Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Southern Red-backed Voles, like other voles, are active year-round. They do not hibernate or reduce their metabolism and enter a state of torpor to conserve energy against the cold. They breed from March through November, producing two or three litters of 4-5 young each year. By three months of age, the young voles are sexually mature and ready to reproduce. This species is semi-fossorial, using burrow systems built by other rodents and natural aboveground runways through logs, rocks, and roots of trees.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: In Gapper, Dr., 1830.  Observations on the quadrupeds found in the district of upper Canada extending between York and Lake Simcoe, with the view of illustrating their geographical distribution, as well as describing some species hitherto unnoticed, p. 204.  The Zoological Journal, 5:201-207.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Red-backed voles, Myodes_gapperi, range from British Columbia to mainland Newfoundland and throughout the northern United States from the Rocky Mountains to the Appalachians.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely distributed in North America in forests of the Hudsonian and Canadian life zones. In the west, from British Columbia, Canada, south to Columbia River and in the Rocky Mountains south to southwestern Arizona and New Mexico in the United States. It ranges across Canada and southward in the mid-west to the northern Great Plains and in the east through the Appalachian Mountains to northern Georgia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red-backed voles, Myodes gapperi, range from British Columbia to mainland Newfoundland and throughout the northern United States from the Rocky Mountains to the Appalachians.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Most of forested Canada (northern British Columbia to Labrador) south through the Rocky Mountains to central New Mexico and east-central Arizona, northern Great Plains (to Iowa), northern Great Lakes, New England and Appalachian Mountains (to northern Georgia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The head and body of red-backed voles measure from 70 to 112 mm in length. The tail is an additional 25 to 60 mm. On average, they weigh 20.57 g, but individuals weighing between 6 and 42 g have been recorded. Red-backed voles have dense, long, soft fur in winter, and shorter, coarser fur in summer. They are dark gray, and have a reddish-brown stripe from head to tail along their backs. Their faces and sides are a lighter yellowish-brown, and their bellies can be dark gray to almost white. Males and females are similar in size and color. Young animals tend to be darker than adults.

Range mass: 6 to 42 g.

Average mass: 20.57 g.

Range length: 95 to 172 mm.

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The head and body length of red-backed voles varies between 70 and 112 mm. The tail is 25 to 60 mm long. Weights between 6 and 42 g have been recorded.

Red-backed voles have dense, long, soft fur in winter but this changes to shorter, coarser fur in summer. The general coloration above is dark gray with a pronounced chestnut brown stripe running along the back from head to tail. Face and sides appear yellowish brown and the underparts are dark slate gray to almost white. Males and females are similar in size and color, and young animals tend to be darker than adults.

Range mass: 6 to 42 g.

Average mass: 20.57 g.

Range length: 70 to 112 mm.

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 16 cm

Weight: 42 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 116-172 mm

Weight:
Range: 6-42 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Red-backed voles live mainly in coniferous forests. Although they prefer evergreens, these voles also live in deciduous or mixed coniferous/deciduous woods. Sometimes they live in tundra and bog habitats.

Red-backed voles build their nests under the roots of stumps, logs, or brush piles. Nests may also be located in holes or branches of trees high above the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Southern red-backed voles inhabit mesic areas in coniferous, deciduous, and mixed forests, with ground cover that includes stumps and logs. Mossy logs and tree roots in coniferous forests are optimal. Also found in muskegs, sedge marshes, mesic prairies, tundra and shrub habitats, and bogs within spruce and fir. Colonize clearcuttings in mesic habitats. Found on rock outcrops in some areas (e.g., Virginia). Often associated with abandoned stone walls (fences) in the northeastern United States. In Pennsylvania, abundance increased with forest fragmentation (Yahner 1992). Regarded as an ecological indicator of old-growth conditions in the Rocky Mountains. Also uses second-growth areas.

They nest under logs, stumps and roots and will use the burrows of moles and other small mammals. Breeds mid-January to late November; peak activity February-October. Gestation lasts 17-19 days. Litters size is one to nine (average 5.6 in Alberta, 6.5 in Colorado). Litters per year: one to four for young females, one to six for older females in Alberta; two per year in Colorado (young of year breed).

