Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Feral house cats, Felis catus, are often overlooked in discussions of exotic nuisance animals due to their ubiquity and our familiarity with them as companion animals. They are, however, among the most ecologically damaging introduced animals worldwide.Domestic cats are characterized by a number of well-known physical characteristics. These include a flexible and compact body, keen eyesight and adaptations for visual acuity at night, retractable claws, sharp teeth and a reduction in numbers of teeth (e.g., the hind chewing teeth) reflecting adaptation as a carnivore, long vibrissae (whiskers), and a long and flexible tail important as an aid to balance (LaBruna 2001, ISSG).F. catus is among the smaller members of the felid family, but shares with other family members the trait of being an agile and efficient predator.
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Felis catus can be found on every continent except Antarctica, generally in human populated areas. This species can be found on a large number islands as well. Their nearly global distribution can be attributed their domestication by humans; however, there is a large global feral population as well.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); oriental (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: holarctic ; cosmopolitan

  • Wilkins, K. 2007. Cats. Neptune City, NJ: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Feral populations occur worldwide in terrestrial habitats, including all main Hawaiian Islands, though populations are small or absent where winter climate severe. The Old World wild cat, from which the domestic cat originated, ranges widely throughout the Palearctic region, from Scotland to South Africa and from Morocco to central and southern China.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Domestic Felis catus are believed to be the results of several millennia of human domestication of one or both of two closely related wild species, the European wild cat, Felis silvestris (probable ancestral line), and the African wild cat Felis lybica. The area of original domestication is believed to be centered in or around Egypt.Domestic and escaped feral F. catus are now distributed worldwide, notwithstanding a few isolated islands where the species has either not been introduced by humans or has failed to become established (La Bruna 2001). Feral Felis catus are well-established throughout the state, including the 6 India River Lagoon watershed counties. A number of feral cat colonies comprised of often large numbers of so-called "TNR" cats (individuals that have been trapped, neutered or spayed, and released into the colony population) are also located in the India River Lagoon region.
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Felis catus most likely originated from African wild cats or Asian desert cats. Although both species have the same number of chromosomes as Felis catus, Asian desert cats are common around human settlements and are easily tamed. There are over 100 breeds of domestic cats but all have a very similar body shape and size. Adult mass ranges from 4.1 to 5.4 kg, and average length is 76.2 cm. Interbreed variation is defined based on coat type and coloration or patterning of the fur. Domestic cat have approximately 244 bones in their body, of which about 30 are vertebrae (the number can vary depending upon the length of cat). With so many vertebrae in their spine, cats are very flexible and can rotate half of their spine 180°. They are capable of jumped five times their own height and are able to slip through narrow spaces because they have no collar bone and their scapula lie medially on their body. Each forelimb (i.e., manus) has five digits and the hindlimbs (i.e., pes) have four. Polydactyly is not uncommon among house cats. They have retractable claws on each paw, which typically do not extend when the animal walks. They have 26 teeth that usually develop within the first year. The dental formula for this species is 3/3, 1/1, 2/2, 1/1. When kittens are about two weeks old they develop deciduous or milk teeth above the gums. By the end of the fourth month the milk incisors are replaced by permanent teeth.

Range mass: 4.1 to 5.4 kg.

Average length: 76.2 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

  • Davison, A. 1947. Mammalian Anatomy With Special Reference To The Cat. Toronto: The Blackiston Company.
  • Edwards, A. 2009. Cats, Cat Breeds, & Cat Care. London, England: Southwater, Anness Publishing Ltd..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

The life expectancy of feral cats is considerably shorter than that of their house-kept counterparts, between 2 and 3 years of age for feral animals versus 10-15 years or longer for house cats.The average head and body length of adult Felis catus is around 46 cm and the tail length averages around 30 cm. Adult feral cats typically weigh 3.3-4.5 kg, with males being at the larger end of the range and females at the lower end (ISSG).
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

The only felids native to Florida are the bobcat, Lynx rufus and the highly endangered Florida panther, Puma concolor coryi. Bobcats grow to around twice as large as Felis catus, and their distinctive black bar-shaped markings on the forelegs and black-tipped, stump tail allow easy differentiation between the species. Confusing a feral domestic cat for a Florida panther is unlikely.
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Domestic cats primarily live in areas of human habitation and are somewhat constrained to developed areas. Most feral populations live in close proximity to current or past human settlements.

Habitat Regions: temperate ; terrestrial

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mainly in or not far from areas inhabited by humans but also in natural habitats up to several miles from a village or town.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Domestic cats are carnivorous, and a healthy diet consists of about 30 to 35% muscle meat, 30% carbohydrates, and 8 to 10% fats, which promote growth and healthy skin and coat. Feral cats may hunt for rodents or birds. Most domestic cats depend on human supplied feed. Adult females require around 200 to 300 calories per day, whereas adult males need between 250 and 300 calories per day. In order to kill their prey, all felids bite the back of the neck at the base of the skull, thus, severing the spinal chord from the brain stem. Primary prey for feral animals includes small rodents, birds, fish, and some arthropods. Occasionally, domestic cats ingest plant material to fulfill fiber deficiencies.

Animal Foods: birds; mammals; fish; insects

Plant Foods: leaves

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet of feral populations dominated by rodents, rabbits, and/or birds; also eats lizards and arthropods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Felis catus is a predatory carnivore that readily preys on birds and small mammals as well as reptiles, and amphibians. La Bruna (2001) suggests that house cats have retained their instinctive hunting skills to insure that specific nutritional requirements for fresh animal protein are met.
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Domestic cats are great pest control agents for rodents in and around areas of human habitation. Cats can become infected with hookworm (Ancylostoma and Uncinaria) larvae either from ingested food or from penetration through the skin. Once infection occurs, hookworms travel to the lungs and then to the intestines where they develop into adults and attach to the intestinal walls. Hookworm infestation can cause anemia and if left untreated can result in blood in the feces and eventually death. Roundworms (Toxascaris leonina and Toxocara cati), the most common parasites among house cats, may infect cats when they eat rodents. Approximately 25% to 75% of the global cat population is estimated to be infected with roundworms. Roundworms also live and develop in the intestine where females produce eggs that are excreted with feces. Infection can result in intestinal blockage and death. Sometimes, larvae from domestic cats can be passed onto humans causing visceral larval migrans and ocular larval migrans. Cats can become infected with tapeworms during grooming by ingesting larvae or eggs or by eating infected rodents. Controlling infection is highly successful with the aid of medications from veterinarians. Tapeworms rarely cause significant illness or death in domestic cats.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Domestic cats have no predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Association between Felis catus and human caregivers has occurred for perhaps 4,000 years.Invasion History: Domestication of Felis silvestris and possibly Felis lybica began around 4,000 years ago in Egypt. Domesticated Felis cattus can readily interbreed with both of these to form viable (fertile) offspring. In fact, recent mitochondrial DNA studies suggest that both F. lybica and F. cattus shuld be considered subspecies of F. silvestris.Human-aided spread of Felis cattus was facilitated both by the animals' beneficial mousing skills and the fact that Egypt was an important trading port in the ancient world. The Egyptians took cats with them on shipping vessels to keep rodent populations in check, and they likely introduced domestic cats to Europe in this manner. In turn, expansion of the Roman Empire and, later, European missionary zeal facilitated the spread of domestic cats into Asia and beyond.Modern house cats keep feral cat numbers high through escapes and through high fecundity and multiple estrous cycles of females. Potential to Compete With Natives: La Bruna (2001) estimates that over a half-billion birds a year are killed in the U.S. by a combined feral and outdoor-kept cat population estimated at more than 90-million animals. Dewey (2005) notes Felis cattushas been directly responsible for declines in a number of bird and mammal populations, especially small, island populations. Possible Economic Consequences of Invasion: Domestic house cats have significant positive economic value for companionship and for vermin control. In the feral Felis catus population, however, these positives are outweighed by the ecoolgical damage these animals can cause.In addition to the ecological impacts, Felis cattus carries a number of diseases that are transmissible to humans, including rabies, cat-scratch fever, and various parasitic infections (Dewey, 2005). Efforts to manage feral cat populations are costly, and the partial solution of TNR feral cat colonies is controversial.F. cattus species has been nominated as among 100 of the "World's Worst" invaders by the Invasive Species Specialist Group (ISSG).
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Felis silvestris catus (Felis catus) preys on:
Anolis evermanni
Anolis gundlachi
Rattus rattus
Coereba flaveola
Geotrygon montana

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

There are an estimated 10 million owned house cats in Florida. The Florida Fish and Wildlife Conservation Commission has estimated that the feral cat population in Florida is roughly on the same order, i.e., between 6 to 10 million animals (FWCC 2001).The estimated U.S. population of feral cats is 60 million (ISSG).
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Turner and Bateson (1988) for information on social behavior. In Brooklyn, New York, cat distribution varied with availability of shelter, not dependent on food supply (Calhoon and Haspel 1989); home range averaged 2-3 ha (Haspel and Calhoon 1989). Feral populations may attain densities of up to a few hundred per sq. km (Kitchener 1991). Coleman (1992) estimated a density of 33/sq. km in rural sections of one Wisconsin county.

See Tomich (1986) for brief overview of literature regarding feral cat populations throughout the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Body language and vocalizations are ways in which domestic cats communicate with conspecifics. Relaxed individuals often have their ears forward and whiskers relaxed. Adults display contentedness via purring. Kittens also purr and knead or prod when content and suckling their mother. Domestic cats also "meow", which changes meaning in relation to posture. If a cat is upset it will likely growl, hiss, or even spit at another cat or animal. In general , cats have advanced auditory perception. Their pinna can rotate 180° to either face frontward or be flattened back or any direction in between. With three inner ear cannals in each of the three dimensional planes, domestic cats have a great sense of balance. Their ears are sensitive enough to hear ten octaves, which is two more than a human can hear. Domestic cats can hear a broad range of frequencies, from 50 to 65 kilohertz, versus humans which can only hear sounds between 18 and 20 kilohertz. They have vabrissae on the muzzle, eyebrows, and elbows which function as haptic receptors. These touch receptors allow house cats to navigate their way around obstacles in low light conditions by sensing changes in air flow around an object as it approaches it.

Peripheral vision in domestic cats is very good but their eyes are also farsighted (an adaptation for hunting), which doesn't allow them to focus on objects within a 2 feet. A reflective membrane in the back of the eye, called the tapetum lucidum, reflects light from behind the eye's retina and intensifies it. Species possessing tapetum lucidum are able to see exceptionally well in low light. Cats cannot see most colors, although some researchers believe that they may be able to see red and blue. The third eyelid, or haw, is a semi-transparent protective lid which typically retracts into the inner corner of the eye.

With about 200 million olfactory cells, the domestic cat's nose is about thirty times more sensitive than that of humans. Jacobson's organ (i.e., the vomeronasal organ) is located immediately dorsal to the hard palate and is particularly exposed to scent molecules when an individual inhales via the mouth.

A domestic cat's tongue is covered in hundreds of papillae; hook-like structures, which face backwards and are used to comb and clean the fur. Domestic cats sometimes socially groom, but typically grooming is a singular task unless the cat is the individual's mother. Taste buds are located on the sides, tip, and back of the tongue and allow domestic cats to perceive bitter, acidic and salty flavors but not sweet.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: mimicry ; pheromones ; scent marks

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: In Brooklyn, New York, nighttime activity peaked at 0100 h and at sunrise; activity levels declined throughout fall and increased in spring (Haspel and Calhoon 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information available regarding the average lifespan of domestic cats in the wild. Captive individuals, however, are expected to live for approximately 14 years.

Average lifespan

Status: captivity:
14 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (captivity) Observations: Domestic cats descend from wild cats (*Felis silvestris*). There are conflicting reports concerning the longevity of cats and estimating their maximum longevity is difficult and error-prone. The oldest cat is reportedly "Creme Puff," a 37 year-old animal in Texas, USA (http://www.guinnessworldrecords.com/), but the accuracy of this record has not been confirmed. Cats do appear to occasionally live more than 30 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

For outdoor and indoor cats

My children want to know if it's true that domestic cats that are allowed to go outdoors have a shorter lifespan than those that are kept indoors for their whole lives.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Matt Matcuk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

House cats are polygynandrous, as both males and females have multiple mates throughout the year.

Mating System: polygynandrous (promiscuous)

Unless pregnant, female house cats go into estrus approximately every 21 days during breeding season, which occurs from March to September in the Northern hemisphere and from October to March in the southern hemisphere. Male house cats patrol territories in search of estrus females during mating season. Estrus females call loudly to potential mates, while continually rolling on the ground. When a potential mate arrives, females present their rumps, which lets the male know they are in estrus. When a pair meets, they may mate many times over a few hours before parting ways. Females have induced ovulation which is stimulated by copulation. Gestation ranges from 60 to 67 days. Average litter size has not been documented for this species; however, as many as 18 kittens in a single litter has been reported. Neonate mass ranges from 110 to 125 g. Most kittens are weaned by 7 to 8 weeks after birth and are completely independent by 12 weeks. Females are reproductively mature by 6 months, and males are reproductively mature by 8 months.

Breeding interval: Females go into oestrus approximately every 21 days during the breeding season unless mated.

Breeding season: March to September in the Northern Hemishpere or October to March in the Southern Hemisphere

Range number of offspring: 18 (high) .

Range gestation period: 60 to 67 days.

Range birth mass: 110 to 125 g.

Range weaning age: 7 to 8 weeks.

Average time to independence: 12 weeks.

Average age at sexual or reproductive maturity (female): 6 months.

Average age at sexual or reproductive maturity (male): 8 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; viviparous

House cat kittens are cared for by their mothers, and paternal care is virtually non-existent. In some cases, unrelated females may aid new mothers by caring for and nursing her kittens while she hunts. This behavior is rare, however, and often mothers are forced to leave their kittens unguarded while hunting. Mothers also purr to their kittends, which is thought to kitten stress levels. Females nurse their kittens until around 8 weeks after birth, when weaning is completed. Prior to independence, kittens learn how to hunt by mimicking their mother. Mothers also take an active role in teaching their young how to hunt by allowing them to hunt only very small animals, such as small mice. Kittens are not permitted to hunt larger prey, such as rats, right away. Weaning is usually complete by 7 to 8 weeks; however, kittens do not leave their mother until they are 6 to 8 months old, depending on sex.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Cornell University College of Veterinary Medicine. 2011. "Health Topics" (On-line). Accessed April 23, 2011 at https://jeppesen.augsburg.edu/atmail/parse.php?redirect=http://www.vet.cornell.edu/fhc/healthinfo/healthtopics.cfm.
  • Leyhausen, P. 1979. Cat Behavior The Predatory and Social Behavior of Domestic and Wild Cats. New York, New York: Garland STPM Press.
  • Morris, D. 1987. Cat Watching: Why cats purr and everything else you ever wanted to know.. New York, NY: Crown Publishers, Inc..
  • Wilkins, K. 2007. Cats. Neptune City, NJ: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As with all mammals, reproduction in Felis catus is sexual and fertilization is internal. Reproduction occurs year-round where resource availability permits.Relative to other members of the mammalian order Carnivora, F. catus exhibits a high fecundity. This is largely related to the rapid onset of sexual maturity in females, typically between 7-12 months of age, and the capacity for females to come into estrous as often as 5 time a year (Ogan and Jurek 1997, Gunther and Terkel 2002). Females can produce as many as 3 litters in a year (Fitzwater 1994).
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Gestation lasts for 63-65 days. Litter size typically averages 4-6 young ( O'Donnell 2001).
  • Dewey T. 2005. Felis silvestris Animal Diversity Web. Available online.Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Nobuyuki Y, O'Brien S.J., and D.W. Macdonald2. 2007. The Near Eastern origin of cat domestication. Science 317:519-523.
  • Fitzwater W.D. 1994. House cats (feral): Prevention and control of wildlife damage. Cooperative Extension Division; Institute of Agriculture and Natural Resources, University of Nebraska- Lincoln, United States Department of Agriculture Animal and Plant Health Inspection
  • Gunther I., and J. Terkel J. 2002. Regulation of free-roaming cat (Felis silvestris catus) populations: A survey of the literature and its application to Israel. AnimalWelfare. 11:171-188.
  • Florida Fish and Wildlife Conservation Commission. 2001. impacts of feral and free-ranging domestic cats on wildlife in Florida. Public education document, published November 2001. 4 p.
  • LaBruna D. 2001. Introduced species summary project: Domestic Cat (Felis catus). Available online.
  • O'Donnell C. 2001. Slowing down A CAT-astrophe: Keeping pet cats indoor. Connecticut Audubon Society. Available online.
  • Ogan C.V., and Jurek R.M. 1997. Biology and ecology of feral, free-roaming and stray cats. Pages 87-92 in: J.E. Harris, and C.V. Ogan, (eds.). Mesocarnivores of northern California: Biology, management and survey techniques, workshop maual. 127 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tongue defeats gravity: cats
 

The tongue of the cat pulls liquid into its mouth by exploiting fluid inertia to beat gravity.

