Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Description

There are only three species of Peccaries in the world, all in South America. Only Collared Peccaries also live in North America. Their range includes a great variety of habitats, and they eat all kind of vegetation, including cactus. They live in highly social and communicative groups. Grooming is an important social behavior, and they have at least 15 different types of calls signaling alarm, submission, and aggression. Territorial groups of 15-50 animals stay together, and cooperate to defend the herd, but they form subgroups that disperse to feed. An alpha male is the dominant animal in the herd. Peccaries often have twins.

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:50, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Collared Peccary is widely distributed. It occurs in Arizona, New Mexico, and Texas in the USA, a large part of Mexico and Central America, the entire Amazon basin, the Pacific coastal forest of Colombia, Ecuador and Peru, the llanos and lowland forest of Venezuela, the Guianas and Suriname, all of Brazil where it is increasingly fragmented in the south and east, and the Gran Chaco of Paraguay, Bolivia and northern Argentina where it also occurs in the upper Parana and Paraguay river basins. In Argentina, the species is extinct in the eastern and southern portions of its original distribution. The Argentine population/s of Collared Peccaries in Misiones is isolated from the rest of the country. Some of the larger islands near the mainland in the Caribbean, such as Trinidad and Tobago, also have populations of P. tajacu. However, islands further from the mainland do not currently have peccaries. Their range has recently expanded northward in the southwestern United States (Albert et al. 2004) including into Oklahoma adjacent to Texas (Stangl and Dalquest 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Collared Peccaries are found in the Nearctic and Neotropical regions. The 14 subspecies occur from northern Argentina in South America, throughout Central America, and have spread into the southern Arizona, New Mexico, and Texas in the United States.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Northern Argentina and northwestern Peru to north-central Texas, northwestern New Mexico (Albert et al. 2004), and Arizona; introduced in Cuba (Grubb, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Shoulder height: 0.3 to 0.5 m Length: 0.8 to 1.0 m. Weight: 15 to 25 kg. Collared Peccaries are often confused with pigs due to their appearance. Their coat is a grizzled grayish black throughout, except for a yellowish tinge on the cheeks and a whitish to yellowish collar extending the mane, over the shoulders, and to the throat. While males and females are very similar in size and color, young are a yellowish brown color, with a black stripe down the back. Collared Peccaries have short, straight tusks that fit together tightly enough to hone eachother down with every jaw movement. This razor sharpness gives this species its common name: Javelina: a javelin is a lightweight, tip-shaped spear. Javelinas have a distinct dorsal gland on the rump that is essential in much species-specific behavior. They also have poor eyesight and good hearing, which are believed to contribute to the very vocal nature of this species.

Range mass: 15 to 25 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 33.165 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 102 cm