Home range varies from 0.25 to 3.5 acres (Merritt and Merritt 1978). Experimentation by Gillis and Nams (1998) suggests that populations separated by an inter-patch distance of 60-70 m would likely be isolated from one another. Mature females are territorial. Populations are noncyclic.

Southern red-backed voles feed chiefly on vegetation, seeds, nuts, fungi, some insects. Summer diet in Colorado (and much of western U.S.) consists almost entirely of fungi. They are mainly nocturnal, active year-long.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-backed voles inhabit cool, mossy and rocky boreal forests in both dry and moist areas. They also inhabit tundra and bogs. Coniferous forests are preferred habitat, although deciduous or mixed coniferous/deciduous woods are also accepted. Nests are generally constructed under the roots of stumps, logs, or brush piles, but may be located in holes or branches of trees high above the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers cool, mesic deciduous, coniferous, or mixed forests, especially areas with large amount of ground cover. Regarded as an ecological indicator of old-growth conditions in the Rocky Mountains. Also uses second-growth areas. Mossy logs and tree roots in coniferous forests are optimal. In the northern part of its range also found in muskegs, sedge marshes, shrubby habitats, and treed peatlands (Merritt, in Wilson and Ruff 1999). Often on rock outcrops in some areas (e.g., Virginia). Often associated with abandoned stone walls (fences) in the northeastern U.S. In Pennsylvania, abundance increased with forest fragmentation (Yahner 1992). Nests under logs, stumps and roots. Unlike Microtus, doesn't dig tunnels, but uses the burrows of moles and other small mammals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red-backed voles are omnivores, and their diet changes with the seasons. They eat leaves and shoots in the spring. Fruits and berries are eaten in the summer. Nuts and seeds are eaten during the fall. They also eat bark, roots, lichens, fungi, and insects. Red-baked voles sometimes store food in their nests for use in the winter, but they continue to look for seeds, tree roots, and bark under the snow.

Animal Foods: insects

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red-backed voles are opportunistic feeders and change their diet as the seasons progress. They eat leaf petioles and young shoots in the spring, add fruits and berries to their diet in the summer, and then switch to nuts and seeds in the autumn. They also consume some bark, roots, lichens, fungi, and insects. They sometimes store food in their nests for use in the winter when it becomes difficult to forage, although they continue to forage for seeds, tree roots, and bark under the snow.

Animal Foods: insects

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds chiefly on vegetation, seeds, nuts, fungi, some insects; summer diet in Colorado (and much of western U.S.) consists almost entirely of fungi.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Red-backed voles are prey to a variety of species. They also consume insects and plant materials, and may help disperse seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Red-backed voles are eaten by a number of predatory species. Strigiformes, Accipitriformes, Mustelidae, Ursus americanus, Lynx canadensis, Lynx rufus, Canis latrans, Vulpes vulpes, and Canis lupus are all likely predators of these small rodents.

Known Predators:

  • Canada lynx, Lynx_canadensis
  • bobcats, Lynx_rufus
  • coyotes, Canis_latrans
  • wolves, Canis_lupus
  • black bears, Ursus_americanus
  • foxes, Vulpes_vulpes
  • owls, Strigiformes
  • hawks, Accipitriformes
  • mustelids, Mustelidae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

These animals are likely to play some role in local food webs. As a prey item, these voles provide food for many other species. As predators, they may have a great impact on some insect populations. In addition, they help to disperse seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Red-backed voles are almost certainly eaten by a number of predatory species. Owls, hawks, mustelids, black bears, Canada lynx, bobcats, coyotes, foxes, and wolves are all likely predators of these small rodents.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Disperses viable spores of mycorrhizal fungi and nitrogen-fixing bacteria (see Maser and Maser 1988).

Home range varies from 0.25 to 3.5 acres (Merritt and Merritt 1978). Experimentation by Gillis and Nams (1998) suggests that populations separated by an inter-patch distance of 60-70 m likely would be isolated from one another. Mature females are territorial. Populations noncyclic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in red-backed voles has not been well studied. However, they can hear, and vocalizations are sometimes used to communicate. When they are disturbed, red-backed voles make a chirplike bark that can be heard 1 to 2 m away. They also gnash or chatter their teeth.