   
  "Animals have developed a range of drinking strategies depending on physiological and environmental constraints. Vertebrates with incomplete cheeks use their tongue to drink; the most common example is the lapping of cats and dogs. We show that the domestic cat (Felis catus) laps by a subtle mechanism based on water adhesion to the dorsal side of the tongue. A combined experimental and theoretical analysis reveals that Felis catus exploits fluid inertia to defeat gravity and pull liquid into the mouth. This competition between inertia and gravity sets the lapping frequency and yields a prediction for the dependence of frequency on animal mass. Measurements of lapping frequency across the family Felidae support this prediction, which suggests that the lapping mechanism is conserved among felines." (Reis et al. 2010)

Watch video
  Learn more about this functional adaptation.
  • Reis PM; Jung S; Aristoff JM; Stocker R. 2010. How cats lap: water uptake by Felis catus. Science. Online November 11: http://www.sciencemag.org/cgi/content/abstract/science.1195421:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Felis catus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GTENK015-11|PRJNA10703|Felis catus| AACCGGTGACTATTTTCAACTAATCACAAAGATATTGGTACTCTTTACCTTTTATTCGGTGCCTGAGCTGGCATGGTGGGGACTGCTCTT---AGTCTTCTAATCCGGGCCGAACTGGGCCAACCTGGTACACTACTAGGAGAT---GATCAGATTTACAATGTAATCGTCACTGCCCATGCTTTTGTAATGATCTTTTTTATGGTGATGCCTATTATAATTGGAGGGTTCGGAAACTGATTGGTCCCATTAATA---ATTGGAGCTCCTGACATAGCATTTCCCCGAATAAACAACATGAGCTTCTGACTCCTCCCTCCATCCTTTCTACTCTTACTCGCCTCATCTATGGTAGAAGCCGGAGCAGGAACTGGGTGAACAGTATACCCACCCCTAGCCGGCAACCTGGCTCATGCAGGAGCATCCGTAGACCTA---ACTATTTTTTCACTACACCTGGCAGGTGTCTCCTCAATCTTGGGTGCTATTAATTTCATTACTACTATTATTAATATAAAACCTCCTGCCATGTCCCAATATCAAACACCTCTATTTGTCTGATCAGTCTTAATCACTGCTGTCTTACTACTTCTATCACTTCCAGTCTTAGCAGCG---GGAATCACTATATTATTAACAGATCGAAACCTAAACACCACATTCTTTGACCCCGCTGGGGGAGGAGATCCTATCTTATACCAACACTTATTCTGATTCTTTGGCCATCCAGAAGTTTACATTTTAATCCTACCCGGTTTTGGGATAATCTCACATATTGTTACCTATTATTCAGGTAAAAAA---GAACCCTTTGGCTACATGGGAATAGTTTGAGCCATGATATCAATCGGCTTCCTGGGCTTTATCGTATGAGCCCATCACATGTTTACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Felis catus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 23
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Domestic cats are extremely abundant, and overpopulation is a major issue throughout various parts of their global distribution. Large population numbers and their natural predatory instincts has lead to the decline of numerous species of small vertebrates, including many species of bird

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Courchamp and Sugihara (1999) discussed the potential use of Feline Immunodeficinecy Virus and Feline Leukemia Virus to control feral cat populations (e.g., on islands where cats are a threat to native species). Both were deemed potentially useful, and culling may be more efficient when combined with virus introduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Domestic cats are extremely abundant and are overpopulated in many urban areas. Overpopulation is a major problem, and has become a significant economic burden in some locations. Feral cats can be a nuisance, and have decreased the abundance and diversity of bird communities at various locations across the globe. Feral cats have also been known to spread parasites and disease to domesticated individuals. Cats can also transmit parasites and disease to humans. For example, domestic cats can pass tapeworms, hookworms and possibly roundworms to humans.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aside from the benefit that humans receive from domestic cats as pets, domestic cats are used as model organisms for various biomedical research efforts and have been used as rodent pest control agents for thousands of years. It is likely that cats were first domesticated due to their usefulness as pest control agents. There has been a great deal of effort put into mapping the genome of domestic cats.

Positive Impacts: pet trade ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Identified as serious threat to nesting Newell's shearwater and Hawaiian (dark-rumped) petrel in Hawaii (Simons 1984). On western Mauna Kea, Hawaii, Amarasekare (1994) found no evidence that this species preys on eggs, young, or adults of endemic birds. Cats apparently have exterminated one (probably 2) endemic birds on Isla Socorro (Mexico); also preying on Townsend's shearwater (Jehl 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cat

The domestic cat[1][2] (Felis catus[2] or Felis silvestris catus)[4] is a small, usually furry, domesticated, carnivorous mammal. It is often called the housecat when kept as an indoor pet,[6] or simply the cat when there is no need to distinguish it from other felids and felines. Cats are valued by humans for companionship and ability to hunt vermin and household pests. They are primarily nocturnal.[7]

Cats are similar in anatomy to the other felids, with strong, flexible bodies, quick reflexes, sharp retractable claws, and teeth adapted to killing small prey. As crepuscular predators, cats use their acute hearing and ability to see in near darkness to locate prey. Not only can cats hear sounds too faint for human ears, they can also hear sounds higher in frequency than humans can perceive. This is because the usual prey of cats (particularly rodents such as mice) make high frequency noises, so the hearing of the cat has evolved to pinpoint these faint high-pitched sounds. Cats also have a much better sense of smell than humans.

Despite being solitary hunters, cats are a social species, and cat communication includes the use of a variety of vocalizations (meowing, purring, trilling, hissing, growling and grunting) as well as pheromones and types of cat-specific body language.[8]

Cats have a rapid breeding rate. Under controlled breeding, they can be bred and shown as registered pedigree pets, a hobby known as cat fancy. Failure to control the breeding of pet cats by spaying and neutering and the abandonment of former household pets has resulted in large numbers of feral cats worldwide, with a population of up to 60 million of these animals in the United States alone.[9]

Since cats were cult animals in ancient Egypt, it was commonly believed to have been domesticated there,[10] but there may have been instances of domestication as early as the Neolithic.[11] A genetic study in 2007 revealed that all house cats are descended from as few as five female African Wildcats (Felis silvestris lybica) c. 8000 BCE, in the Middle East.[10][12] Cats are currently the most popular pet in the world, now found almost everywhere in the world.[13]

Contents

Nomenclature and etymology

The English word cat (Old English catt) is in origin a loanword, introduced to many languages of Europe from Latin cattus and Byzantine Greek κάτια, including Portuguese and Spanish gato, French chat, German Katze, Lithuanian katė and Old Church Slavonic kotka, among others. The ultimate source of the word is Afro-Asiatic, presumably from Late Egyptian čaute, the feminine of čaus "African wildcat". The word was introduced (together with the domestic animal) to the Roman Republic by the 1st century BCE. An alternative word with cognates in many languages is English puss (pussycat). Attested only from the 16th century, it may have been introduced from Dutch poes or from Low German puuskatte, related to Swedish kattepus, or Norwegian pus, pusekatt. The etymology of this word is unknown, but it appears to reflect the native Germanic name of the animal.[14]

Classification based on human interaction[15]
PopulationFood sourceShelterSocialized
PedigreeFed by ownerHuman homesYes
PetFed by ownerHuman homesYes
Semi-feralGeneral feedingBuildingsYes
FeralGeneral feeding/foragingBuildingsNo

While wildcats are the ancestral species from which domestic cats are descended, there are several intermediate stages between domestic pet and pedigree cats and these entirely wild cats. The semi-feral cat is a cat that is not owned by any one individual, but is generally friendly to people and may be fed by several households. Feral cats are associated with human habitations and may be fed by people or forage in rubbish, but are wary of human interaction.[15]

A group of cats is referred to as a "clowder", a male cat is called a "tom" (or a "gib", if neutered), and a female is called a "molly" or "queen". The male progenitor of a cat, especially a pedigreed cat, is its "sire", and its female progenitor is its "dam". An immature cat is called a "kitten". In medieval Britain, the word kitten was interchangeable with the word catling.

A cat whose ancestry is formally registered is called a pedigreed cat, purebred cat, or a show cat. In strict terms, a pure-bred cat is one whose ancestry contains only individuals of the same breed. A pedigreed cat is one whose ancestry is recorded, but may have ancestors of different breeds. Cats of unrecorded mixed ancestry are referred to as domestic longhairs and domestic shorthairs or commonly as random-bred, moggies, mongrels, or mutt-cats.

Taxonomy and evolution

The wildcat Felis silvestris is a close relative and possible ancestor of the domestic cat.

The Felids are a rapidly evolving family of mammals that share a common ancestor only 10–15 million years ago,[16] and include, in addition to the domestic cat, lions, tigers, cougars, and many others. Within this family, domestic cats (Felis catus) are part of the genus Felis, which is a group of small cats containing seven species.[1][17] Members of the genus are found worldwide and include the Jungle Cat (Felis chaus) of southeast Asia, the African Wildcat (Felis silvestris lybica), the Chinese Mountain Cat (Felis bieti) and the Arabian Sand Cat (Felis margarita).[18]

All the cats in this genus share a common ancestor that probably lived around 6–7 million years ago in Asia.[19] Although the exact relationships within the Felidae are still uncertain,[20][21] both the Chinese Mountain Cat and the African Wildcat are close relatives of the domestic cat and are both classed as subspecies of the Wildcat Felis silvestris.[4][20] As domestic cats are little altered from wildcats, they can readily interbreed. This hybridization may pose a danger to the genetic distinctiveness of wildcat populations, particularly in Scotland and Hungary.[22]

The domestic cat was first classified as Felis catus by Carolus Linnaeus in the tenth edition of his Systema Naturae of 1758.[1][3] However, because of modern phylogenetics, domestic cats are now usually regarded as another subspecies of the Wildcat Felis silvestris.[1][4][23] This has resulted in mixed usage of the terms, as the domestic cat can be called by its subspecies name, Felis silvestris catus.[1][4][23] Wildcats have also been referred to as various subspecies of F. catus,[23] but in 2003 the International Commission on Zoological Nomenclature fixed the name for wildcats as F. silvestris.[24] The most common name in use for the domestic cat remains F. catus, following a convention for domesticated animals of using the earliest (the senior) synonym proposed.[24] Sometimes the domestic cat is called Felis domesticus[25] or Felis domestica,[1] the term coined by German naturalist Johann Christian Polycarp Erxleben in 1777. These are not valid taxonomic names, and Linnaeus's binomial takes precedence.[26]

Cats have either a mutualistic or commensal relationship with humans. However, in comparison to dogs, cats have not undergone major changes during the domestication process, as the form and behavior of the domestic cat are not radically different from those of wildcats, and domestic cats are perfectly capable of surviving in the wild.[27][28] This limited evolution during domestication means that domestic cats tend to interbreed freely with feral cats, which distinguishes them from other domesticated animals.[15] However, several natural behaviors and characteristics of wildcats may have preadapted them for domestication as pets.[28] These traits include their small size, social nature, obvious body language, love of play and relatively high intelligence;[29]:12–17 they may also have an inborn tendency towards tameness.[28]

There are two main theories about how cats were domesticated. In one, people deliberately tamed cats in a process of artificial selection, as they were useful predators of vermin.[30] However, this has been criticized as implausible, because there may have been little reward for such an effort: cats generally do not carry out commands and, although they do eat rodents, other species such as ferrets or terriers may be better at controlling these pests.[4] The alternative idea is that cats were simply tolerated by people and gradually diverged from their 'wild' relatives through natural selection, as they adapted to hunting the vermin found around humans in towns and villages.[4]

Genetics

Blue-eyed cats with white fur have a high incidence of genetic deafness.[31]

The domesticated cat and its closest wild ancestor are both diploid organisms that possess 38 chromosomes[32] and roughly 20,000 genes.[33] About 250 heritable genetic disorders have been identified in cats, many similar to human inborn errors.[34] The high level of similarity among the metabolisms of mammals allows many of these feline diseases to be diagnosed using genetic tests that were originally developed for use in humans, as well as the use of cats in the study of the human diseases.[35][36]

An example of a mutation that is shared among all felines, including the big cats, is a mutant chemosensor in their taste buds that prevents them from tasting sweetness, which may explain their indifference to fruits, berries, and other sugary foods.[37] In some breeds of cats congenital deafness is very common, with most white cats (but not albinos) being affected, particularly if they also have blue eyes.[31] The genes responsible for this defect are unknown, but the disease is studied in the hope that it may shed light on the causes of hereditary deafness in humans.[38]

Since a large variety of coat patterns exist within the various cat breeds, the cat is an excellent animal to study the coat genetics of hair growth and coloration.[39] Several genes interact to produce cats' hair color and coat patterns. Different combinations of these genes give different phenotypes. For example, the enzyme tyrosinase is needed to produce the dark pigment melanin and Burmese cats have a mutant form that is only active at low temperatures, resulting in color appearing only on the cooler ears, tail and paws.[40] A completely inactive gene for tyrosinase is found in albino cats, which therefore lack all pigment.[41] Hair length is determined by the gene for fibroblast growth factor 5, with inactive copies of this gene causing long hair.[42]

The Cat Genome Project, sponsored by the Laboratory of Genomic Diversity at the U.S. National Cancer Institute Frederick Cancer Research and Development Center in Frederick, Maryland, aims to help the development of the cat as an animal model for human hereditary and infectious diseases, as well as contributing to the understanding of the evolution of mammals.[36] This effort led to the publication in 2007 of an initial draft of the genome of an Abyssinian cat called Cinnamon.[33] The existence of a draft genome has led to the discovery of several cat disease genes,[33] and even allowed the development of cat genetic fingerprinting for use in forensics.[43]

Anatomy

Diagram of the general anatomy of a male

Domestic cats are similar in size to the other members of the genus Felis, typically weighing between 4 kilograms (8 lb 13 oz) and 5 kilograms (11 lb 0 oz).[20] However, some breeds, such as the Maine Coon, can exceed 11 kilograms (25 lb). Conversely, very small cats (less than 1.8 kilograms (3 lb 15 oz)) have been reported.[44] The world record for the largest cat is 21.297 kilograms (46 lb 15.2 oz).[45] The smallest adult cat ever officially recorded weighed around 1.36 kilograms (3 lb).[46] Cats average about 23–25 centimeters (9–10 in) in height and 46 centimeters (18.1 in) in head/body length (males being larger than females), with tails averaging 30 centimeters (11.8 in) in length.[47]

Cats have 7 cervical vertebrae like almost all mammals, 13 thoracic vertebrae (humans have 12), 7 lumbar vertebrae (humans have 5), 3 sacral vertebrae like most mammals (humans have 5 because of their bipedal posture), and a variable number of caudal vertebrae in the tail (humans retain 3 to 5 caudal vertebrae, fused into an internal coccyx).[48]:11 The extra lumbar and thoracic vertebrae account for the cat's spinal mobility and flexibility. Attached to the spine are 13 ribs, the shoulder, and the pelvis.[48] :16 Unlike human arms, cat forelimbs are attached to the shoulder by free-floating clavicle bones, which allow them to pass their body through any space into which they can fit their heads.[49]

Skull

The cat skull is unusual among mammals in having very large eye sockets and a powerful and specialized jaw.[50]:35 Within the jaw, cats have teeth adapted for killing prey and tearing meat. When it overpowers its prey, a cat delivers a lethal neck bite with its two long canine teeth, inserting them between two of the prey's vertebrae and severing its spinal cord, causing irreversible paralysis and death.[51] Compared to other felines, domestic cats have narrowly spaced canine teeth; which is an adaptation to their preferred prey of small rodents, which have small vertebrae.[51] The premolar and first molar together compose the carnassial pair on each side of the mouth, which efficiently shears meat into small pieces, like a pair of scissors. These are vital in feeding, since cats' small molars cannot chew food effectively.[50]:37

Cats, like dogs, are digitigrades. They walk directly on their toes, with the bones of their feet making up the lower part of the visible leg.[52] Cats are capable of walking very precisely, because like all felines they directly register; that is, they place each hind paw (almost) directly in the print of the corresponding forepaw, minimizing noise and visible tracks. This also provides sure footing for their hind paws when they navigate rough terrain. Unlike most mammals, when cats walk, they use a "pacing" gait; that is, they move the two legs on one side of the body before the legs on the other side. This trait is shared with camels and giraffes. As a walk speeds up into a trot, a cat's gait will change to be a "diagonal" gait, similar to other mammals: the diagonally opposite hind and forelegs will move simultaneously.[53]

Like almost all members of the Felidae family, cats have protractable claws.[54] In their normal, relaxed position the claws are sheathed with the skin and fur around the toe pads. This keeps the claws sharp by preventing wear from contact with the ground and allows the silent stalking of prey. The claws on the forefeet are typically sharper than those on the hind feet.[55] Cats can voluntarily extend their claws on one or more paws. They may extend their claws in hunting or self-defense, climbing, "kneading", or for extra traction on soft surfaces. Most cats have five claws on their front paws, and four on their rear paws.[56] The fifth front claw (the dewclaw) is proximal to the other claws. More proximally, there is a protrusion which appears to be a sixth "finger". This special feature of the front paws, on the inside of the wrists, is the carpal pad, also found on the paws of big cats and dogs. It has no function in normal walking, but is thought to be an anti-skidding device used while jumping. Some breeds of cats are prone to polydactylyism, and may have eight or even ten toes.[56] These are particularly common along the North-East coast of North America.[57]