Weight: 29500 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 0.85-1.02 m

Weight:
Range: 15-25 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
P. tajacu is a highly adaptable species inhabiting a wide variety of habitats from tropical forests to deserts. At the northern fringe of its range, Collared Peccary maintain viable populations in areas where winter night-time temperatures fall below 0° C and light snow cover is occasionally present. The species' tolerance of low seasonal temperatures is exceptional for an animal also living in the tropics (Bodmer and Sowls 1993). The upper limit of its range along the Andean foothills is between 1,000-1,500 m (Grimwood 1969), though they have been found up to 2,000 m asl in Ecudaor (G. Zapata-Rios pers. comm.) and up to 3,000 m asl in the Sierra de las Minas Biosphere Reserve in central-eastern Guatemala (J. Moreira pers. comm.).
Like all peccaries, P. tajacu is a highly social animal, living in herds, which vary from fewer than six to over 30 individuals. Home ranges of groups average approximately 150 ha, but can range from 24 to 800 ha (Sowls 1984). Variation of home range size among different herds in various regions is not unusual. In the Neotropics mean home range estimates of radio-tracked Collared Peccary herds were 102 - 287 ha in the semideciduous Atlantic forest in southeastern Brazil (Keuroghlian et al 2004); 64 – 109 ha in Northwestern Costa Rica (McCoy et al 1990); 460 – 543 ha on the Maraca Island of Brazil (Fragoso 1994); 685 ha in the Chaco of Paraguay (Taber et al 1994); and 157 - 243 ha in the French Guyana (Judas and Henry 1999).
The species' diet varies in accordance with this range of habitats (Beck 2005, 2006). Foods of P. tajacu can include roots, tubers, fruits, seeds, and edible parts of green growing plants, insects, and small animals (Beck 2005, 2005; Desbiez 2007; Keuroghlian and Eaton 2008). Throughout their neotropical range P. tajacu consume fruits from over 128 plant species, and destroy seeds form 79 species (Beck 2006). In tropical forests, diets are dominated by palm fruits (over 25 species, Beck 2005), supplemented with small vertebrates and invertebrates (Bodmer 1989, Beck 2005), whereas in deserts environments their diet is dominated by the cladophylls of prickly pear cactus (Opuntia spp.) (Corn and Warren 1985, Beck 2005). In a heterogeneous environment, the distribution and abundance of resources would be expected to vary among the small, spatially-stable home ranges of Collared Peccary herds. Because each herd uses a unique subset of the available habitat types (McCoy et al 1990, Judas and Henry, 1999, Fragoso,1999; Keuroghlian et al 2004, Neri 2004). The level of frugivory will vary according to local vegetation types or frugivore guild composition (Keuroghlian and Eaton 2008). Frugivory in the Atlantic Forest of Brazil for Collared Peccaries was 78% for both the dry and wet seasons. In the Peruvian Amazon 59 - 66% was composed of fruits (Kiltie 1981, Bodmer 1989); and in the Brazilian Pantanal, frugivory dramatically differed between dry and wet seasons, 17% to 49% respectively (Desbiez 2007).
Habitat and riparian zone use were herd specific for Collared Peccaries in the Atlantic Forest fragment of Brazil, and related to habitat quality and composition where stable home ranges had been established (Neri 2007, Keuroghlian and Eaton in press). Herds are kept together by vocalizations and a strong musk released from the dorsal gland. They deposit scent on tree trunks, rocks and other individuals (Byers 1980). The Collared Peccary has a diurnal/crepuscular activity pattern, typically feeding in early hours of the night but varying seasonally. They commonly rest in small groups of three to four individuals and often seek shelter in burrows, caves and under logs. Collared Peccaries frequently wallow in mud or dust and rarely spend time auto-grooming (Sowls 1984). Keuroghlian et al 2004 observed that subgrouping of herds occurred on a different spatial and temporal scale than the subherding of White-lipped Peccaries. Usually, a herd would be united early in the morning and again in late afternoon, but would split into groups of 1 to 3 individuals during the day. These subgroups appeared to forage separately and were from 30 to 250 m apart. Sightings of lone Collared Peccaries or groups of 2 to 3 individuals have frequently been reported from sites in both the Neotropics and the southwestern United States (Kiltie and Terborgh, 1983; Robinson and Eisenberg, 1985; Sowls, 1997; Castellanos, 1983; Oldenburg et al. 1985; Bissonette, 1976; Green et al. 1984). Collared Peccaries appeared to travel more in the early morning and late afternoon, when the full herd was together. During midday, subherds would usually remain in a relatively restricted area foraging. They also spent a good part of late morning and early afternoon resting in cavities excavated at the bases of large trees, next to fallen trunks, or in other cool locations (Taber et al. 1994, Keuroghlian et al. 2004).
Births have been recorded year-round, though in the southern USA there is a birth peak during the summer rainy season. In the Amazon, the Collared Peccary female is considered to be aseasonally polyoestrous (Mayor et al. 2006), with an oestrous cycle length of 27.8 ± 1.5 days (Mauget et al. 1997), a mean gestation period of 138 days (Mayor et al. 2005), a pregnancy rate of 42.5% (Mayor et al. 2010) and a litter size of 1.7 – 1.9 foetuses or newborns (Gottdenker and Bodmer 1998, Mayor et al. 2006). Reproductive production of the species in the wild was estimated at 1.12 births/year and 1.98 piglets per pregnant female (Mayor et al. 2010). Collared Peccary females presented a mean ovulation rate of 2.25 ± 0.58 CLs, a litter size of 1.77 ± 0.48 embryos or foetuses and a reproductive wastage of 0.45 ± 0.65 (21.3%) oocytes or embryos per pregnant female female (Mayor et al. 2010). Among 163 piglets, 78 were females and 85 were males. The young are highly precocial at birth, following their mothers within an hour of parturition and stopping to suckle at frequent intervals. In one case infants were observed to spend up to 24% of their time suckling (Sowls 1966). Weaning occurs at approximately 6 weeks (Sowls 1984).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

In South and Central America, the Collared Peccary inhabits tropical rainforests. In the southern United States, herds occur in Saguaro deserts, where they prefer mesquite habitats with an abundance of prickly pear cacti. Collared Peccaries have also become common in residential areas, where they may rely on human handouts for food.

