes in small mammal populations following clear-cutting in upper Michigan conifer swamps". Canadian Field-Naturalist. 95(3): 253-256.
  34. ^ Kirkland, Gordon L., Jr. 1988. "Meadow voles (Microtus pennsylvanicus) on forest clearcuts: the role of long-distance dispersal". Journal of the Pennsylvania Academy of Science. 62(2): 83-85.
  35. ^ Harper, Steven J.; Bollinger, Eric K.; Barrett, Gary W. 1993. "Effects of habitat patch shape on population dynamics of meadow voles (Microtus pennsylvanicus)". Journal of Mammalogy. 74(4): 1045-1055.
  36. ^ Jones, Eric N. 1990. "Effects of forage availability on home range and population density of Microtus pennsylvanicus". Journal of Mammalogy. 71(3): 382-389.
  37. ^ Bergeron, Jean-Marie; Jodoin, Louise. 1989. "Patterns of resource use, food quality, and health status of voles (Microtus pennsylvanicus) trapped from fluctuating populations". Oecologia. 79: 306-314.
  38. ^ Osborn, Eric D.; Hoagstrom, Carl W. 1989. "Small mammals of a relict wet prairie in Ohio". In: Bragg, Thomas B.; Stubbendieck, James, eds. Prairie pioneers: ecology, history and culture: Proceedings, 11th North American prairie conference; 1988 August 7–11; Lincoln, NE. Lincoln, NE: University of Nebraska: 247-250.
  39. ^ a b Evrard, James O.; Snobl, DeWayne A.; Doeneir, Paul B.; Dechant, Jill A. 1991. "Nesting short-eared owls and voles in St. Croix County". Passenger Pigeon. 53(3): 223-226.
  40. ^ Madison, Dale M. 1978. "Behavioral and sociochemical susceptibility of meadow voles (Microtus pennsylvanicus) to snake predators". The American Midland Naturalist. 100(1): 23-28.
  41. ^ Askham, Leonard R. 1992. "Voles". In: Black, Hugh C., ed. Silvicultural approaches to animal damage management in Pacific Northwest forests. Gen. Tech. Rep. PNW-GTR-287. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 187-204.
  42. ^ Sullivan, Thomas P.; Martin, Wayne L. 1991. "Influence of site factors on incidence of vole and lemming feeding damage to forest plantations". Western Journal of Applied Forestry. 6(3): 64-67.
  43. ^ Gill, David S.; Marks, P. L. 1991. "Tree and shrub seedling colonization of old fields in central New York". Ecological Monographs. 61(2): 183-205.
  44. ^ Pauls, Ronald W. 1986. "Protection with vexar cylinders from damage by meadow voles of tree and shrub seedlings in northeastern Alberta". In: Salmon, Terrell P.; Marsh, Rex E.; Beadle, Dorothy E., eds. Proceedings--12th vertebrate pest conference; 1986 March 4–6; San Diego, CA. Davis, CA: University of California: 199-204.
  45. ^ Walley, W. J. 1972. "Summer observations of the short-eared owl in the Red River Valley". Prairie Naturalist. 4(2): 39-41.
  46. ^ http://www.ncbi.nlm.nih.gov/pubmed/9775612
  47. ^ a b c d Lautenschlager, R.A., Sullivan, T. P., Wagner, R. G. (1999). Clearcutting and burning of northern spruce-fir forests: implications for small mammal communities. Journal of Applied Ecology vol. 36 issue 3, pages 327–344.
  48. ^ Cantú-Salazar, L; Hidalgo-Mihart, M. G.; González-Romero, A.; López-González, C. A. (2004). Historical and present distribution of coyote (Canis latrans) in Mexico and Central. America Journal of Biogeography vol. 31, issue 12, pages 2025–2038.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes M. nesophilus and M. provectus, island populations that formerly were regarded as distinct species (see Modi 1986; Musser and Carleton, in Wilson and Reeder 1993, 2005). Microtus breweri from Muskeget Island, Massachusetts, sometimes has been included in this species; see Moyer et al. (1988) for recent study of relationships between these two taxa. Microtus pennsylvanicus has been proposed as conspecific with Old World M. agrestis, but chromosome differences support their recognition as distinct species (see Musser and Carleton).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: marsh

The currently accepted scientific name for meadow vole is Microtus
pennsylvanicus (Ord)[27,48,67]. Subspecies include:

Microtus pennsylvanicus chihuahuensis, Chihuahuan meadow vole [48,67]
Microtus pennsylvanicus dukecampbelli, Florida salt marsh vole [67]
Microtus pennsylvanicus kincaidi, potholes meadow vole [48]
Microtus pennsylvanicus pennsylvanicus, meadow vole [48,67]
Microtus pennsylvanicus provectus, Block Island meadow vole
Microtus pennsylvanicus shattucki, Penobscot meadow vole [48]
  • 48. Reich, Lawrence M. 1981. Microtus pennsylvanicus. Mammalian Species. No. 159: 1-8. [23129]
  • 27. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]
  • 67. ITIS Database. 2013. Integrated taxonomic information system, [Online]. Available: http://www.itis.gov/index.html. [51763]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

meadow vole
meadow mouse
field mouse

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!