Physiology

Normal physiological values[58]:330
Body temperature38.6 °C (101.5 °F)
Heart rate120–140 beats per minute
Breathing rate16–40 breaths per minute

As cats are familiar and easily kept animals, their physiology has been particularly well studied; it generally resembles that of other carnivorous mammals but displays several unusual features probably attributable to cats' descent from desert-dwelling species.[25] For instance, cats are able to tolerate quite high temperatures: humans generally start to feel uncomfortable when their skin temperature passes about 44.5 °C (112 °F), but cats show no discomfort until their skin reaches around 52 °C (126 °F),[50]:46 and can tolerate temperatures of up to 56 °C (133 °F) if they have access to water.[59]

Cats conserve heat by reducing the flow of blood to their skin and lose heat by evaporation through their mouth. They do not sweat, and pant only at very high temperatures.[60] Unusually, a cat's body temperature does not vary throughout the day; this is part of cats' general lack of circadian rhythms and may reflect their tendency to be active both during the day and at night.[61]:1 Cats' feces are usually dry and their urine is also highly concentrated, both of which are adaptations that allow cats to retain as much fluid as possible.[25] Their kidneys are so efficient that cats can survive on a diet consisting only of meat, with no additional water,[62] and can even rehydrate by drinking seawater.[61]:29[63]

Cats are obligate carnivores: their physiology has evolved to efficiently process meat, and they have difficulty digesting plant matter.[25] In contrast to omnivores such as rats, which only require about 4% protein in their diet, about 20% of a cat's diet must be protein.[25] Cats are unusually dependent on a constant supply of the amino acid arginine, and a diet lacking arginine causes marked weight loss and can be rapidly fatal.[64] Another unusual feature is that the cat also cannot produce the amino acid taurine, with taurine deficiency causing macular degeneration, where the cat's retina slowly degenerates, causing irreversible blindness.[25] Since cats tend to eat all of their prey, they obtain minerals by digesting animal bones, and a diet composed only of meat may cause calcium deficiency.[25]

A cat's digestive tract is also adapted to meat eating, being much shorter than that of omnivores and having low levels of several of the digestive enzymes that are needed to digest carbohydrates.[65] These traits severely limit the cat's ability to digest and use plant-derived nutrients, as well as certain fatty acids.[65] Despite the cat's meat-oriented physiology, several vegetarian or vegan cat foods have been marketed that are supplemented with chemically synthesized taurine and other nutrients, in attempts to produce a complete diet. However, some of these products still fail to provide all the nutrients that cats require,[66] and diets containing no animal products pose the risk of causing severe nutritional deficiencies.[67]

Senses

Cats have excellent night vision and can see at only one-sixth the light level required for human vision.[50]:43 This is partly the result of cat eyes having a tapetum lucidum, which reflects any light that passes through the retina back into the eye, thereby increasing the eye's sensitivity to dim light.[68] Another adaptation to dim light is the large pupils of cats' eyes. Unlike some big cats, such as tigers, domestic cats have slit pupils.[69] These slit pupils can focus bright light without chromatic aberration, and are needed since the domestic cat's pupils are much larger, relative to their eyes, than the pupils of the big cats.[69] Indeed, at low light levels a cat's pupils will expand to cover most of the exposed surface of its eyes.[70] However, domestic cats have rather poor color vision and (like most non-primate mammals) have only two types of cones, optimized for sensitivity to blue and yellowish green; they have limited ability to distinguish between red and green,[71] although they can achieve this in some conditions.[72]

Cats' whiskers are highly sensitive to touch.

Cats have excellent hearing and can detect an extremely broad range of frequencies. They can hear higher-pitched sounds than either dogs or humans, detecting frequencies from 55 Hz up to 79 kHz, a range of 10.5 octaves; while humans can only hear from 31 Hz up to 18 kHz, and dogs hear from 67 Hz to 44 kHz, which are both ranges of about 9 octaves.[73][74] Cats do not use this ability to hear ultrasound for communication but it is probably important in hunting,[75] since many species of rodents make ultrasonic calls.[76] Cat hearing is also extremely sensitive and is among the best of any mammal,[73] being most acute in the range of 500 Hz to 32 kHz.[77] This sensitivity is further enhanced by the cat's large movable outer ears (their pinnae), which both amplify sounds and help a cat sense the direction from which a noise is coming.[75]

Cats have an acute sense of smell, which is due in part to their well-developed olfactory bulb and also to a large surface of olfactory mucosa, in cats this mucosa is about 5.8 cm2 in area, which is about twice that of humans and only 1.7-fold less than the average dog.[78] Cats are very sensitive to pheromones such as 3-mercapto-3-methylbutan-1-ol,[79] which they use to communicate through urine spraying and marking with scent glands.[80] Cats also respond strongly to plants that contain nepetalactone, especially catnip, as they can detect that substance at less than one part per billion.[81] This response is also produced by other plants, such as Silver Vine and valerian, and may be caused by the smell of these plants mimicking a pheromone and stimulating cats' social or sexual behaviors.[82]

Cats have relatively few taste buds compared to humans. Owing to a mutation in an early cat ancestor, one of two genes necessary to taste sweetness may have been lost by the cat family.[37] Their taste buds instead respond to amino acids, bitter tastes and acids.[83] To aid with navigation and sensation, cats have dozens of movable vibrissae (whiskers) over their body, especially their face. These provide information on the width of gaps and on the location of objects in the dark, both by touching objects directly and by sensing air currents; they also trigger protective blink reflexes to protect the eyes from damage.[50]:47

Health

The average life expectancy for male indoor cats at birth is around 12 to 14 years,[84] with females usually living a year or two longer.[85] However, there have been reports of cats reaching into their 30s,[86] with the oldest known cat, Creme Puff, dying at a verified age of 38.[87] Feline life expectancy has increased significantly in recent decades.[88] Having a cat neutered or spayed confers some health benefits, since castrated males cannot develop testicular cancer, spayed females cannot develop uterine or ovarian cancer, and both have a reduced risk of mammary cancer.[89] The lifespan of feral cats is hard to determine accurately, although one study reported a median age of 4.7 years, with a range between 0 to 8.3 years.[90]

Diseases

Cats can suffer from a wide range of health problems, including infectious diseases, parasites, injuries and chronic disease. Vaccinations are available for many of these diseases, and domestic cats are regularly given treatments to eliminate parasites such as worms and fleas.

Poisoning

In addition to obvious dangers such as rodenticides, insecticides and weed killers, cats may be poisoned by many chemicals that are usually considered safe.[91] This is because their livers are less effective at some forms of detoxification than those of other animals, including humans and dogs.[25][92] Some of the most common causes of poisoning in cats are antifreeze and rodent baits.[93] It has also been suggested that cats may be particularly sensitive to environmental pollutants.[91][94] When a cat has a sudden or prolonged serious illness without any obvious cause, it is possible that it has been exposed to a toxin.[citation needed]

Human medicines should never be given to cats. For example, the painkiller paracetamol (also called acetaminophen, sold as Tylenol and Panadol) is extremely toxic to cats: even very small doses need immediate treatment and can be fatal.[95][96] Even aspirin, which is sometimes used to treat arthritis in cats, is much more toxic to them than to humans and must be administered cautiously.[91] Similarly, application of minoxidil (Rogaine) to the skin of cats, either accidentally or by well-meaning owners attempting to counter loss of fur, has sometimes been fatal.[97] Essential oils can be toxic to cats and there have been reported cases of serious illnesses caused by tea tree oil, and tea tree oil-based flea treatments and shampoos.[98]

Other common household substances that should be used with caution around cats include mothballs and other naphthalene products.[91] Phenol-based products (Pine-Sol, Dettol (Lysol) or hexachlorophene)[91] are often used for cleaning and disinfecting near cats' feeding areas or litter boxes but these can sometimes be fatal.[99] Ethylene glycol, often used as an automotive antifreeze, is particularly appealing to cats, and as little as a teaspoonful can be fatal.[100] Some human foods are toxic to cats; for example theobromine in chocolate can cause theobromine poisoning, although few cats will eat chocolate.[101] Large amounts of onions or garlic are also poisonous to cats.[91] Many houseplants are also dangerous,[102] such as Philodendron species and the leaves of the Easter Lily, which can cause permanent and life-threatening kidney damage.[103]

Behavior

Free-ranging cats are active both day and night, although they tend to be slightly more active at night.[104][105] The timing of cats' activity is quite flexible and varied, which means that house cats may be more active in the morning and evening (crepuscular behavior), as a response to greater human activity at these times.[106] House cats have territories that vary considerably in size, in one study ranging from seven to 28 hectares (69 acres).[105] Although they spend the majority of their time in the vicinity of their home, they can range many hundreds of meters from this central point.[105] Cats conserve energy by sleeping more than most animals, especially as they grow older. The daily duration of sleep varies, usually 12–16 hours, with 13–14 being the average. Some cats can sleep as much as 20 hours in a 24-hour period. The term cat nap refers to the cat's ability to fall asleep (lightly) for a brief period and has entered the English lexicon—someone who nods off for a few minutes is said to be "taking a cat nap". During sleep cats experience short periods of rapid eye movement sleep accompanied by muscle twitches, which suggests that they are dreaming.[107]

Sociability

Social grooming in a pair

Although wildcats are solitary, the social behavior of domestic cats is much more variable and ranges from widely dispersed individuals to feral cat colonies that form around a food source, based on groups of co-operating females.[108][109] Within such groups one cat is usually dominant over the others.[110] Each cat in a colony holds a distinct territory, with sexually active males having the largest territories, which are about ten times larger than those of female cats and may overlap with several females' territories.[80] These territories are marked by urine spraying, by rubbing objects at head height with secretions from facial glands and by defecation.[80] Between these territories are neutral areas where cats watch and greet one another without territorial conflicts. Outside these neutral areas, territory holders usually chase away stranger cats, at first by staring, hissing, and growling, and if that does not work, by short but noisy and violent attacks. Despite some cats cohabiting in colonies, cats do not have a social survival strategy, or a pack mentality and always hunt alone.[111]

Domestic cats use many vocalizations for communication, including purring, trilling, hissing, growling, snarling and several different forms of meowing.[8] In contrast, feral cats are generally silent.[112]:208 Their types of body language, including position of ears and tail, relaxation of whole body, and kneading of paws, are all indicators of mood. The tail and ears are particularly important social signal in cats, with a raised tail acting as a friendly greeting.[113][114] Tail raising also indicates the cat's position in the group's social hierarchy, with dominant individuals raising their tails less often than subordinate animals.[114] Nose-touching is also a common greeting and may be followed by social grooming, which is solicited by one of the cats raising and tilting its head.[109] However, some pet cats are poorly socialized. In particular older cats may show aggressiveness towards newly arrived kittens, which may include biting and scratching; this type of behavior is known as Feline Asocial Aggression.[115]

For cats, life in proximity with humans (and other animals kept by humans) amounts to a "symbiotic social adaptation". They may express great affection towards their human companions, especially if they imprint on them at a very young age and are treated with consistent affection. It has been suggested that, ethologically, the human keeper of a cat functions as a sort of surrogate for the cat's mother, and that adult domestic cats live their lives in a kind of extended kittenhood, a form of behavioral neoteny.[116] Conversely, the high-pitched purrs cats make to solicit food may mimic the cries of a hungry human infant, making them particularly hard for humans to ignore.[117]

Grooming

The hooked papillae on a cat's tongue act like a hairbrush to help clean and detangle fur.
Cats intimidate opponents by arching their backs, raising their fur, turning sideways, and hissing.

Cats are known for their cleanliness, spending many hours licking their coats.[118] The cat's tongue has backwards-facing spines about 500 micrometers long, which are called papillae. These are quite rigid, as they contain keratin.[119] These spines allow cats to groom themselves by licking their fur, with the rows of papillae acting like a hairbrush. Some cats, particularly longhaired cats, occasionally regurgitate hairballs of fur that have collected in their stomachs from grooming. These clumps of fur are usually sausage-shaped and about two to three centimeters long. Hairballs can be prevented with remedies that ease elimination of the hair through the gut, as well as regular grooming of the coat with a comb or stiff brush.[118] Some cats can develop a compulsive behavior known as psychogenic alopecia, or excessive grooming.[120]

Fighting

With domestic cats, males are more likely to fight than females.[121] With feral cats, the most common reason for cat fighting is competition between two males to mate with a female: here most fights will be won by the heavier male.[122] Another possible reason for fighting in domestic cats is the difficulty of establishing territories within a small home.[121] Female cats will also fight over territory or to defend their kittens. Spaying females and neutering males will decrease or eliminate this behavior in many cases, suggesting that the behavior is linked to sex hormones.

When fighting, cats make themselves appear more impressive and threatening by raising their fur and arching their backs, thus increasing their apparent size.[113] Often, the ears are pointed down and back to avoid damage to the inner ear and potentially listen for any changes behind them while focused forward. Attacks usually comprise powerful slaps to the face and body with the forepaws as well as bites, but serious damage is rare; usually the loser runs away with little more than a few scratches to the face, and sometimes the ears. Cats will also throw themselves to the ground in a defensive posture to rake their opponent's belly with their powerful hind legs.[123]

Normally, serious injuries from fighting will be limited to infections of scratches and bites, though these can occasionally kill cats if untreated. In addition, bites are probably the main route of transmission of feline immunodeficiency virus (FIV).[124] Sexually active males will usually be involved in many fights during their lives, and often have decidedly battered faces with obvious scars and cuts to the ears and nose.

Hunting and feeding

Cats feed on small prey, primarily birds and rodents.[125] Feral cats and house cats that are free-fed tend to consume many small meals in a single day, although the frequency and size of meals varies between individuals.[111] Cats use two hunting strategies, either stalking prey actively, or waiting in ambush until an animal comes close enough to be captured. Although it is not certain, the type of strategy used may depend on the prey species in the area, with for example, cats waiting in ambush outside burrows, but tending to actively stalk birds.[126]:153

Most breeds of cat have a noted fondness for settling in high places, or perching. In the wild, a higher place may serve as a concealed site from which to hunt; domestic cats may strike prey by pouncing from such a perch as a tree branch, as does a leopard.[127] Other possible explanations include that height gives the cat a better observation point, allowing it to survey its territory. During a fall from a high place, a cat can reflexively twist its body and right itself using its acute sense of balance and flexibility.[128] This is known as the cat's "righting reflex". It always rights itself in the same way, provided it has the time to do so, during a fall. The height required for this to occur is around 90 cm (3 feet). Cats without a tail also have this ability, since a cat mostly moves its hind legs and relies on conservation of angular momentum to set up for landing, and the tail is in fact little used for this feat.[129] This leads to the proverb "a cat always lands on its feet".

Eating a house sparrow.

One poorly understood element of cat hunting behavior is the presentation of prey to human owners. Ethologist Paul Leyhausen proposed that cats adopt humans into their social group, and share excess kill with others in the group according to the local pecking order, in which humans are placed at or near the top.[130] Anthropologist and animal scientist Desmond Morris, in his 1986 book Catwatching, suggests that when cats bring home mice or birds, they are teaching their human to hunt, or helping their human as if feeding "an elderly cat, or an inept kitten".[131] Morris's theory is inconsistent with the fact that male cats also bring home prey, despite males having no involvement with raising kittens.[126]:153

Domestic cats select food based on its temperature, smell and texture, strongly disliking chilled foods and responding most strongly to moist foods rich in amino acids, which are similar to meat.[67][111] Cats may reject novel flavors (a response termed neophobia) and learn quickly to avoid foods that have tasted unpleasant in the past.[111] They may also avoid sugary foods and milk; since they are lactose intolerant, these sugars are not easily digested and may cause soft stools or diarrhea.[111][132] They can also develop odd eating habits. Some cats like to eat or chew on other things, most commonly wool, but also plastic, paper, string, aluminum foil/Christmas tree tinsel, or even coal. This condition is called pica and can threaten their health, depending on the amount and toxicity of the items eaten.[133][134]

Since cats cannot fully close their lips around something to create suction, they use a lapping method with the tongue to draw liquid upwards into their mouths. Lapping at a rate of four times a second, the cat touches the smooth tip of its tongue to the surface of the water, and quickly retracts it, drawing water upwards.[135]

Play

Domestic cats, especially young kittens, are known for their love of play. This behavior mimics hunting and is important in helping kittens learn to stalk, capture, and kill prey.[136] Cats will also engage in play fighting, with each other and with humans. This behavior may be a way for cats to practice the skills needed for real combat, and might also reduce any fear they associate with launching attacks on other animals.[137]

Owing to the close similarity between play and hunting, cats prefer to play with objects that resemble prey, such as small furry toys that move rapidly, but rapidly lose interest (they become habituated) in a toy they have played with before.[138] Cats also tend to play with toys more when they are hungry.[139] String is often used as a toy, but if it is eaten it can become caught at the base of the cat's tongue and then move into the intestines, a medical emergency which can cause serious illness and death.[140] Owing to the risks posed by cats eating string, it is sometimes replaced with a laser pointer's dot, which cats may chase.[141] While concerns have been raised about the safety of these lasers, Professor John Marshall, an ophthalmologist at St Thomas' Hospital, has stated that it would be "virtually impossible" to blind a cat with a laser pointer.[142]

Reproduction

A newborn kitten
When cats mate, the tomcat (male) bites the scruff of the female's neck as she assumes a position conducive to mating known as lordosis behavior.