Terrestrial Biomes: desert or dune ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Seldom abundant in absence of dense, scrubby ground cover. Often in thickets along creeks and washes. In southern Texas, prime habitat was dense scrub cover with succulents (Ilse and Hellgren 1995). On the Zuni Indian Reservation, New Mexico, animals were observed at elevations up to 2,335 m in piñon-juniper and ponderosa pine habitats (Albert et al. 2004). Rests in caves, mine shafts, rock crevices, holes in ground. May visit water hole daily.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Collared Peccaries are primarily herbivorous, and have complex stomachs for digesting coarsely-chewed food. In its southern range, this species eats a variety of foods, including roots, bulbs, fungi, and nuts, in addition to fruits and occasional eggs, carrion, snakes, fish, and frogs. In the northern range, Collared Peccaries eats more herbivorous foods, such as roots, bulbs, beans, nuts, berries, grass, and cacti. Despite all this supplementary diet, the main dietary components of this species are agaves and prickly pears. The prickly pear is ideal in the Javelina's arid range due to its high water content. This species is also capable of eating cultivated planted by humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic omnivore. Eats acorns, tubers, bulbs, fruits and rhizomes, pads or cladophyls of cacti, beans of mesquite, catclaw, figs, eggs of birds and turtles, some carrion. Prickly pear cactus is a preferred food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Travels in socially cohesive groups of two to thirty individuals, may bed down together. At Welder Wildife Refuge, Texas, crude density was 2.0 per sq km; mean annual home range size (95% minimum convex polygon) was 1.76 sq km (Ilse and Hellgren 1995). Group home range size is several hundred acres; herd may defend territiory. Extreme cold may result in considerable mortality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active in early morning, late afternoon, and at night. Activity crepuscular and nocturnal in hot weather; may continue throughout day with short rest periods in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
31.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 31.5 years (captivity) Observations: One captive specimen was still alive at 31.5 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

A designated or specific breeding season does not prevail in Collared Peccary herds; rather, mating reflects climate, especially rain, and occurs throughout the year. More young are raised in rainy years. The dominant male does virtually all the breeding. Subordinate males do not have to leave the herd, but are not allowed to approach females in estrus. As a result, bachelor herds do not exist. 1 to 3, but rarely 4, young are born after a gestation period of 141 to 151 days. Birthing mothers retreat from the group; the newborn might otherwise be eaten by other group members. However, mothers rejoin the herd 1 day after giving birth. Only the older sisters of the newborn are tolerated with the young; these often become nursemaids for the new mother. Weaning occurs at 2 to 3 months. Males reach sexual maturity at 11 months; females, at 8 to 14 months. Despite the high mortality rate in this species, members have a life span of up to 24 years, which was observed in captivity.

Average birth mass: 700 g.

Average gestation period: 145 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
358 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
329 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds throughout year, but in desert areas births are concentrated in the summer rainy season (July or August in Arizona). Litter size is 1-3 (usually 2). Gestation lasts 142-148 days. Young are precocial at birth and follow their mother from the first day or two until they are at least a year old.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Tayassu tajacu