Visual cues such as body posture may be of some importance in interactions with other voles. Scents may also help these voles to communicate. It is likely that some information is transmitted through scents in the urine or associated with reproduction. Tactile communication is important in fighting, as well as in the relationship between a mother and her young.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Communication in these animals has not been thoroughly described. Some vocalizations are used. When disturbed, red-backed voles utter a chirplike bark that can be heard 1 to 2 m away. They also gnash or chatter their teeth.

In addition, visual cues such as body posture may be of some importance in interactions with members of the same species.

The role of chemical signals in these animals remains unknown, although it is likley that some information is transmitted through scents.

Tactile communication is important in aggression, as well as in the relationship between a mother and her offspring.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal, active year-long.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Red-backed voles can live 20 months in the wild. However, most voles only live as long as 12 to 18 months

Range lifespan

Status: wild:
20 (high) months.

Typical lifespan

Status: wild:
12 to 18 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Red-backed voles can live in the wild to be 20 months. However, most voles only live as long as 12 to 18 months

Range lifespan

Status: wild:
20 (high) months.

Typical lifespan

Status: wild:
12 to 18 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of red-backed voles has not been described.

Red-backed voles breed in all but the coldest months. Mating occurs from March until November. A healthy female can rear 2 or 3 litters in a year. Pregnancy lasts 17 to 19 days. Litters can have from 1 to 11 young, although 3 to 7 is more typcial.

Red-backed voles are naked and blind when they are born. They develop quickly and are able to stand by the time they are 4 days old. Babies gain fur by 8 days of age and open their eyes by 15 days. Mothers stop nursing their young when they are 17 to 21 days old. It is likley that young voles become independent around this time. Red-backed voles are able to reproduce at around 3 months of age.

Breeding interval: Breeding of red-backed voles occurs every 1.5 months during warm weather.

Breeding season: Breeding season of red-backed voles extends from March through November.

Range number of offspring: 1 to 11.

Average number of offspring: 3 to 7.

Range gestation period: 17 to 19 days.

Range weaning age: 17 to 21 days.

Average age at sexual or reproductive maturity (female): 3 months.

Average age at sexual or reproductive maturity (male): 3 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Little is known about the parental behavior of red-backed voles. Mothers nurse their young for 17 to 21 days after birth. They also shelter their babies in a protective nest. It is not known whether males help to care for the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The mating system of these animals has not been described.

Breeding may begin as early as late winter and continue to late fall, so that females are generally able to rear 2 or 3 litters each year. Gestation is 17 to 19 days, and litter size is from 1 to 11 young, although the average is 3 to 7, depending on environmental conditions.

Offspring are born naked and blind. They are able to stand when 4 days old, have fur by day 8, open their eyes by 15 days and are weaned at 17 to 21 days. Sexual maturity occurs at approximately 3 months. Average life span in the wild is 10 to 12 months, with a maximum reported longevity of 20 months.

Breeding interval: Breeding occurs every 1.5 months during warm weather.

Breeding season: Breeding season extends from March through November.

Range number of offspring: 1 to 11.

Average number of offspring: 3-7.

Range gestation period: 17 to 19 days.

Range weaning age: 17 to 21 days.

Average age at sexual or reproductive maturity (female): 3 months.

Average age at sexual or reproductive maturity (male): 3 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