Female cats are seasonally polyestrous, which means they may have many periods of heat over the course of a year, the season beginning in spring and ending in late autumn. Heat periods occur about every two weeks and last about 4 to 7 days.[143] Multiple males will be attracted to a female in heat. The males will fight over her, and the victor wins the right to mate. At first, the female will reject the male, but eventually the female will allow the male to mate. The female will utter a loud yowl as the male pulls out of her. This is because a male cat's penis has a band of about 120–150 backwards-pointing spines, which are about one millimeter long;[144] upon withdrawal of the penis, the spines rake the walls of the female's vagina, which is a trigger for ovulation. This act also occurs to clear the vagina of other sperm in the context of a second (or more) mating, thus giving the later males a larger chance of conception.[citation needed]

After mating, the female will wash her vulva thoroughly. If a male attempts to mate with her at this point, the female will attack him. After about 20 to 30 minutes, once the female is finished grooming, the cycle will repeat.[143]

Because ovulation is not always triggered by a single mating, females may not be impregnated by the first male with which they mate.[145] Furthermore, cats are superfecund; that is, a female may mate with more than one male when she is in heat, with the result that different kittens in a litter may have different fathers.[143]

The gestation period for cats is between 64–67 days, with an average length of 66 days.[146] The size of a litter averages three to five kittens, with the first litter usually smaller than subsequent litters. Kittens are weaned at between six and seven weeks, and cats normally reach sexual maturity at 5–10 months (females) and to 5–7 months (males), although this can vary depending on breed.[143] Females can have two to three litters per year, so may produce up to 150 kittens in their breeding span of around ten years.[143]

Cats are ready to go to new homes at about 12 weeks old,[147] or when they are ready to leave their mother. Cats can be surgically sterilized (spayed or castrated) as early as 7 weeks to limit unwanted reproduction.[148] This surgery also prevents undesirable sex-related behavior, such as aggression, territory marking (spraying urine) in males and yowling (calling) in females. Traditionally, this surgery was performed at around six to nine months of age, but it is increasingly being performed prior to puberty, at about three to six months.[149] In the USA approximately 80% of household cats are neutered.[150]

Ecology

Habitats

A Black cat under the snow.

Cats are a cosmopolitan species and are found across much of the world.[27] They are extremely adaptable and are now present on all continents except Antarctica, and on 118 of the 131 main groups of islands – even on sub-Antarctic islands such as the Kerguelen Islands.[151][152] Feral cats can live in forests, grasslands, tundra, coastal areas, agricultural land, scrublands, urban areas and wetlands.[153] Their habitats even include small oceanic islands with no human inhabitants.[154] This ability to thrive in almost any terrestrial habitat has led to the cat's designation as one of the world's worst invasive species.[155] Despite this general adaptability, the close relatives of domestic cats, the African Wildcat (Felis silvestris lybica) and the Arabian Sand Cat (Felis margarita) both inhabit desert environments,[4] and domestic cats still show similar adaptations and behaviors.[25]

Impact on prey species

Young feral cat eating a cottontail rabbit.

To date, there are few scientific data available to assess the impact of cat predation on prey populations. Even well-fed domestic cats may hunt and kill, mainly catching small mammals, but also birds, amphibians, reptiles, fish and invertebrates.[125][156] Hunting by domestic cats may be contributing to the decline in the numbers of birds in urban areas, although the importance of this effect remains controversial.[157] In the wild, the introduction of feral cats during human settlement can threaten native species with extinction.[154] In many cases controlling or eliminating the populations of non-native cats can produce a rapid recovery in native animals.[158] However, the ecological role of introduced cats can be more complicated: for example, cats can control the numbers of rats, which also prey on birds' eggs and young, so in some cases eliminating a cat population can actually accelerate the decline of an endangered bird species in the presence of a mesopredator, controlled by cats.[159]

In the Southern Hemisphere, cats are a particular problem in landmasses such as Australasia, where cat species have never been native and there were few equivalent native medium-sized mammalian predators.[160] Native species such as the New Zealand Kakapo and the Australian Bettong, for example, tend to be more ecologically vulnerable and behaviorally "naive" to predation by feral cats.[161] Feral cats have had a major impact on these native species and have played a leading role in the endangerment and extinction of many animals.[162]

Cat numbers in the UK are growing annually and their abundance is far above the "natural" carrying capacity, because their population sizes are independent of their prey's dynamics: i.e. cats are "recreational" hunters.[163] Population densities can be as high as 2,000 individuals per km2[164] and the current trend is an increase of 0.5 million cats annually.

Impact on birds

The domestic cat is probably a significant predator of birds. Current UK assessments indicate that they may be accountable for an estimated 64.8 million bird deaths each year.[125] Certain species appear more susceptible than others; for example, 30% of house sparrow mortality is linked to the domestic cat.[165] In the recovery of ringed robins and dunnocks, it was also concluded that 31% of deaths were a result of cat predation.[166] The presence of larger carnivores such as coyotes which prey on cats and other small predators reduces the effect of predation by cats and other small predators such as opossums and raccoons on bird numbers and variety.[167] The proposal that cat populations will increase when the numbers of these top predators decline is called the mesopredator release hypothesis.

On islands, birds can contribute as much as 60% of a cat's diet.[168] In nearly all cases, however, the cat cannot be identified as the sole cause for reducing the numbers of island birds, and in some instances eradication of cats has caused a ‘mesopredator release’ effect;[169] where the suppression of top carnivores creates an abundance of smaller predators that cause a severe decline in their shared prey. Domestic cats are, however, known to be a contributing factor to the decline of many species; a factor that has ultimately led, in some cases, to extinction. The South Island Piopio, Chatham Islands Rail,[166] the Auckland Islands Merganser,[170] and the common diving petrel[171] are a few from a long list, with the most extreme case being the flightless Stephens Island Wren, which was driven to extinction only a few years after its discovery.[172][173]

Some of the same factors that have promoted adaptive radiation of island avifauna over evolutionary time appear to promote vulnerability to non-native species in modern time. The susceptibility inherent of many island birds is undoubtedly due to evolution in the absence of mainland predators, competitors, diseases and parasites. In addition to lower reproductive rates and extended incubation periods.[174] The loss of flight, or reduced flying ability is also characteristic of many island endemics.[175] These biological aspects have increased vulnerability to extinction in the presence of introduced species, such as the domestic cat.[176] Equally, behavioural traits exhibited by island species, such as "predatory naivety"[177] and ground-nesting,[174] have also contributed to their susceptibility.

Cats and humans

Girl with young cat

Cats are a common companion animal in Europe and North America, and their worldwide population exceeds 500 million.[10] In 1998 there were around 43 million cats in Western Europe, 33 million in Eastern Europe, seven million in Japan and three million in Australia.[126]:4 A 2007 report stated that about 37 million US households owned cats, with an average of 2.2 cats per household giving a total population of around 82 million.[178] In contrast, there are about 72 million pet dogs in that country.[178] Although cat ownership has commonly been associated with women,[179] a 2007 Gallup poll reported that men and women were equally likely to own a cat.[180] The ratio of pedigree/purebred cats to random-bred cats varies from country to country. However, generally speaking, purebreds are less than 10% of the total population.[181]

According to the Humane Society of the United States, as well as being kept as pets, cats are also used in the international fur trade.[182] Cat fur is used in coats, gloves, hats, shoes, blankets and stuffed toys. About 24 cats are needed to make a cat fur coat.[183] This use has now been outlawed in several countries, including the United States, Australia and the European Union.[184] However, some cat furs are still made into blankets in Switzerland as folk remedies that are believed to help rheumatism.[185]

It has long been common for cats to be eaten in some parts of China and in some other Asian countries and it is estimated that in southern China's Guangdong province people eat 10,000 cats per day.[186] Animal People estimates that 4 million cats are killed and consumed in Asia every year.[187]

Domesticated varieties

Domesticated Indian cats sleeping
Domesticated Indian cats sleeping

The concept of a cat breed appeared in Britain during the late 19th century.[188]:224 The current list of cat breeds is quite large: with the Cat Fanciers' Association recognizing 41 breeds, of which 16 are "natural breeds" that probably emerged before humans began breeding pedigree cats, while the others were developed over the latter half of the 20th century.[27] The owners and breeders of show cats compete to see whose animal bears the closest resemblance to the "ideal" definition and standard of the breed (see selective breeding). Because of common crossbreeding in populated areas, many cats are simply identified as belonging to the homogeneous breeds of domestic longhair and domestic shorthair, depending on their type of fur. In the United Kingdom and Australasia, non-purebred cats are referred in slang as moggies (derived from "Maggie", short for Margaret, reputed to have been a common name for cows and calves in 18th century England and latter applied to housecats during the Victorian era).[189] In the United States, a non-purebred cat is sometimes referred to as a barn or alley cat, even if it is not a stray.

A purebred chocolate Persian

Cats come in a variety of colors and patterns. These are physical properties and should not be confused with a breed of cat. Furthermore, cats may show the color and/or pattern particular to a certain breed without actually being of that breed. For example, cats may have point coloration, but not be Siamese.

Some original or natural breeds of cat that have a distinct phenotype that is the main type occurring naturally as the dominant domesticated cat type in their region of origin are sometimes considered as subspecies and also have received names as such in nomenclature, although this is not supported by feline biologists. Some of these cat breeds are:

  • Manx – a stocky, solid natural breed of cat originating on the Isle of Man, characterized primarily by lack of a tail or presence of a short tail, with a dense double coat (long or short), a compact body, short, rounded back, hind legs that are visibly longer than the front legs, big bones, a wide chest, and greater depth of flank (sides of the cat nearest the rear) than other cats.[190] A female Manx usually does not weigh more than 10 pounds (4.5 kg) and a male does not weigh over 12 pounds (5.4 kg). Specific to this breed is the way their ears appear as a "cradle" when looked at from behind. Because of the genetic mutation of these cats they are susceptible of developing what is colloquially called "Manx Syndrome", a condition that could be fatal for a kitten. Although the gene normally affects only the tail, there is the risk of developmental damage to the spine, such as fused vertebrae.
  • Siamese – among the firstly recognized Oriental cats, a type of cat with a long body but an elegant posture. The length is the main characteristic based on which these cats are distinguished. Their body, legs and tail are all long and still Siamese cats are known for their grace. Also, they are famous because of their blue almond eyes and they are also called "people cats" because of the affection they show to their owners.[191]
  • Chartreux is a natural French breed, which is easily recognized by its size, grayish color and double coat. These cats are also famous because of the contrast between their massively built body juxtaposed with their seemingly smiling expression and sweet voice.
  • Turkish Angora

Coat patterns

Cat coat genetics can produce a variety of coat patterns. Some of the most common are:

Blue (grey) and white bicolor cat
Bicolor, Tuxedo and Van 
This pattern varies between the tuxedo cat which is mostly black with a white chest, and possibly markings on the face and paws/legs, all the way to the Van pattern (so named after the Lake Van area in Turkey, which gave rise to the Turkish Van breed), where the only colored parts of the cat are the tail (usually including the base of the tail proper), and the top of the head (often including the ears). There are several other terms for amounts of white between these two extremes, such as Harlequin or jellicle cat. Bicolor cats can have as their primary (non-white) color black, red, any dilution thereof, and tortoiseshell (see below for definition).
Mackerel tabby, showing the characteristic "M" on its forehead.
Tabby 
Striped, with a variety of patterns. The classic blotched tabby (or marbled) pattern is the most common and consists of butterflies and bullseyes. The mackerel or striped tabby is a series of vertical stripes down the cat's side (resembling the fish). This pattern broken into spots is referred to as a spotted tabby. Finally, the tabby markings may look like a series of ticks on the fur, thus the ticked tabby, which is almost exclusively associated with the Abyssinian breed of cats. The worldwide evolution of the cat means that certain types of tabby are associated with certain countries; for instance, blotched tabbies are quite rare outside NW Europe, where they are the most common type.
Female tortoiseshell-and-white cat
Tortoiseshell and calico
This cat is also known as a calimanco cat or clouded tiger cat, and by the abbreviation 'tortie'. In the cat fancy, a tortoiseshell cat is patched over with red (or its dilute form, cream) and black (or its dilute blue) mottled throughout the coat. Additionally, the cat may have white spots in its fur, which make it a 'tortoiseshell and white' cat; if there is a significant amount of white in the fur and the red and black colors form a patchwork rather than a mottled aspect, in North America the cat will be called a calico. All calicos are tortoiseshell (as they carry both black and red), but not all tortoiseshells are calicos (which requires a significant amount of white in the fur and patching rather than mottling of the colors). The calico is also sometimes called a tricolor cat. The Japanese refer to this pattern as mi-ke (meaning "triple fur"), while the Dutch call these cats lapjeskat (meaning "patches cat"). A true tricolor must consist of three colors: a reddish color, dark or light; white; and one other color, typically a brown, black, or blue.[192] Both tortoiseshell and calico cats are typically female because the coat pattern is the result of differential X chromosome inactivation in females (which, as with all normal female mammals, have two X chromosomes). Conversely, cats where the overall color is ginger (orange) are commonly male (roughly in a 3:1 ratio). In a litter sired by a ginger tom, the females will be tortoiseshell or ginger. Male tortoiseshells can occur as a result of chromosomal abnormalities (often linked to sterility) or by a phenomenon known as mosaicism, where two early stage embryos are merged into a single kitten.
Siamese cat, classical colorpoint pattern
Colorpoint
The colorpoint pattern is most commonly associated with Siamese cats, but may also appear in any domesticated cat. A colorpointed cat has dark colors on the face, ears, feet, and tail, with a lighter version of the same color on the rest of the body, and possibly some white. The exact name of the colorpoint pattern depends on the actual color, so there are seal points (dark brown), chocolate points (warm lighter brown), blue points (dark gray), lilac or frost points (silvery gray-pink), red or flame points (orange), and tortie (tortoiseshell mottling) points, among others. This pattern is the result of a temperature sensitive mutation in one of the enzymes in the metabolic pathway from tyrosine to pigment, such as melanin; thus, little or no pigment is produced except in the extremities or points where the skin is slightly cooler. For this reason, colorpointed cats tend to darken with age as bodily temperature drops; also, the fur over a significant injury may sometimes darken or lighten as a result of temperature change.
The tyrosine pathway also produces neurotransmitters, thus mutations in the early parts of that pathway may affect not only pigment, but also neurological development. This results in a higher frequency of cross-eyes among colorpointed cats, as well as the high frequency of cross-eyes in white tigers.
White cats
White cat
True albinism (a mutation of the tyrosinase gene) is quite rare in cats. Much more common is the appearance of white coat color that is caused by a lack of melanocytes in the skin. A higher frequency of deafness in white cats is due to a reduction in the population and survival of melanoblast stem cells, which in addition to creating pigment-producing cells, develop into a variety of neurological cell types. White cats with one or two blue eyes have a particularly high likelihood of being deaf.
Smoke cats
The bottom eighth of each hair is white or creamy-white, with the rest of the hair being a solid color. Genetically this color is a non-agouti cat with the dominant inhibitor gene; a non-agouti version of the silver tabby. Smoke cats will look solid colored until they move, when the white undercoat becomes apparent. It is mostly found in pedigreed cats (especially longhair breeds) but also present in some domestic longhaired cats.

Body types

Cats can also come in several body types, ranging between two extremes:

Oriental
Not a specific breed, but any cat with an elongated slender build, almond-shaped eyes, long nose, large ears (the Siamese and Oriental Shorthair breeds are examples of this).
Foreign
Less slender than the oriental type, but nevertheless a cat with a slight build and generally athletic look. Typical example breeds would be the Abyssinian cat and the Turkish Angora. Some people consider the foreign and oriental body types as being the same, however.
Semi-Foreign
More or less the middle range of body conformation types, this type of cat is less slender without being stocky. Example breeds would be the Devon Rex and the Egyptian Mau.
Semi-Cobby
These cats look more rounded without looking too stocky. Example breeds would be the American Shorthair and British Shorthair.
Cobby
Any cat with a short, muscular, compact build, roundish eyes, short nose, and small ears. Persian cats and Exotic cats are two prime examples of such a body type.