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Pecari tajacu

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2409-09|AP003427|Pecari tajacu| GAACGCTGATTATTCTCAACCAATCACAAAGATATTGGCACCCTGTACTTACTGTTCGGTGCTTGAGCGGGGATAGTAGGGACTGCCCTA---AGCCTGCTTATCCGTGCTGAACTAGGCCAACCTGGGACTCTACTCGGAGAT---GATCAAATCTACAATGTAGTCGTAACAGCCCACGCCTTTGTAATAATTTTCTTCATAGTCATACCCATCATAATTGGAGGCTTCGGAAATTGACTAGTACCACTGATA---ATTGGGGCACCAGATATAGCCTTTCCCCGAATGAACAACATAAGCTTTTGACTATTGCCACCATCATTCCTATTATTACTAGCATCTTCAATAGTAGAAGCAGGAGCGGGTACGGGGTGAACCGTTTATCCCCCACTAGCTGGGAATCTGGCCCATGCAGGAGCCTCTGTAGACCTA---ACCATTTTCTCCCTACATCTAGCAGGAATCTCCTCAATTCTAGGTGCTATCAACTTTATCACTACTATTATTAATATAAAACCACCAGCAGTATCTCAGTACCAAACACCCTTATTCGTTTGATCTATCCTAATTACAGCTGTGCTACTACTCCTATCACTCCCCGTCCTAGCAGCG---GGTATTACTATATTACTAACAGACCGAAACCTAAATACAACTTTCTTTGATCCGGCCGGAGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTATCCTACCTGGATTTGGAATAATCTCTCACATTGTGACTTATTACTCAGGAAAAAAG---GAACCTTTTGGATATATAGGAATAGTATGAGCCATAATATCCATCGGCTTCCTAGGATTCATTGTATGAGCTCACCACATATTTACTGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pecari tajacu

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Gongora, J., Reyna-Hurtado, R., Beck, H., Taber, A., Altrichter, M. & Keuroghlian, A.

Reviewer/s
Mayor, P. & Biondo, C.