The parental behavior of these animals has not been described. However, because they are mammals, we know that the mother provides some care for the young. Mothers nurse their offspring for 17 to 21 days after birth, and provide the young with a protective nest in which to live. It is not known whether males help to care for the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mid-January to late November; peak activity February-October. Gestation lasts 17-19 days. Litters size is 1-9 (average 5.6 in Alberta, 6.5 in Colorado). Litters/year: 1-4 for young, 1-6 for older females in Alberta; 2/year in Colorado (young of year breed).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myodes gapperi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 55 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACNTTATATNTCNTATTTGGGGCGTGAGCAGGAATAGTCGGGACAGCCCTAAGCATCGTAATTCGAGCGGAACTTGGGCAACCAGGTGCTCTATTAGGTGACGACCAAATTTATAATGTAGTGGTCACAGCCCACGCATTTGTTATAGTTTTCTTCATAGTAATACCAATAATAATCGGCGGGTTCGGTAACTGACTAGTCCCGCTAATAATTGGAGCCCCCGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTTCTACCCCCATCATTCCTTCTTCTCTTAGCCTCATCCATAGTAGAAGCAGGAGCTGGAACTGGCTGAACAGTTTACCCACCACTAGCCGGCAATTTAGCACACGCAGGAGCATCCGTAGACCTAACCATTTTTTCCCTGCACCTAGCAGGAGTCTCATCAATTTTAGGCGCCATTAACTTCATCACTACTATTATCAATATAAAACCACCAGCCATAACACAATATCAAACCCCCTTGTTCGTATGATCAGTCCTCATTAATGCTGTACTCCTCCTCCTCTCCCTCCCAGTCTTAGCCGCAGGCATTACAATACTCCTAACTGACCGAAATCTAAATACTACCTTCTTTGACCCAGCCGGAGGCGGTGACCCCCTTTTATACCAACACCTATGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myodes gapperi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 136
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Populations of red-backed voles often fluctuate widely from year to year but with no apparent periodicity. Numbers are fairly low in most of the species range, however, with an average of approximately 2 to 3 voles per acre in favorable habitat.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because it is widespread, common, and there are no major threats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Populations of Myodes gapperi often fluctuate widely from year to year but with no apparent periodicity. Numbers are fairly low in most of the species range, however, with an average of approximately 2 to 3 voles per acre in favorable habitat.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The Kentucky red-backed vole (C. gapperi maurus) is Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common and widespread (NatureServe). Density estimates range from 0 to 65/ha, depending on season and location.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is not of conservation concern and its range includes many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red-backed voles may damage or kill tree seedlings, and they also eat a large number of seeds. This has been of little economic importance to humans, however.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-backed voles destroy harmful insect larvae and are also a major source of food for fur-bearing animals. Although some seeds are eaten, they are important agents in transporting and burying seeds in some areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Red-backed voles may damage or kill tree seedlings, and they also eat a large number of seeds. This has been of little economic importance to humans, however.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-backed voles destroy harmful insect larvae and are also a major source of food for fur-bearing animals. They have been found to be important in some areas as agents in transporting and burying seeds, although some seeds are obviously eaten.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern red-backed vole

The southern red-backed vole or Gapper's red-backed vole (Myodes gapperi) is a small slender vole found in Canada and the northern United States. It is closely related to the western red-backed vole (Myodes californius), which lives to the south and west of its range and which is less red with a less sharply bicolored tail.

These voles have short slender bodies with a reddish band along the back and a short tail. The sides of the body and head are grey and the underparts are paler. There is a grey color morph in the northeast part of their range. They are 12–16.5 cm (4.7–6.5 in) long with a 4 cm tail)[2] and weigh about 6–42 g; average 20.6 g (0.21–1.48 oz; average 0.72 oz).[3]

These animals are found in coniferous, deciduous, and mixed forests, often near wetlands. They use runways through the surface growth in warm weather and tunnel through the snow in winter. They are omnivorous feeding on green plants, underground fungi, seeds, nuts, roots, also insects, snails, and berries.[2] They store roots, bulbs, and nuts for later use.

Predators include hawks, owls, and mustelids.

Female voles have two to four litters of two to eight young in a year.[2]

They are active year-round, mostly at night. They use underground burrows created by other small animals.

References

  1. ^ Linzey, A.V. & NatureServe (Hammerson, G.) (2008). Myodes gapperi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 June 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b c Southern Red-backed Vole, borealforest.org
  3. ^ Southern Red-backed Vole, Animal Diversity Web
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes subspecies occidentalis and caurinus, which formerly were included in the species now known as Myodes californicus. Some authors have suggested that rutilis and gapperi are conspecific, but this has not been accepted by most authorities (Jones et al. 1992; Musser and Carleton, in Wilson and Reeder 1993, 2005).

See Musser and Carleton (in Wilson and Reeder 2005) for an extensive discussion of the basis for correcting the generic name from Clethrionomys to Myodes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!