Effects on human health

Because of their small size, domesticated house cats pose little physical danger to adult humans. However, in the USA cats inflict about 400,000 bites per year. This number represents about one in ten of all animal bites.[193] Many cat bites will become infected,[194] sometimes with serious consequences such as cat-scratch disease, or, more rarely, rabies.[193] Cats may also pose a danger to pregnant women and immunosuppressed individuals, since their feces can transmit toxoplasmosis.[195] A large percentage of cats are infected with this parasite, with infection rates ranging from around 40 to 60% in both domestic and stray cats worldwide.[196][197][198]

Allergic reactions to cat dander and/or cat saliva are common.[199] Some humans who are allergic to cats—typically manifested by hay fever, asthma, or a skin rash—quickly acclimate themselves to a particular animal and live comfortably in the same house with it, while retaining an allergy to cats in general.[200] Whether the risk of developing allergic diseases such as asthma is increased or decreased by cat ownership is uncertain.[201][202] Some owners cope with this problem by taking allergy medicine, along with bathing their cats frequently, since weekly bathing will reduce the amount of dander shed by a cat.[203] There have also been attempts to breed hypoallergenic cats, which would be less likely to provoke an allergic reaction.[204]

As well as posing health risks, interactions with cats may improve health and reduce physical responses to stress: for example the presence of cats may moderate increased blood pressure.[205] Cat ownership may also improve psychological health by providing emotional support and dispelling feelings of depression, anxiety and loneliness.[29]:23–56 Their ability to provide companionship and friendship are common reasons given for owning a cat.[180]

From another point of view, cats are thought to be able to improve the general mood of their owners by alleviating negative attitudes. According to a Swiss study carried out in 2003, cats may change the overall psychological state of their owner as their company's effect appears to be comparable to that of a human partner.[206] The researchers concluded that, while cats were not shown to promote positive moods, they do alleviate negative ones.

One study found that cat ownership is associated with a reduced risk of heart attacks and strokes at the 95% confidence interval.[207]

Several studies have shown that cats develop affection towards their owners. However, the effect of these pets on human health is closely related to the time and effort the cat owner is able to invest in it, in terms of bonding and playing.[208]

Indoor scratching

A natural behavior in cats is to periodically hook their front claws into suitable surfaces and pull backwards. This marks their territory and exercises their legs, in addition to cleaning and sharpening their claws.[209] Indoor cats benefit from being provided with a scratching post so that they are less likely to use carpet or furniture which they can easily ruin.[210] Commercial scratching posts typically are covered in carpeting or upholstery, but some authorities[who?] advise against this practice, as not making it clear to the cat which surfaces are permissible and which are not; they suggest using a plain wooden surface, or reversing the carpeting on the posts so that the rougher texture of the carpet backing is a more attractive alternative to the cat than the floor covering. Scratching posts made of sisal rope or corrugated cardboard are also common.

Close-up of a cat's claw, with the quick clearly visible

Although scratching can serve cats to keep their claws from growing excessively long, their nails can be trimmed if necessary. Another response to indoor scratching is onychectomy, commonly known as declawing. This is a surgical procedure to remove the claw and first bone of each digit of a cat's paws. Declawing is most commonly only performed on the front feet. A related procedure is tendonectomy, which involves cutting a tendon needed for cats to extend their claws.[211] Declawing is a major surgical procedure and can produce pain, infections and permanent lameness.[211]

Since this surgery is almost always performed for the benefit of owners, it is controversial and remains uncommon outside of North America.[212] In many countries, declawing is prohibited by animal welfare laws and it is ethically controversial within the veterinary community.[213] While both the Humane Society of the United States and the American Society for the Prevention of Cruelty to Animals strongly discourage or condemn the procedure,[214] the American Veterinary Medical Association supports the procedure under certain guidelines and finds "no scientific evidence that declawing leads to behavioral abnormalities when the behavior of declawed cats is compared with that of cats in control groups."[215] They further argue that many cats would be given up and euthanized were declawing not performed.[212] Nevertheless, many veterinarians refuse to perform the procedure.

Waste

A toilet-trained house cat

Cats bury their urine and feces. Indoor cats are usually provided with a box containing litter, typically bentonite, but sometimes other absorbent material such as shredded paper or wood chips, or sometimes sand or similar material. It should be cleaned daily and changed often, depending on the number of cats in a household and the type of litter; if it is not kept clean, a cat may be fastidious enough to find other locations in the house for urination or defecation. This may also happen for other reasons; for instance, if a cat becomes constipated and defecation is uncomfortable, it may associate the discomfort with the litter box and avoid it in favor of another location.

Daily attention to the litter box also serves as a monitor of the cat's health. Bentonite or clumping litter is a variation which absorbs urine into clumps which can be sifted out along with feces, and thus stays cleaner longer with regular sifting, but has sometimes been reported to cause health problems in some cats.[216]

Some cats can be trained to use the human toilet, eliminating the litter box and its attendant expense, unpleasant odor, and the need to use landfill space for disposal. Training may involve four to six weeks of incremental moves, such as moving and elevating the litter box until it is near the toilet, as well as employing an adapter such as a bowl or small box to suspend the litter above the toilet bowl.[217] When training is complete, the cat uses the toilet by squatting on the toilet seat over the bowl.

Feral cats

American feral farm cat

Feral cats are domestics cats that were born in or have reverted to a wild state. They are unfamiliar with and wary of humans and roam freely in urban and rural areas.[9] The numbers of feral cats are not known, but estimates of the US feral population range from 25 to 60 million.[9] Feral cats may live alone, but most are found in large groups called feral colonies, which occupy a specific territory and are usually associated with a source of food.[218] Famous feral cat colonies are found in Rome around the Colosseum and Forum Romanum, with cats at some of these sites being fed and vetted by volunteers.[219]

Public attitudes towards feral cats vary widely: ranging from seeing them as free-ranging pets, to regarding them as vermin.[220] One common approach to reducing the feral cat population is termed trap-neuter-return, where the cats are trapped, neutered, immunized against rabies and the feline leukemia virus, and then released. Before releasing them back into their feral colonies, the attending veterinarian often nips the tip off one ear to mark the feral as neutered and inoculated, since these cats may be trapped again. Volunteers continue to feed and give care to these cats throughout their lives. Given this support, their lifespan is increased, and behavior and nuisance problems caused by competition for food are reduced.[218]

History and mythology

Egyptian sculpture at the Louvre

Traditionally, historians tended to think that ancient Egypt was the site of cat domestication, owing to the clear depictions of house cats in Egyptian paintings about 3,600 years old.[4] However, in 2004, a Neolithic grave was excavated in Shillourokambos, Cyprus, that contained the skeletons, laid close to one another, of both a human and a cat. The grave is estimated to be 9,500 years old, pushing back the earliest known feline-human association significantly.[12][221][222] The cat specimen is large and closely resembles the African wildcat (Felis silvestris lybica), rather than present-day domestic cats. This discovery, combined with genetic studies, suggest that cats were probably domesticated in the Middle East, in the Fertile Crescent around the time of the development of agriculture and then they were brought to Cyprus and Egypt.[4]

In ancient Egypt cats were sacred animals, with Bast often depicted in cat form, sometimes taking on the warlike aspect of a lioness.[188]:220 The Romans are often credited with introducing the domestic cat from Egypt to Europe;[188]:223 in Roman Aquitaine, a 1st or 2nd century epitaph of a young girl holding a cat is one of two earliest depictions of the Roman domesticated cat.[223] However, it is possible that cats were already kept in Europe prior to the Roman Empire, as they may have already been present in Britain in the late Iron Age.[30] Domestic cats were spread throughout much of the rest of the world during the Age of Discovery, as they were carried on sailing ships to control shipboard rodents and as good-luck charms.[188]:223

Freyja and her cats

Several ancient religions believed that cats are exalted souls, companions or guides for humans, that they are all-knowing but are mute so they cannot influence decisions made by humans. In Japan, the maneki neko is a cat that is a symbol of good fortune. Although there are no sacred species in Islam, some writers have stated that Muhammad had a favorite cat, Muezza.[224] He is reported to have loved cats so much that "he would do without his cloak rather than disturb one that was sleeping on it".[225]

Freyja—the goddess of love, beauty, and fertility in Norse mythology—is depicted as riding a chariot drawn by cats.

Many cultures have negative superstitions about cats. An example would be the belief that a black cat "crossing your path" leads to bad luck, or that cats are witches' familiars used to augment a witch's powers and skills. This led to the widespread extermination of cats in Europe in medieval times. The Black Plague was spread by fleas carried by infected rats, and the killing of cats ostensibly caused an increase in the rat population. The killing of cats in Medieval Ypres is commemorated in the innocuous present-day Kattenstoet (cat parade).

According to a myth in many cultures, cats have multiple lives. In many countries, they are believed to have nine lives, but in some Spanish-speaking regions they are said to have seven lives,[226] while in Turkish and Arabic traditions the number of lives is six.[227] The myth is attributed to the natural suppleness and swiftness cats exhibit to escape life-threatening situations.[228] Also lending credence to this myth is the fact that falling cats often land on their feet, using an instinctive righting reflex to twist their bodies around. Nonetheless, cats can still be injured or killed by a high fall.[229]