Contributor/s

Justification
Listed as Least Concern as this species is widely distributed and occurs in a variety of habitats, including woodlands, tropical dry and rainforests, savannas, Gran Chaco, and deserts, from the southern USA through to northern Argentina. However, given the continuing rates of habitat destruction and potential for over-hunting of this species, the status of all populations requires monitoring.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The main predators of Collared Peccaries are humans, coyotes, pumas, jaguars, and bobcats. For centuries, young Peccaries have been captured, kept as domestic pets, and even fattened by Central and South American Indians. In Peru, 10,000 skins have been exported annually for decades. In Texas, more than 20,000 individuals are shot during the hunting season. Populations are fairly resilient due to adaptability, although subspecies in the tropics are threatened by rainforest destruction.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Densities of Collared Peccary differ among habitats. In the south-eastern USA, older reports of densities ranged from 10.9 individuals/km2 in the Tucson mountains (Schweinsburg 1969), 7.3 individuals/km2 at the King Ranch, Texas and 3.5 individuals/km2 at the Welder Wildlife Refuge, Texas, to only 1.1 individuals/km2 in a Texas desert. In Venezuela, Collared Peccary density in the llanos was found to be 8 individuals/km2, whereas, in gallery forests was 2 individuals/km2 (Eisenberg 1980). In the Pantanal of Brazil densities range from 6.6 (forested) to 5.5 (cerrado) individuals/km2 (Desbiez 2007). Densities in tropical forest range from 9 individuals/km2 on Barro Colorado Island, Panama (Glanz 1982), to 5 individuals/km2 in Manu National Park, Peru (Terborgh et al. 1986). In the Peruvian Amazon, densities range from 3,7 individuals/km2 in non-flooded terra firme forest to 1.0 in flooded forest (Fang et al. 2008). In a forest fragment of Atlantic Forest of Brazil, the density found was 5.9 and 6.4 individuals/km2 (Cullen 1997, Keuroghlian et al. 2004). In a recent study conducted in the Argentine Chaco, Altrichter and Boaglio (2004) found the Collared Peccary to be more common, widely distributed and present under a wider range of conditions than the other two species of peccaries. Previous studies have shown that Collared Peccaries are less vulnerable than White-lipped Peccaries to habitat fragmentation and hunting pressure, and can maintain healthy populations even in highly degraded areas (Peres 1996, Cullen et al. 2000). The Collared Peccary's smaller herd size and range requirements facilitate its survival in small, disturbed forest remnants (i.e. Atlantic Forest of Brazil), and they have frequently been observed using matrix habitat adjacent to larger forest fragments, e.g. satellite forests and secondary growth (Keuroghlian et al. 2004).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The two major threats to the survival of Collared Peccary are over-hunting for their meat and hides and excessive destruction of its natural habitats. These factors have already resulted in the extensive fragmentation of peccary populations and its extirpation over large parts of its former range (Bodmer and Sowls 1993). The Collared Peccary (Pecari tajacu) and White-lipped Peccary (Tayassu pecari) are important resources for subsistence hunters of the Peruvian Amazon (Bodmer et al. 2004a). In Peru, subsistence hunting of peccaries is legally defined as the use of peccary meat for household consumption or the sale of peccary meat in settlements of fewer than 3,000 inhabitants. Rural inhabitants hunt peccaries mainly for their meat, which have an economic value of approximately $23 for a Collared Peccary and $30 for a white-lipped peccary either as subsistence food or through local sale (Bodmer et al. 2004b). Peccary pelts are sold as a by-product and have an economic value to hunters of approximately $5 for a Collared Peccary pelt and $3 for a White-lipped Peccary pelt (Bodmer and Pezo 2001, Fang 2003). Approximately 51,419 Collared Peccary pelts and 20,522 White-lipped Peccary pelts are legally exported with CITES permits every year from Peru under a quota system imposed by the Peruvian government (INRENA 2004). The pelts are tanned in Peru and primarily sold to the European leather industry for the manufacture of high quality gloves and shoes. However, it is unclear if this trade increases the hunting pressure to meet the quotas. Furthermore, how many individuals have to be killed to obtain pelts that meet the quality standards of international trade (assuming that a given number of pelt are rejected because of scars, parasite marks i.e. bot flies, and bullet holes). In addition, considering that peccary glove can sell for as much as $285, a $5 reward for a Collared Peccary pelt does not qualify as a fare trade. On the other hand, increasing the dollar value would certainly further increase the hunting pressure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: At Welder Wildlife Refuge, Texas, feral hogs may have been involved in reducing herd and group size of peccaries (Ilse and Hellgren 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Collared Peccaries occur in a large number of national parks and other reserves throughout their extensive range in the Americas. In many of these areas populations are relatively secure, although poaching and inefficient protection are common and may nullify the nominal protection afforded by the designation of protected sites (Bodmer and Sowls 1993). Conservation measures specific to Collared Peccaries include national wildlife protection legislatures, which vary from country to country, and the inclusion in 1986 of this and other peccary species on the Appendices of CITES. The Collared Peccary was originally placed on Appendix III of CITES and in 1986 it was elevated to Appendix II (except the populations of Mexico and the United States of America, which are not included in the Appendices). Specific management regulations appertaining to hunting and movement of peccary products exist for all countries within the geographical range of P. tajacu. In the USA, for example, the species is managed as a game animal outside national parks and reserves, and may be hunted with permits under a quota system operated by state authorities. In Brazil there is a total ban on all hunting of peccaries by non-indigenous people, though this is largely unenforced in many states. Subsistence hunting is permitted in Colombia and Venezuela, but these countries prohibit the movement of peccary products, whilst in other countries, such as Peru, subsistence hunters are allowed to trade peccary products under management laws. However, in these and many Central and South American countries, rural people are often unaware of wildlife management regulations or these are flouted, sometimes quite openly, owing to the common lack of resources and trained personnel for the enforcement of protective legislation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Collared Peccaries have readily habituated urban environments, and often frequent locations where they know they will be fed. Thus, they are potential nuisances.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Collared Peccaries have for decades been a source of economic income due to their skins and as hunting trophies. They are among the most important big game species in Arizona. The young are often captured and serve as domestic farm animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: May cause considerable damage to crops. Hunted for meat and hides in much of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant Peccary

The Giant Peccary (Pecari maximus) is a possible fourth species of peccary, discovered in Brazil in 2000 by the Dutch naturalist Marc van Roosmalen. In 2003, he and German natural history filmmaker Lothar Frenz succeeded in filming a group and gathering material, which later would serve as the type. Though recently discovered by science it has been known to locals as Caitetu Munde, which means "great peccary which lives in pairs". It was formally described in 2007,[2] but the scientific evidence for its species status has later been questioned,[3][4] which also is one of the reasons for it being evaluated as data deficient by IUCN.[1]

Its assumed range encompass the south-central Amazon between the Madeira and the Tapajós Rivers. It is restricted to Terra Firme forest. Unlike other peccaries in its range, the Giant Peccary appears to mainly occur in pairs or small family groups.[2]