See also

References

  1. ^ a b c d e f g Wozencraft, W. Christopher (16 November 2005). "Species Felis catus". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 534–535. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000031. 
  2. ^ a b c "ITIS Standard Report Page: Felis catus". ITIS Online Database. Reston, Virginia: Integrated Taxonomic Information System. 2011. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=183798. Retrieved 14 December 2011. 
  3. ^ a b Linnaeus, Carolus (1766) [1758] (in (Latin)). Systema naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 1 (12th ed.). Holmiae (Laurentii Salvii). p. 62. http://gallica.bnf.fr/ark:/12148/bpt6k99004c/f62.chemindefer. Retrieved 2 April 2008. 
  4. ^ a b c d e f g h i j Driscoll CA, Macdonald DW, O'Brien SJ, CA (2009). "In the Light of Evolution III: Two Centuries of Darwin Sackler Colloquium: From wild animals to domestic pets, an evolutionary view of domestication". Proc. Natl. Acad. Sci. U.S.A. 106 (S1): 9971–9978. doi:10.1073/pnas.0901586106. PMC 2702791. PMID 19528637. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2702791. 
  5. ^ "ITIS Standard Report Page: Felis catus domestica". op. cit.. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=727487. Retrieved 14 December 2011. 
  6. ^ "Housecat". American Heritage Dictionary of the English Language, Education.Yahoo.com Edition. Boston: Houghton Mifflin. 2010. http://education.yahoo.com/reference/dictionary/entry/housecat. Retrieved 6 October 2010. 
  7. ^ Animal Humane Society. Animal Humane Society. Retrieved on 2012-05-04.
  8. ^ a b Moelk, Mildred (1944-04). "Vocalizing in the House-Cat; A Phonetic and Functional Study". The American Journal of Psychology (The American Journal of Psychology, Vol. 57, No. 2) 57 (2): 184–205. doi:10.2307/1416947. JSTOR 1416947. 
  9. ^ a b c Rochlitz, Irene (2007). The Welfare of Cats. "Animal Welfare" series. Berlin: Springer. pp. 141–175. ISBN 1-4020-6143-9. 
  10. ^ a b c Wade, Nicholas (29 June 2007). "Study Traces Cat's Ancestry to Middle East". New York Times (New York: NYTC). http://www.nytimes.com/2007/06/29/science/29cat.html. Retrieved 2 April 2008. 
  11. ^ "Meet Helen and Aphrodite, Cyprus's Indigenous Cats". China Daily. http://www.chinadaily.com.cn/life/2009-11/03/content_8904093.htm. Retrieved 3 November 2009. 
  12. ^ a b "Oldest Known Pet Cat? 9500-Year-Old Burial Found on Cyprus". National Geographic News. National Geographic Society. 8 April 2004. http://news.nationalgeographic.com/news/2004/04/0408_040408_oldestpetcat.html. Retrieved 6 March 2007. 
  13. ^ "The Evolution of House Cats". Scientific American. New York: Nature Publishing Group. 10 June 2009. http://www.scientificamerican.com/article.cfm?id=the-taming-of-the-cat. Retrieved 26 August 2009. 
  14. ^ OED. Webster's Encyclopedic Unabridged Dictionary of the English Language. New York: Gramercy Books, 1996: 1571.
  15. ^ a b c J. W. S Bradshawa, G. F. Horsfield, J. A. Allen and I. H. Robinson (1999). "Feral cats: their role in the population dynamics of Felis catus". Applied Animal Behaviour Science 65 (3): 273–283. doi:10.1016/S0168-1591(99)00086-6. 
  16. ^ Johnson, Warren; O'brien, Stephen J. (1997). "Phylogenetic reconstruction of the felidae using 16S rRNA and NADH-5 mitochondrial genes". Journal of Molecular Evolution 44 (0): S98–S116. doi:10.1007/PL00000060. PMID 9071018. 
  17. ^ "ITIS Standard Report Page: Felis". op. cit.. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180586. Retrieved 14 December 2011. 
  18. ^ Stefoff, Rebecca (2003-11). Cats. New York: Benchmark Books. p. 34. ISBN 0-7614-1577-7. 
  19. ^ Johnson, W. E.; Eizirik, E.; Pecon-Slattery, J.; Murphy, W. J.; Antunes, A.; Teeling, E.; O'Brien, S. J. (2006). "The Late Miocene Radiation of Modern Felidae: A Genetic Assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. 
  20. ^ a b c Mattern, Michelle Y.; McLennan, Deborah A. (2000). "Phylogeny and Speciation of Felids". Cladistics 16 (2): 232–253. doi:10.1111/j.1096-0031.2000.tb00354.x. 
  21. ^ Masuda, R.; Lopez, J. V.; Slattery, J. P.; Yuhki, N.; O'Brien, S. J. (1996). "Molecular Phylogeny of Mitochondrial Cytochrome b and 12S rRNA Sequences in the Felidae: Ocelot and Domestic Cat Lineages". Molecular Phylogenetics and Evolution 6 (3): 351–365. doi:10.1006/mpev.1996.0085. PMID 8975691. 
  22. ^ Oliveira R, Godinho R, Randi E, Alves PC, R (2008). "Hybridization versus conservation: are domestic cats threatening the genetic integrity of wildcats (Felis silvestris silvestris) in Iberian Peninsula?". Philos. Trans. R. Soc. Lond., B, Biol. Sci. 363 (1505): 2953–61. doi:10.1098/rstb.2008.0052. PMC 2606743. PMID 18522917. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2606743. 
  23. ^ a b c Wozencraft, W. Christopher (16 November 2005). "Species Felis silvestris". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 536–537. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000057. 
  24. ^ a b ICZN (2003). "Opinion 2027". Bulletin of Zoological Nomenclature (International Commission on Zoological Nomenclature) 60. http://web.archive.org/web/20110609014212/http://www.nhm.ac.uk/hosted_sites/iczn/BZNMar2003opinions.htm. 
  25. ^ a b c d e f g h i MacDonald ML, Rogers QR, Morris JG (1984). "Nutrition of the domestic cat, a mammalian carnivore". Annu. Rev. Nutr. 4: 521–62. doi:10.1146/annurev.nu.04.070184.002513. PMID 6380542. 
  26. ^ Vella, Carolyn M.; Lorraine M. Shelton, John J. McGonagle, Terry W. Stanglein (1999). Robinson's Genetics for Cat Breeders and Veterinarians (4 ed.). Butterworth-Heinemann. p. 3. ISBN 0-7506-4069-3. 
  27. ^ a b c Lipinski, Monika J.; Froenicke, Lutz; Baysac, Kathleen C.; Billings, Nicholas C.; Leutenegger, Christian M.; Levy, Alon M.; Longeri, Maria; Niini, Tirri et al (2008-01). "The ascent of cat breeds: Genetic evaluations of breeds and worldwide random-bred populations". Genomics 91 (1): 12–21. doi:10.1016/j.ygeno.2007.10.009. PMC 2267438. PMID 18060738. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2267438. 
  28. ^ a b c Cameron-Beaumont, Charlotte; Lowe, Sarah E.; Bradshaw, John W. S. (2002). "Evidence suggesting pre-adaptation to domestication throughout the small Felidae". Biological Journal of the Linnean Society 75 (3): 361–366. doi:10.1046/j.1095-8312.2002.00028.x. http://www.neiu.edu/~jkasmer/Biol498R/Readings/essay1-06.pdf. Retrieved 29 September 2009. 
  29. ^ a b Fogle, Bruce (ed.) (1981). Interrelations Between People and Pets. Charles C. Thomas Pub. Ltd.. ISBN 0-398-04169-5. 
  30. ^ a b O'Connor, T. P. (2007). "Wild or domestic? Biometric variation in the cat Felis silvestris Schreber". International Journal of Osteoarchaeology 17 (6): 581–595. doi:10.1002/oa.913. 
  31. ^ a b Strain GM (1996). "Aetiology, prevalence and diagnosis of deafness in dogs and cats". Br. Vet. J. 152 (1): 17–36. doi:10.1016/S0007-1935(96)80083-2. PMID 8634862. 
  32. ^ Nie W, Wang J, O'Brien PC (2002). "The genome phylogeny of domestic cat, red panda and five mustelid species revealed by comparative chromosome painting and G-banding". Chromosome Res. 10 (3): 209–22. doi:10.1023/A:1015292005631. PMID 12067210. 
  33. ^ a b c Pontius JU, Mullikin JC, Smith DR, JU (2007). "Initial sequence and comparative analysis of the cat genome". Genome Res. 17 (11): 1675–89. doi:10.1101/gr.6380007. PMC 2045150. PMID 17975172. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2045150. 
  34. ^ O'Brien SJ, Johnson W, Driscoll C, Pontius J, Pecon-Slattery J, Menotti-Raymond M (2008). "State of cat genomics". Trends Genet. 24 (6): 268–79. doi:10.1016/j.tig.2008.03.004. PMID 18471926. 
  35. ^ Sewell AC, Haskins ME, Giger U (2007). "Inherited metabolic disease in companion animals: searching for nature's mistakes". Vet. J. 174 (2): 252–9. doi:10.1016/j.tvjl.2006.08.017. PMC 3132193. PMID 17085062. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3132193. 
  36. ^ a b O'Brien SJ, Menotti-Raymond M, Murphy WJ, Yuhki N (2002). "The Feline Genome Project". Annu. Rev. Genet. 36: 657–86. doi:10.1146/annurev.genet.36.060602.145553. PMID 12359739. 
  37. ^ a b Li, Xia; Li, Weihua; Wang, Hong; Cao, Jie; Maehashi, Kenji; Huang, Liquan; Bachmanov, Alexander A.; Reed, Danielle R. et al (2005). "Pseudogenization of a Sweet-Receptor Gene Accounts for Cats' Indifference toward Sugar". PLOS Genetics (Public Library of Science) 1 (1): 27–35. doi:10.1371/journal.pgen.0010003. PMC 1183522. PMID 16103917. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1183522. 
  38. ^ Saada AA, Niparko JK, Ryugo DK (1996). "Morphological changes in the cochlear nucleus of congenitally deaf white cats". Brain Res. 736 (1–2): 315–28. doi:10.1016/0006-8993(96)00719-6. PMID 8930338. 
  39. ^ Robinson, Roy; Vella, Carolyn M.; Lorraine Shelton; McGonagle, John J.; Carolyne Vella (1999). Robinson's genetics for cat breeders and veterinarians. Oxford: Butterworth-Heinemann. ISBN 0-7506-4069-3. 
  40. ^ Lyons LA, Imes DL, Rah HC, Grahn RA (2005). "Tyrosinase mutations associated with Siamese and Burmese patterns in the domestic cat (Felis catus)". Anim. Genet. 36 (2): 119–26. doi:10.1111/j.1365-2052.2005.01253.x. PMID 15771720. 
  41. ^ Imes DL, Geary LA, Grahn RA, Lyons LA (2006). "Albinism in the domestic cat (Felis catus) is associated with a tyrosinase (TYR) mutation". Anim. Genet. 37 (2): 175–8. doi:10.1111/j.1365-2052.2005.01409.x. PMC 1464423. PMID 16573534. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1464423. 
  42. ^ Kehler JS, David VA, Schäffer AA (2007). "Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats". J. Hered. 98 (6): 555–66. doi:10.1093/jhered/esm072. PMID 17767004. 
  43. ^ Menotti-Raymond M, David VA, Stephens JC, Lyons LA, O'Brien SJ (1997). "Genetic individualization of domestic cats using feline STR loci for forensic applications". J. Forensic Sci. 42 (6): 1039–51. PMID 9397545. 
  44. ^ Hartwell, Sarah (2002–2011). "Dwarf, Midget and Miniature Cats (Including 'Tea-cup' Cats)". MessyBeast.com. self-published. http://www.messybeast.com/dwarfcats.html. Retrieved 6 March 2007. [self-published source]
  45. ^ Cat World (2008). Cat World Records: Heaviest Cat. Retrieved on 30 July 2008 from Cat-world.com
  46. ^ Cat-world.com.au retrieved on 2008/29/11
  47. ^ "Domestic Cat". Animal Bytes. SeaWorld Parks and Entertainment. 2011. http://www.seaworld.org/animal-info/Animal-Bytes/animalia/eumetazoa/coelomates/deuterostomes/chordata/craniata/mammalia/carnivora/domestic-cat.htm. Retrieved 14 December 2011.  This is a tertiary source that clearly includes information from other sources and names them, but does not cite them in detail.
  48. ^ a b Walker, Warren F. (1982). Study of the Cat with Reference to Human Beings (4th Revised ed.). Thomson Learning. ISBN 0-03-057914-7. 
  49. ^ "Cat Skeleton". Archived from the original on 6 December 2006. http://web.archive.org/web/20061206105542/http://bioweb.uwlax.edu/zoolab/Table_of_Contents/Lab-9b/Cat_Skeleton_1/cat_skeleton_1.htm. Retrieved 12 December 2006. 
  50. ^ a b c d e *Case, Linda P. (2003). The Cat: Its Behavior, Nutrition, & Health. Ames, Iowa: Iowa State University Press. ISBN 0-8138-0331-4. 
  51. ^ a b Smith, Patricia; Eitan Tchernov (1992). Structure, function and evolution of teeth. Freund Publishing House Ltd.. p. 217. ISBN 965-222-270-4. 
  52. ^ Lacquaniti F, Grasso R, Zago M (1 August 1999). "Motor Patterns in Walking". News Physiol. Sci. 14 (4): 168–174. PMID 11390844. 
  53. ^ Christensen, Wendy (2004). Outwitting Cats. Globe Pequot. p. 23. ISBN 1-59228-240-7. http://books.google.com/?id=WmuQQXU6EtAC&pg=PA23. 
  54. ^ Russell, Anthony P.; Bryant, Harold N. (2001). "Claw Retraction and Protraction in the Carnivora: The Cheetah (Acinonyx Jubatus) as an Atypical Felid". Journal of Zoology 254 (1): 67–76. doi:10.1017/S0952836901000565. 
  55. ^ Armes, Annetta F. (22 December 1900). "Outline of Cat Lessons". The School Journal (E.L. Kellogg & Co.) LXI: 659. http://books.google.com/?id=-_gBAAAAYAAJ. Retrieved 12 November 2007. 
  56. ^ a b Danforth CH. (1947). "Heredity of Polydactyly in the Cat". J. Hered. 38 (4): 107–112. PMID 20242531. http://jhered.oxfordjournals.org/content/38/4/107.full.pdf. 
  57. ^ Lettice, LA; Hill, AE; Devenney, PS; Hill, RE (2008). "Point mutations in a distant sonic hedgehog cis-regulator generate a variable regulatory output responsible for preaxial polydactyly". Human Molecular Genetics 17 (7): 978–985. doi:10.1093/hmg/ddm370. PMID 18156157. 
  58. ^ Kahn, Cynthia M.; Line, Scott; Hollander, Joseph Lee (ed.) (2007). The Merck/Merial Manual for Pet Health. Merck. ISBN 0-911910-99-9. 
  59. ^ Subcommittee on Dog and Cat Nutrition (2006). Nutrient Requirements of Dogs and Cats. Washington, DC: National Academies Press. p. 292. ISBN 0-309-08628-0. 
  60. ^ Adams T, Morgan ML, Hunter WS, Holmes KR (1970). "Temperature regulation of the unanesthetized cat during mild cold and severe heat stress". J Appl Physiol 29 (6): 852–8. PMID 5485356. 
  61. ^ a b Committee on Animal Nutrition (1986). Nutrient Requirements of Cats (2nd ed.). National Academy Press. ISBN 0-309-07483-5. http://www.nap.edu/catalog.php?record_id=910#toc. 
  62. ^ Prentiss, Phoebe G. (1959). "Hydropenia in cat and dog. Ability of the cat to meet its water requirements solely from a diet of fish or meat". Am J Physiol 196 (3): 625–632. PMID 13627237. 
  63. ^ Wolf, A. V. (1959). "Potability of sea water with special reference to the cat". Am J Physiol 196 (3): 633–641. PMID 13627238. 
  64. ^ Morris JG, Rogers QR (1 December 1978). "Arginine: an essential amino acid for the cat". J. Nutr. 108 (12): 1944–53. PMID 722344. 
  65. ^ a b Zoran DL (2002). "The carnivore connection to nutrition in cats". J. Am. Vet. Med. Assoc. 221 (11): 1559–67. doi:10.2460/javma.2002.221.1559. PMID 12479324. http://www.rawessentials.co.nz/media/documents/website%20-zorans_article.pdf. 
  66. ^ Gray CM, Sellon RK, Freeman LM (2004). "Nutritional adequacy of two vegan diets for cats". J. Am. Vet. Med. Assoc. 225 (11): 1670–5. doi:10.2460/javma.2004.225.1670. PMID 15626215. 
  67. ^ a b Zaghini G, Biagi G (2005). "Nutritional peculiarities and diet palatability in the cat". Vet. Res. Commun. 29 Suppl 2: 39–44. doi:10.1007/s11259-005-0009-1. PMID 16244923. 
  68. ^ Ollivier, F. J.; Samuelson, D. A.; Brooks, D. E.; Lewis, P. A.; Kallberg, M. E.; Komaromy, A. M. (2004). "Comparative morphology of the tapetum lucidum (among selected species)". Veterinary Ophthalmology 7 (1): 11–22. doi:10.1111/j.1463-5224.2004.00318.x. PMID 14738502. 
  69. ^ a b Malmström T, Kröger RH (2006). "Pupil shapes and lens optics in the eyes of terrestrial vertebrates". J. Exp. Biol. 209 (Pt 1): 18–25. doi:10.1242/jeb.01959. PMID 16354774. 
  70. ^ Hammond, P.; Mouat, G. S. V. (1985). "The relationship between feline pupil size and luminance". Experimental Brain Research 59 (3): 485–490. doi:10.1007/BF00261338. 
  71. ^ Loop MS, Bruce LL (1978). "Cat color vision: the effect of stimulus size". Science 199 (4334): 1221–2. doi:10.1126/science.628838. PMID 628838. 
  72. ^ Schneider H, Beller FK (1 April 1993). "The Spectral Sensitivity of Dark- and Light-adapted Cat Retinal Ganglion Cells". Journal of Neuroscience 13 (4): 1543–1550. PMID 8463834. http://www.jneurosci.org/content/13/4/1543.full.pdf+html. 
  73. ^ a b Heffner, RS (2004-11). "Primate hearing from a mammalian perspective". The Anatomical Record. Part A, Discoveries in Molecular, Cellular, and Evolutionary Biology 281 (1): 1111–1122. doi:10.1002/ar.a.20117. PMID 15472899. Archived from the original on 19 September 2006. http://web.archive.org/web/20060919003302/http://psychology.utoledo.edu/images/users/74/Primate+Hearing+from+a+Mammalian+Perspective.pdf. Retrieved 20 August 2009. 
  74. ^ Heffner, Henry E. (1998-05). "Auditory awareness". Applied Animal Behaviour Science 57 (3–4): 259–268. doi:10.1016/S0168-1591(98)00101-4. 
  75. ^ a b Sunquist, Melvin E.; Sunquist, Fiona (2002). Wild Cats of the World. University of Chicago Press. p. 10. ISBN 0-226-77999-8. 
  76. ^ Blumberg, M. S. (1992). "Rodent ultrasonic short calls: locomotion, biomechanics, and communication". Journal of Comparative Psychology 106 (4): 360–365. doi:10.1037/0735-7036.106.4.360. PMID 1451418. 
  77. ^ Heffner, R. S.; Heffner, H. E. (1985). "Hearing range of the domestic cat". Hearing Research 19 (1): 85–88. doi:10.1016/0378-5955(85)90100-5. PMID 4066516. http://psychology.utoledo.edu/images/users/74/Audiograms/HearingRangeOfTheDomesticCat_1985.pdf. Retrieved 20 August 2009. 
  78. ^ Moulton, David G. (1 August 1967). "Olfaction in Mammals". Amer. Zool. 7 (3): 421–429. doi:10.1093/icb/7.3.421. 
  79. ^ M. Miyazaki, T. Yamashita, Y. Suzuki, Y. Saito, S. Soeta, H. Taira, and A. Suzuki (2006). "A major urinary protein of the domestic cat regulates the production of felinine, a putative pheromone precursor" (PDF). Chem. Biol. 13 (10): 1071–1079. doi:10.1016/j.chembiol.2006.08.013. PMID 17052611. 
  80. ^ a b c Sommerville, B. A. (1998). "Olfactory awareness". Applied Animal Behaviour Science 57 (3–4): 269–286. doi:10.1016/S0168-1591(98)00102-6. 
  81. ^ Grognet, Jeff (1990-06). "Catnip: Its uses and effects, past and present". The Canadian Veterinary Journal 31 (6): 455–456. PMC 1480656. PMID 17423611. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1480656. 
  82. ^ Tucker, Arthur; Sharon Tucker (1988). "Catnip and the catnip response". Economic Botany 42 (2): 214–231. http://www.springerlink.com/content/f613756573257t02/. 
  83. ^ Bradshaw, John W. S. (1 July 2006). "The Evolutionary Basis for the Feeding Behavior of Domestic Dogs (Canis familiaris) and Cats (Felis catus)". Journal of Nutrition 136 (7): 1927S–1931. PMID 16772461. 
  84. ^ Taylor, E. J.; Adams, C.; Neville, R. (1995). "Some Nutritional Aspects of Ageing in Dogs and Cats". Proceedings of the Nutrition Society 54 (3): 645–656. doi:10.1079/PNS19950064. PMID 8643702. 
  85. ^ Poynter, Dan (2002). The Older Cat: Recognizing Decline & Extending Life (2nd ed.). Santa Barbara, CA: Para Publishing. p. 25. ISBN 1-56860-076-3. http://books.google.com/books?id=Ulx0L3_nkCcC&printsec=frontcover. Retrieved 26 April 2012. 
  86. ^ Example: "Me-wow! Texas Woman Says Cat is 30 Years Old: Although She Can't Hear or See Very Well, Caterack the Cat Is Still Purring". Today.MSNBC.MSN.com/. New York: NBCUniversal. 30 September 2009. Archived from the original on 2 October 2009. http://web.archive.org/web/20091002231250/http://today.msnbc.msn.com/id/33094898/ns/today-today_pets_and_animals?GT1=43001. Retrieved 30 September 2009. 
  87. ^ Guinness World Records 2010. Bantam; Reprint edition. 2010. p. 320. ISBN 978-0-553-59337-2. http://books.google.com/books?id=hLYzvUvPL3MC&pg=PA320. "The oldest cat ever was Creme Puff, who was born on August 3, 1967 and lived until August 6, 2005—38 years and 3 days in total." 
  88. ^ Kraft, W (February 1998). "Geriatrics in canine and feline internal medicine.". European Journal of Medical Research 3 (1–2): 31–41. ISSN 0949-2321. PMID 9512965. 
  89. ^ "Cat Care: Spay–Neuter". ASPCA.org. New York: American Society for the Prevention of Cruelty to Animals. 2011. http://www.aspca.org/pet-care/cat-care/spay-neuter.html. Retrieved 14 December 2011.  This is a tertiary source that clearly includes information from other sources but does not name them.
  90. ^ Levy, J. K.; Gale, D. W.; Gale, L. A. (2003). "Evaluation of the effect of a long-term trap-neuter-return and adoption program on a free-roaming cat population". Journal of the American Veterinary Medical Association 222 (1): 42–46. doi:10.2460/javma.2003.222.42. PMID 12523478. http://www.collierferalcatcoalition.org/tnr%20sources/javma.2003.222.pdf. 
  91. ^ a b c d e f "Toxic to Cats". VetInfo.com. VetInfo. 2011. http://www.vetinfo.com/ctoxin.html. Retrieved 14 December 2011.  This is a tertiary source that clearly includes information from other sources but does not name them.
  92. ^ Williams, R. T. (1 February 1978). "Species variations in the pathways of drug metabolism". Environmental Health Perspectives (Environmental Health Perspectives, Vol. 22) 22: 133–8. doi:10.2307/3428562. JSTOR 3428562. PMC 1637137. PMID 417918. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1637137. 
  93. ^ Rowland, J. (1987). "Incidence of ethylene glycol intoxication in dogs and cats seen at Colorado State University Veterinary Teaching Hospital". Vet Hum Toxicol 29 (1): 41–4. PMID 3824875. 
  94. ^ Potera, C. (2007). "Chemical Exposures: Cats as Sentinel Species". Environmental Health Perspectives 115 (12): A580. doi:10.1289/ehp.115-a580a. PMC 2137107. PMID 18087575. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2137107. 
  95. ^ Allen, A. L. (1 June 2003). "The diagnosis of acetaminophen toxicosis in a cat". Canadian Veterinary Journal 44 (6): 509–10. PMC 340185. PMID 12839249. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=340185. 
  96. ^ Villar D, Buck WB, Gonzalez JM, D (1998). "Ibuprofen, aspirin and acetaminophen toxicosis and treatment in Dogs and Cats". Vet Hum Toxicol 40 (3): 156–62. PMID 9610496. 
  97. ^ Camille DeClementi; Bailey, Keith L.; Goldstein, Spencer C.; Orser, Michael Scott (2004). "Suspected toxicosis after topical administration of minoxidil in 2 cats". Journal of Veterinary Emergency and Critical Care 14 (4): 287–292. doi:10.1111/j.1476-4431.2004.04014.x. 
  98. ^ Bischoff K, Guale F, K (1 April 1998). "Australian tea tree (Melaleuca alternifolia) oil poisoning in three purebred cats". J. Vet. Diagn. Invest. 10 (2): 208–10. doi:10.1177/104063879801000223. PMID 9576358. 
  99. ^ Rousseaux, C. G.; Smith, R. A.; Nicholson, S. (1986). "Acute Pinesol Toxicity in a Domestic Cat". Veterinary and Human Toxicology 28 (4): 316–317. PMID 3750813. 
  100. ^ "Antifreeze Warning". The Cat Fanciers' Association. Archived from the original on 9 May 2007. http://web.archive.org/web/20070509041844/http://www.cfainc.org/articles/antifreeze.html. Retrieved 15 May 2007. 
  101. ^ "Death by Chocolate? Methylxanthine Toxicosis". Veterinary Technician. 2001. http://www.aspcapro.org/mydocuments/download.php?f=l-vettech_0301.pdf. Retrieved 25 August 2009. 
  102. ^ "Plants and Your Cat". The Cat Fanciers' Association, Inc.. Archived from the original on 17 January 2010. http://www.webcitation.org/5mq1hjPbF. Retrieved 15 May 2007. 
  103. ^ Langston, Cathy E (1 January 2002). "Acute renal failure caused by lily ingestion in six cats". Journal of the American Veterinary Medical Association 220 (1): 49–52, 36. doi:10.2460/javma.2002.220.49. PMID 12680447. 
  104. ^ Germain, E.; Benhamou, S.; Poulle, M.-L. (2008). "Spatio-temporal sharing between the European wildcat, the domestic cat and their hybrids". Journal of Zoology 276 (2): 195–203. doi:10.1111/j.1469-7998.2008.00479.x. 
  105. ^ a b c Barratt, David G. (1 June 1997). "Home Range Size, Habitat Utilisation and Movement Patterns of Suburban and Farm Cats Felis catus". Ecography 20 (3): 271–280. doi:10.1111/j.1600-0587.1997.tb00371.x. JSTOR 3682838. 
  106. ^ Randall, Walter; Johnson, R. F.; Randall, S; Cunningham, J. T. (1985). "Circadian rhythms in food intake and activity in domestic cats". Behavioral Neuroscience 99 (6): 1162–1175. doi:10.1037/0735-7044.99.6.1162. PMID 3843546. 
  107. ^ Jouvet, Michel (1979). "What does a cat dream about?". Trends in Neurosciences 2: 280–282. doi:10.1016/0166-2236(79)90110-3. 
  108. ^ Pontier, Dominique; Eugenia Natoli (1996). "Male reproductive success in the domestic cat (Felis catus L.): A case history". Behavioural Processes 37 (1): 85–88. doi:10.1016/0376-6357(95)00070-4. 
  109. ^ a b Crowell-Davis, SL; Curtis, TM; Knowles, R. J. (2004). "Social organization in the cat: a modern understanding". Journal of Feline Medicine and Surgery 6 (1): 19–28. doi:10.1016/j.jfms.2003.09.013. PMID 15123163. http://zoopsy.free.fr/veille_biblio/social_organization_cat_2004.pdf. Retrieved 21 May 2008. 
  110. ^ Baron, Alan; Stewart, C. N.; Warren, J. M. (1 January 1957). "Patterns of Social Interaction in Cats (Felis domestica)". Behaviour 11 (1): 56–66. doi:10.1163/156853956X00084. JSTOR 4532869. 
  111. ^ a b c d e Bradshaw JW, Goodwin D, Legrand-Defrétin V, Nott HM, J.W. (1996). "Food selection by the domestic cat, an obligate carnivore". Comp. Biochem. Physiol. A Physiol. 114 (3): 205–9. doi:10.1016/0300-9629(95)02133-7. PMID 8759144. 
  112. ^ Jensen, Per (2009). The Ethology of Domestic Animals. "Modular Text" series. Wallingford: CABI. ISBN 1-84593-536-5. 
  113. ^ a b "Cat Guide: Body Language". Animal Planet. Archived from the original on 30 June 2008. http://web.archive.org/web/20080630210950/http://animal.discovery.com/guides/cats/behavior/bodylanguageintro.html. Retrieved 26 August 2009. 
  114. ^ a b Cafazzo S, Natoli E, S. (2009). "The social function of tail up in the domestic cat (Felis silvestris catus)". Behav. Processes 80 (1): 60–6. doi:10.1016/j.beproc.2008.09.008. PMID 18930121. 
  115. ^ Levine, E.; Perry, P.; Scarlett, J.; Houpt, K. (2005). "Intercat aggression in households following the introduction of a new cat". Applied Animal Behaviour Science 90 (90): 325–336. doi:10.1016/j.applanim.2004.07.006. http://faculty.washington.edu/jcha/330_cats_introducing.pdf. Retrieved 8 April 2009. 
  116. ^ Cat Guide: Adolescence and Sexual Maturity Animal Planet
  117. ^ McComb K, Taylor AM, Wilson C, Charlton BD (2009). "The cry embedded within the purr". Curr. Biol. 19 (13): R507–8. doi:10.1016/j.cub.2009.05.033. PMID 19602409. 
  118. ^ a b Ewing, Tom (2006). "A Hairy Dilemma: When Hair Balls Aren't Harmless". Cat Watch. Cornell Feline Health Center, Cornell University. http://www.vet.cornell.edu/FHC/news/hair.htm. Retrieved 25 August 2009. 
  119. ^ Boshel, J; Wilborn, W. H.; Singh, B. B.; Peter, S.; Stur, M. (1982). "Filiform Papillae of Cat Tongue". Cells Tissues Organs 114 (2): 97–105. doi:10.1159/000145583. PMID 17728549. 
  120. ^ Alice Moon-Fanelli, PhD, CAAB. "Feline Compulsive Behavior". Tufts University School of Veterinary Medicine. http://www.tufts.edu/vet/vet_common/pdf/petinfo/dvm/case_march2005.pdf. Retrieved 21 December 2011. 
  121. ^ a b Lindell, Ellen M. (1997-12). "Intercat aggression: A retrospective study examining types of aggression, sexes of fighting pairs, and effectiveness of treatment". Applied Animal Behaviour Science 55 (1–2): 153–162. doi:10.1016/S0168-1591(97)00032-4. 
  122. ^ Akihiro Yamane, Teruo Doi and Yuiti Ono "Mating behaviors, courtship rank and mating success of male feral cat (Felis catus)" Journal of Ethology, Volume 14, Number 1, p35-44 (1996) doi:10.1007/BF02350090
  123. ^ Aggression Between Family Cats. The Humane Society of the United States 2002
  124. ^ Pedersen NC, Yamamoto JK, Ishida T, Hansen H, N. C. (1989). "Feline immunodeficiency virus infection". Vet. Immunol. Immunopathol. 21 (1): 111–29. doi:10.1016/0165-2427(89)90134-7. PMID 2549690. 
  125. ^ a b c Woods M, McDonald RA, Harris S. (2003). "Predation of wildlife by domestic cats Felis catus in Great Britain". Mammal Review 23 (2): 174–188. doi:10.1046/j.1365-2907.2003.00017.x. 
  126. ^ a b c Turner, Dennis C.; Bateson, Patrick (eds.) (2000). The Domestic Cat: The Biology of its Behaviour (2nd ed.). Cambridge, England: Cambridge University Press. ISBN 0-521-63648-5. 
  127. ^ "Why Do Cats Like High Places?". Drs. Foster & Smith, Inc.. Dr. Holly Nash, DVM, MS. Archived from the original on 2 January 2008. http://web.archive.org/web/20080102145008/http://www.peteducation.com/article.cfm?cls=1&cat=1313&articleid=1125. 
  128. ^ "Falling Cats". Archived from the original on 26 October 2005. http://web.archive.org/web/20051026122408/http://www.verrueckte-experimente.de/leseproben_e.html. Retrieved 24 October 2005. 
  129. ^ Nguyen, Huy D. (1998). "How Does a Cat Always Land on Its Feet?". Dynamics II (ME 3760) Course Materials. Georgia Institute of Technology, School of Medical Engineering. http://helix.gatech.edu/Classes/ME3760/1998Q3/Projects/Nguyen/. Retrieved 15 May 2007.  This is a tertiary source that clearly includes information from other sources but does not name them.
  130. ^ Leyhausen, Paul (1978). Cat Behavior: The Predatory and Social Behavior of Domestic and Wild Cats. New York: Garland STPM Press. ISBN 978-0-8240-7017-5. 
  131. ^ Desmond, Morris (1986). Catwatching: Why Cats Purr and Everything Else You Ever Wanted to Know. Crown Publishing. 
  132. ^ Kienzle, E. (1994). "Blood sugar levels and renal sugar excretion after the intake of high carbohydrate diets in cats". Journal of Nutrition 124 (12 Suppl): 2563S–2567S. PMID 7996238. http://jn.nutrition.org/content/124/12_Suppl/2563S.full.pdf. 
  133. ^ Bradshaw, John W. S. (April 1997). "Factors affecting pica in the domestic cat". Applied Animal Behaviour Science 52 (3–4): 373–379. doi:10.1016/S0168-1591(96)01136-7. 
  134. ^ "Pica: The Un-finicky Feline – Chewing or Eating Cords, Fabric, Houseplants, etc.". Behavior.VetMed.UCDavis.edu. University of California School of Veterinary Medicine. http://www.vmth.ucdavis.edu/home/beh/feline_behavior/pica.html. Retrieved 6 September 2009.  This is a tertiary source that clearly includes information from other sources but does not name them.
  135. ^ Wade, Nicholas (11 November 2010). "For Cats, a Big Gulp With a Touch of the Tongue". New York Times. http://www.nytimes.com/2010/11/12/science/12cats.html. Retrieved 12 November 2010. 
  136. ^ Poirier, F. E.; Hussey, L. K. (1 July 1982). "Nonhuman Primate Learning: The Importance of Learning from an Evolutionary Perspective". Anthropology & Education Quarterly 13 (2): 133–148. doi:10.1525/aeq.1982.13.2.05x1830j. JSTOR 3216627. 
  137. ^ Byers, John A.; Bekoff, Marc (1998). Animal play: evolutionary, comparative, and ecological perspectives. Cambridge, UK: Cambridge University Press. p. 135. ISBN 0-521-58656-9. 
  138. ^ Hall, Sarah L. (2002). "Object play in adult domestic cats: the roles of habituation and disinhibition". Applied Animal Behaviour Science 79 (3): 263–271. doi:10.1016/S0168-1591(02)00153-3. 
  139. ^ Hall, Sarah L. (1998-06). "The influence of hunger on object play by adult domestic cats". Applied Animal Behaviour Science 58 (1–2): 143–150. doi:10.1016/S0168-1591(97)00136-6. 
  140. ^ Norberg, S. T. (2002-11). "Gastrointestinal obstruction". Clinical Techniques in Small Animal Practice 17 (4): 178–183. doi:10.1053/svms.2002.36606. PMC 2391006. PMID 12324686. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2391006. 
  141. ^ "Fat indoor cats need exercise". Pocono Record. 10 December 2006. http://www.poconorecord.com/apps/pbcs.dll/article?AID=/20061210/NEWS01/612100320/-1/NEWS. 
  142. ^ Eye expert challenges laser pen 'danger' BBC News 24 November 1997
  143. ^ a b c d e "Prolific Cats: The Estrous Cycle". Veterinary Learning Systems. http://vlsstore.com/Media/PublicationsArticle/PV_23_12_1049.pdf. Retrieved 19 June 2009. 
  144. ^ Aronson, L. R.; Cooper, M. L. (1967). "Penile spines of the domestic cat: their endocrine-behavior relations". Anat. Rec. 157 (1): 71–8. doi:10.1002/ar.1091570111. PMID 6030760. http://www.catcollection.org/files/PenileSpines.pdf. 
  145. ^ Wildt DE, Seager SW, Chakraborty PK (1980). "Effect of copulatory stimuli on incidence of ovulation and on serum luteinizing hormone in the cat". Endocrinology 107 (4): 1212–7. doi:10.1210/endo-107-4-1212. PMID 7190893. 
  146. ^ Tsutsui, T.; Stabenfeldt, G. H. (1993). "Biology of ovarian cycles, pregnancy and pseudopregnancy in the domestic cat". J. Reprod. Fertil. Suppl. 47: 29–35. PMID 8229938. 
  147. ^ Behrend, Katrin; Wegler, Monika; translated from German by Elizabeth D. Crawford. (1991). The Complete Book of Cat Care: How to Raise a Happy and Healthy Cat. Hauppauge, NY: Barron's Educational Series, Inc.. p. 28. ISBN 0-8120-4613-7. 
  148. ^ Olson PN, Kustritz MV, Johnston SD (2001). "Early-age neutering of dogs and cats in the United States (a review)". J. Reprod. Fertil. Suppl. 57: 223–32. PMID 11787153. 
  149. ^ Root Kustritz, Margaret V. (2007). "Determining the optimal age for gonadectomy of dogs and cats". J Am Vet Med 231 (11): 1665–75. doi:10.2460/javma.231.11.1665. PMID 18052800. http://www.imom.org/spay-neuter/pdf/kustritz.pdf. 
  150. ^ Chu, K.; Anderson, W. M.; Rieser, M. Y. (2009). "Population characteristics and neuter status of cats living in households in the United States". Journal of the American Veterinary Medical Association 234 (8): 1023–1030. doi:10.2460/javma.234.8.1023. PMID 19366332. 
  151. ^ Say, Ludovic (2002). "Spatio-temporal variation in cat population density in a sub-Antarctic environment". Polar Biology 25 (2): 90–95. doi:10.1007/s003000100316. 
  152. ^ Frenot, Y; Chown, Steven L.; Whinam, Jennie; Selkirk, Patricia M.; Convey, Peter; Skotnicki, Mary; Bergstrom, Dana M. (2005). "Biological Invasions in the Antarctic: Extent, Impacts and Implications". Biological Reviews 80 (1): 45–72. doi:10.1017/S1464793104006542. 
  153. ^ "Ecology of Felis catus". Global Invasive Species Database. Invasive Species Specialist Group. 2006. http://www.issg.org/database/species/ecology.asp?si=24&fr=1&sts=sss&lang=EN. Retrieved 31 August 2009. 
  154. ^ a b Nogales M, Martin A, Tershy BR, Donlan CJ, Veitch D, Uerta N, Wood B, Alonso J. (2004). "A Review of Feral Cat Eradication on Islands". Conservation Biology 18 (2): 310. doi:10.1111/j.1523-1739.2004.00442.x. 
  155. ^ "100 of the World's Worst Invasive Alien Species: a Selection from the Global Invasive Species Database". The Invasive Species Specialist Group. 2000. Archived from the original on 27 September 2007. http://web.archive.org/web/20070927223530/http://www.issg.org/booklet.pdf. Retrieved 31 August 2009. 
  156. ^ Robertson ID (1998). "Survey of predation by domestic cats". Aust. Vet. J. 76 (8): 551–4. doi:10.1111/j.1751-0813.1998.tb10214.x. PMID 9741724. 
  157. ^ Beckerman AP, Boots M, Gaston KJ. (2007). "Urban bird declines and the fear of cats". Animal Conservation 10 (3): 320–325. doi:10.1111/j.1469-1795.2007.00115.x. http://img2.tapuz.co.il/forums/1_102419784.pdf. 
  158. ^ Courchamp F, Chapuis JL, Pascal M (2003). "Mammal invaders on islands: impact, control and control impact". Biol Rev Camb Philos Soc 78 (3): 347–83. doi:10.1017/S1464793102006061. PMID 14558589. 
  159. ^ Rayner MJ, Hauber ME, Imber MJ, Stamp RK, Clout MN (2007). "Spatial heterogeneity of mesopredator release within an oceanic island system". Proc. Natl. Acad. Sci. U.S.A. 104 (52): 20862–5. doi:10.1073/pnas.0707414105. PMC 2409232. PMID 18083843. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2409232. 
  160. ^ Chris R. Dickman (1996). "Overview of the Impacts of Feral Cats on Australian Native Fauna". Australian Department of the Environment, Water, Heritage and the Arts. Archived from the original on 13 September 2007. http://web.archive.org/web/20070913172757/http://www.environment.gov.au/biodiversity/invasive/publications/cat-impacts/pubs/impacts-feral-cats.pdf. Retrieved 28 August 2009. 
  161. ^ James H, Acharya AB, Taylor JA, Freak MJ (2002). "A case of bitten Bettongs". J Forensic Odontostomatol 20 (1): 10–2. PMID 12085522. 
  162. ^ Glen AS, Dickman CR (2005). "Complex interactions among mammalian carnivores in Australia, and their implications for wildlife management". Biol Rev Camb Philos Soc 80 (3): 387–401. doi:10.1017/S1464793105006718. PMID 16094805. 
  163. ^ May, R. (1988). "Control of feline delinquency". Nature 332 (6163): 392–393. doi:10.1038/332392a0. 
  164. ^ Liberg, O. (1982). "Food habits and prey impact by feral and house-based domestic cats in a rural area in southern Sweden". Journal of Mammalogy (Journal of Mammalogy, Vol. 65, No. 3) 65 (3): 424–432. doi:10.2307/1381089. JSTOR 1381089. 
  165. ^ Chucher, P.B.; Lawton, J.H. (1987). "Predation by domestic cats in an English village". Journal of Zoology, London 212 (3): 439–455. doi:10.1111/j.1469-7998.1987.tb02915.x. 
  166. ^ a b Mead, C.J. (1982). "Ringed birds killed by cats". Mammal Review 12 (4): 183–186. doi:10.1111/j.1365-2907.1982.tb00014.x. 
  167. ^ Crooks, Kevin R.; Soulé, Michael E. (1999). "Mesopredator release and avifaunal extinctions in a fragmented system". Nature 400 (6744): 563–566. doi:10.1038/23028. http://www38.homepage.villanova.edu/jameson.chace/Urban%20Ecology/Crooks&Soule_Mesopredator_release.pdf. 
  168. ^ Fiztgerald, M. B.; Turner, Dennis C.. Turner & Bateson, op. cit.. ed (in The Domestic Cat: The Biology of its Behaviour). Hunting Behaviour of Domestic Cats and Their Impact on Prey Populations. pp. 151–175. 
  169. ^ Courchamp, F.; Langlais, M. and Sugihara, G. (1999). "Cats protecting birds: modelling the mesopredator release effect". Journal of Animal Ecology 68 (2): 282–292. doi:10.1046/j.1365-2656.1999.00285.x. 
  170. ^ Stattersfield, A.J.; Crosby, M.J., Long, A.J. and Wege, D.C. (1998). Endemic Bird Areas of the World: Priorities for Biodiversity Conservation. "BirdLife Conservation Series" No. 7. Cambridge, England: Burlington Press. ISBN 0-946888-33-7. 
  171. ^ Williams, A.J. (1984). Status and Conservation of Seabirds at some Islands in the African Sector of the Southern Ocean. In: Status and Conservation of the World’s Seabirds, ed Croxall, J.P., Evans, P.G.H. & Schreiber, R.W. International Council for Bird Preservation.. Cambridge.. pp. 627–635. 
  172. ^ Falla, R. A. (1955). New Zealand Bird Life Past and Present. Stiles. 
  173. ^ Galbreath, R.; Brown, D. (2004). "The Tale of the Lighthouse-keeper's Cat: Discovery and Extinction of the Stephens Island Wren (Traversia lyalli)". Notornis 51: 193–200. Archived from the original on 17 October 2008. http://wayback.archive.org/web/*/http://www.notornis.org.nz/free_issues/Notornis_51-2004/Notornis_51_4_193.pdf. Retrieved 14 December 2011. 
  174. ^ a b Dowding, J.E.; Murphy, E.C. (2001). "The Impact of Predation be Introduced Mammals on Endemic Shorebirds in New Zealand: A Conservation Perspective". Biological Conservation 99: 47–64. doi:10.1016/S0006-3207(00)00187-7. 
  175. ^ Whiting, M.F.; Bradler, S. and Maxwell, T. (2003). "Loss and Recovery of Wings in Stick Insects". Nature 421 (6920): 264–267. doi:10.1038/nature01313. PMID 12529642. 
  176. ^ WCMC, .; McComb, J., Groombridge, B., Byford, E., Allan, C., Howland, J., Magin, C., Smith, H., Greenwood, V. and Simpson, L. (1992). World Conservation Monitoring Centre.. Chapman and Hall.. ISBN 2-8317-0156-2. 
  177. ^ Steadman, D.W.; Martin, P.S. (2003). "The Late Quaternary Extinction and Future Resurrection of Birds on Pacific Islands". Earth Science Reviews 61: 133–147. Bibcode 2003ESRv...61..133S. doi:10.1016/S0012-8252(02)00116-2. 
  178. ^ a b "Market Research Statistics – U.S. Pet Ownership". American Veterinary Medical Association. http://www.avma.org/reference/marketstats/ownership.asp. Retrieved 27 August 2009. 
  179. ^ Abby Ellin (5 October 2008). "More Men Are Unabashedly Embracing Their Love of Cats". New York Times. http://www.nytimes.com/2008/10/05/fashion/05cats.html. Retrieved 30 August 2009. 
  180. ^ a b Jones, Jeffrey M. (30 November 2007). "Companionship and Love of Animals Drive Pet Ownership". Gallup, Inc. http://www.gallup.com/poll/102952/companionship-love-animals-drive-pet-ownership.aspx. Retrieved 30 August 2009. 
  181. ^ Richards, James R. (1 September 1999). ASPCA Complete Guide to Cats. San Francisco: Chronicle Books LLC. p. 65. ISBN 0-8118-1929-9. 
  182. ^ "What Is That They're Wearing?". Humane Society of the United States. Archived from the original on 1 December 2006. http://web.archive.org/web/20061201153853/http://www.hsus.org/web-files/PDF/What-is-that-they-re-wearing_FurBooklet.pdf. Retrieved 22 October 2009. 
  183. ^ "EU proposes cat and dog fur ban". BBC News. 20 November 2006. http://news.bbc.co.uk/2/hi/europe/6165786.stm. Retrieved 22 October 2009. 
  184. ^ Ikuma, Carly (27 June 2007). "EU Announces Strict Ban on Dog and Cat Fur Imports and Exports". HSUS.org. Humane Society International. Archived from the original on 17 February 2009. http://web.archive.org/web/20090217153420/http://www.hsus.org/about_us/humane_society_international_hsi/hsi_europe/dog_cat_fur/. Retrieved 14 December 2011. 
  185. ^ Paterson, Tony (25 April 2008). "Switzerland Finds a Way to Skin a Cat for the Fur Trade and High Fashion". The Independent (London , England). http://www.independent.co.uk/news/world/europe/switzerland-finds-a-way-to-skin-a-cat-for-the-fur-trade-and-high-fashion-815426.html. Retrieved 23 October 2009. 
  186. ^ "China Protesters: Stop 'Cooking Cats Alive' – Fury After Newspaper Says 10,000 Felines Are Eaten Daily in Single Province". AP Newswire. Associated Press. 18 December 2008. http://www.msnbc.msn.com/id/28292558/. Retrieved 14 December 2011. 
  187. ^ Clifton, Merritt; Bartlett, Kim (September 2003). "How Many Dogs and Cats Are Eaten in Asia?". AnimalPeopleNews.org. Animal People, Inc.. http://www.animalpeoplenews.org/03/9/dogs.catseatenAsia903.html. Retrieved 14 December 2011. 
  188. ^ a b c d Mason, I. L. (1984). Evolution of Domesticated Animals. Prentice Hall Press. ISBN 0-582-46046-8. 
  189. ^ Quinion, Michael (17 July 1999). "Moggie". World Wide Words. self-published. http://www.worldwidewords.org/qa/qa-mog1.htm. Retrieved 14 December 2011. [self-published source]
  190. ^ Brown, Jean; Osmond, Paul; Baker, Marj; and Cuttell, Sam (1995). "The Manx: Cat Breed FAQ". Fanciers.com. Cat Fanciers. http://fanciers.com/breed-faqs/manx-faq.html#description. Retrieved 25 June 2010. 
  191. ^ "Breed Profile: Siamese". Cat Fanciers Association. Archived from the original on 11 May 2008. http://web.archive.org/web/20080511203954/http://www.cfainc.org/breeds/profiles/siamese.html. Retrieved 25 June 2010. 
  192. ^ French, Barbara. "Torties, Calicos and Tricolor Cats". Fanciers.com. http://www.fanciers.com/cat-faqs/tricolors.shtml. Retrieved 24 October 2005. [self-published source]
  193. ^ a b Kravetz JD, Federman DG (2002). "Cat-associated zoonoses". Arch. Intern. Med. 162 (17): 1945–52. doi:10.1001/archinte.162.17.1945. PMID 12230416. 
  194. ^ Talan DA, Citron DM, Abrahamian FM, Moran GJ, Goldstein EJ (1999). "Bacteriologic analysis of infected dog and cat bites. Emergency Medicine Animal Bite Infection Study Group". N. Engl. J. Med. 340 (2): 85–92. doi:10.1056/NEJM199901143400202. PMID 9887159. 
  195. ^ Torda A (2001). "Toxoplasmosis. Are cats really the source?". Aust Fam Physician 30 (8): 743–7. PMID 11681144. 
  196. ^ Svobodová V, Knotek Z, Svoboda M (1998). "Prevalence of IgG and IgM antibodies specific to Toxoplasma gondii in cats". Vet. Parasitol. 80 (2): 173–6. doi:10.1016/S0304-4017(98)00201-5. PMID 9870370. 
  197. ^ Meireles LR, Galisteo AJ, Pompeu E, Andrade HF (2004). "Toxoplasma gondii spreading in an urban area evaluated by seroprevalence in free-living cats and dogs". Trop. Med. Int. Health 9 (8): 876–81. doi:10.1111/j.1365-3156.2004.01280.x. PMID 15303992. 
  198. ^ De Craeye S, Francart A, Chabauty J (2008). "Prevalence of Toxoplasma gondii infection in Belgian house cats". Vet. Parasitol. 157 (1–2): 128–32. doi:10.1016/j.vetpar.2008.07.001. PMID 18707811. 
  199. ^ Erwin EA, Woodfolk JA, Custis N, Platts-Mills TA (2003). "Animal danders". Immunol Allergy Clin North Am 23 (3): 469–81. doi:10.1016/S0889-8561(03)00004-3. PMID 14524386. 
  200. ^ "Dealing with cat allergies". animaltrustees.org. Archived from the original on 4 June 2007. http://web.archive.org/web/20070604203854/http://www.animaltrustees.org/ATA_Web/pdfs/dealingwithcatallergies.pdf. 
  201. ^ Simpson A, Custovic A (2003). "Early pet exposure: friend or foe?". Curr Opin Allergy Clin Immunol 3 (1): 7–14. doi:10.1097/00130832-200302000-00002. PMID 12582308. 
  202. ^ Simpson A, Custovic A (2005). "Pets and the development of allergic sensitization". Curr Allergy Asthma Rep 5 (3): 212–20. doi:10.1007/s11882-005-0040-x. PMID 15842959. 
  203. ^ Avner, D. B.; Perzanowski, M. S.; Platts-Mills, T. A.; Woodfolk, J. A. (1997). "Evaluation of different techniques for washing cats: quantitation of allergen removed from the cat and the effect on airborne Fel d 1". Journal of Allergy and Clinical Immunology 100 (3): 307–312. doi:10.1016/S0091-6749(97)70242-2. PMID 9314341. 
  204. ^ Miller, Henry (2005). "Cat and Mouse in Regulating Genetic 'Enhancement'". Nature Biotechnology 23 (2): 171–172. doi:10.1038/nbt0205-171. PMID 15696141. 
  205. ^ Allen, K.; Blascovich, J.; Mendes, W. B. (2002). "Cardiovascular reactivity and the presence of pets, friends, and spouses: the truth about cats and dogs". Psychosom Med 64 (5): 727–739. doi:10.1097/01.PSY.0000024236.11538.41. PMID 12271103. 
  206. ^ Turner, Dennis C.; Rieger, G.; Gygax, L. (2003). "Abstract: 'Spouses and Cats and Their Effects on Human Mood'". ScientificCommons.org (Berlin: magazine.One UG). http://en.scientificcommons.org/20081280. Retrieved 25 June 2010. 
  207. ^ Qureshi, A. I.; Memon, M. Z.; Vazquez, G.; Suri, M. F. (2009). "Cat Ownership and the Risk of Fatal Cardiovascular Diseases". Journal of Vascular and Interventional Neurology 2 (1): 132–135. 
  208. ^ Serpell, J. (3 October 2011). "Beneficial Effects of Pet Ownership on Some Aspects of Human Health and Behaviour". Journal of the Royal Society of Medicine 84 (12): 717–720. PMC 1295517. PMID 1774745. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1295517.  May be available at NCBI.NLM.NIH.gov.
  209. ^ Landsberg GM (1991). "Feline scratching and destruction and the effects of declawing". Vet. Clin. North Am. Small Anim. Pract. 21 (2): 265–79. PMID 2053250. 
  210. ^ "FAB nformation Sheet: Scratching or Clawing in the House". FABCats.org. Tisbury, England: Feline Advisory Bureau. February 2008. http://www.fabcats.org/behaviour/scratching/info.html. Retrieved 14 August 2005. 
  211. ^ a b Swiderski J (2002). "Onychectomy and its alternatives in the feline patient". Clin. Tech. Small Anim. Pract. 17 (4): 158–161. doi:10.1053/svms.2002.36604. PMID 12587280. 
  212. ^ a b Welfare Implications of Declawing of Domestic Cats American Veterinary Medical Association 9 April 2009
  213. ^ Patronek, GJ (2001). "Assessment of claims of short- and long-term complications associated with onychectomy in cats". J. Am. Vet. Med. Assoc. 219 (7): 932–7. doi:10.2460/javma.2001.219.932. PMID 11601788. http://symptomresearch.nih.gov/chapter_1/index.htm. 
  214. ^ "Paw Project Acknowledgements". Pawproject.org. 20 February 2011. http://www.pawproject.org/html/acknow.asp. Retrieved 30 October 2011. 
  215. ^ "Issues: AVMA Policy: Declawing of Domestic Cats". AVMA.org. American Veterinary Medical Association. April 2009. http://www.avma.org/issues/policy/animal_welfare/declawing.asp. Retrieved 30 July 2010. 
  216. ^ Hornfeldt, CS; Westfall (1996). "Suspected bentonite toxicosis in a cat from ingestion of clay cat litter". Veterinary and human toxicology 38 (5): 365–6. PMID 8888544. 
  217. ^ "A Step-by-Step Guide on How to Train Your Cat to Use the Human Toilet". ToiletTrainedCat.com. Point Roberts, Washington: The Toilet Trained Cat Co.. 2009. http://www.toilettrainedcat.com/toilet-train-cat.php. Retrieved 15 February 2009. [self-published source]
  218. ^ a b What is the difference between a stray cat and a feral cat? Humane Society of the United States
  219. ^ Torre Argentina cat shelter. Retrieved 17 June 2009.
  220. ^ Rowan, Andrew N.; Deborah J. Salem (2003-11). "4". The State of the Animals II: 2003. Humane Society Press. ISBN 0-9658942-7-4. http://web.archive.org/web/20061110230426/http://www.hsus.org/web-files/PDF/hsp/SOA_3-2005_Chap4.pdf. 
  221. ^ Muir, Hazel (8 April 2004). "Ancient remains could be oldest pet cat". New Scientist. http://www.newscientist.com/article/dn4867.html. Retrieved 23 November 2007. 
  222. ^ Walton, Marsha (9 April 2004). "Ancient burial looks like human and pet cat". CNN. http://edition.cnn.com/2004/TECH/science/04/08/cats.cyprus/index.html. Retrieved 23 November 2007. 
  223. ^ Veyne, Paul (2002) [1987]. ""The Household and Its Freed Slaves"". The Roman Empire. Arthur Goldhammer (Trans.) (3rd ed.). Cambridge, Massachusetts: Harvard College. p. 81. ISBN 0-674-77771-9. http://books.google.com/books?id=JmpOH8AVV4EC&printsec=frontcover. 
  224. ^ Geyer, Georgie Anne (2004). When Cats Reigned Like Kings: On the Trail of the Sacred Cats. Kansas City, Missouri: Andrews McMeel. ISBN 0-7407-4697-9. 
  225. ^ Minou Reeves (2000). Muhammad in Europe. New York University (NYU) Press. p. 52. ISBN 0-8147-7533-0. 
  226. ^ Nora Sugobono (7 March 2010). "Las vidas del gato" (in Spanish). El Comercio. http://elcomercio.pe/impresa/notas/vidas-gato/20100307/423959. Retrieved 19 March 2010. 
  227. ^ Tim Dowling (19 March 2010). "Tall tails: Pet myths busted". The Guardian (UK). http://www.guardian.co.uk/lifeandstyle/gallery/2010/mar/18/guide-to-pets-pet-myths?picture=360591960. Retrieved 18 March 2010. 
  228. ^ Wachtmeister, Rosina (2008). "Cat Myths, Misinformation and Untruths". Best-Cat-Art.com. self-published. http://www.best-cat-art.com/cat-myths.html. Retrieved 22 November 2008. [self-published source]
  229. ^ ASPCA (30 June 2005). "The ASPCA Warns About High-Rise Falls by Cats". New York: About.com. http://cats.about.com/od/catsafety/a/highrisefalls.htm. Retrieved 26 April 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The domestic cat is treated by different authors as either a distinct species (Felis catus) or as a subspecies (Felis sylvestris catus). For convenience, it is treated here as Felis catus to distinguish it from the wild populations of Felis sylvestris. Wozencraft (in Wilson and Reeder 2005) discussed the taxonomy of catus and sylvestris and listed Felis catus and Felis sylvestris as distinct species. Baker et al. (2003) also listed the domestic cat as Felis catus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!