According to its original description, the Giant Peccary is larger, longer-legged, and proportionally smaller-headed than the only other member of the genus, the Collared Peccary (P. tajacu).[2] Compared to the sympatric populations of the Collared Peccary, the Giant Peccary also has thinner fur that is grizzled in brown and white, blacker legs and a relatively faint collar. Five skins of the Giant Peccary had a total length of 120–137 cm (47–54 in), while local hunters have estimated a weight of 40–50 kg (88–110 lb). Based on mtDNA, it has been estimated that the Collared and the Giant Peccary diverged 1-1,2 million years ago,[2] but these results have been considered questionable due to the low bootstrap support, small sample size, and the absence of nDNA and cytogenetic results.[1][4] Furthermore, it is known that there are extensive intraspecific variations (both individual and locality-based) in the morphology of the Collared Peccary.[1][4]

References

  1. ^ a b c d Gongora, J. (2008). Pecari maximus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 25 November 2008. Database entry includes a brief justification of why this species is of data deficient.
  2. ^ a b c d Roosmalen, M.G.M.; Frenz, L.; Hooft, W.F. van; Iongh, H.H. de; Leirs, H. 2007. A New Species of Living Peccary (Mammalia: Tayassuidae) from the Brazilian Amazon. Bonner zoologische Beitrage 55(2): 105–112.
  3. ^ Trials of a Primatologist. – smithsonianmag.com. Accessed March 15, 2008
  4. ^ a b c Gongora, J., Taber, A., Keuroghlian, A., Altrichter, M., Bodmer, R.E., Mayor, P., Moran, C., Damayanti, C.S., González S. (2007). Re-examining the evidence for a ‘new’ peccary species, ‘Pecari maximus’, from the Brazilian Amazon. Newsletter of the Pigs, Peccaries, and Hippos Specialist Group of the IUCN/SSC. 7(2): 19–26.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Collared peccary

The collared peccary (Pecari tajacu) is a species of mammal in the family Tayassuidae that is found in North, Central, and South America. They are commonly referred to as javelina, saíno or báquiro, although these terms are also used to describe other species in the family. The species is also known as the musk hog and Mexican hog. In Trinidad, it is colloquially known as quenk.

Although somewhat related to the pigs and frequently referred to as one, this species and the other peccaries are no longer classified in the pig family, Suidae.

Dentition, as illustrated in Knight's Sketches in Natural History

Contents

Description

Size

The collared peccary stands around 0.5 meters (20-24 inches) tall at the shoulder and it is about 1-1.5 meters (40-60 inches) long. It weighs between 16 and 27 kilograms (35 and 60 lbs).[2]

Range and habitat

The collared peccary is a widespread creature that can be found throughout much of the tropical and subtropical Americas, ranging from the Southwestern United States to northern Argentina in South America. The only Caribbean island it is native to, however, is Trinidad, although introduced populations exist in Cuba. It inhabits deserts and xeric shrublands, tropical and subtropical grasslands, savannas, and shrublands, flooded grasslands and savannas, tropical and subtropical dry broadleaf forests, and several other habitats, as well. In addition, it is well adapted to habitats shared by humans, merely requiring sufficient cover; they can be found in cities and agricultural land throughout their range, where they will add human garden plants to their menu. Notable populations are known to exist in the suburbs of Phoenix and Tucson, Arizona.[3][4]

Diet

Collared peccaries normally feed on fruits, roots, tubers, palm nuts, grasses, invertebrates and small vertebrates. In areas inhabited by humans, they will also consume cultivated crops and ornamental plants, such as tulip bulbs.[3][4]

Behavior

Collared peccaries are diurnal creatures that live in groups of one to 20 individuals, averaging between six and 9 members. They frequently sleep at night in burrows, often under the roots of trees.

Although they usually ignore humans, they will react if they feel threatened. They defend themselves with their long tusks, which can sharpen themselves whenever their mouths open or close. A collared peccary will also release a strong musk if it is alarmed.

References

  1. ^ Gongora, J., Reyna-Hurtado, R., Beck, H., Taber, A., Altrichter, M. & Keuroghlian, A. (2011). "Pecari tajacu". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41777. Retrieved 18 January 2012.  Database entry includes a brief justification of why this species is of least concern.
  2. ^ "Collared Peccary: Javelina ~ Tayaussa ~ Musk Hog". Digital West Media Inc.. http://www.desertusa.com/magnov97/nov_pap/du_collpecc.html. Retrieved 8 January 2012. 
  3. ^ a b Friederici, Peter (August/September 1998). "Winners and Losers". National Wildlife Magazine (National Wildlife Federation) 36 (5). http://www.nationalwildlife.org/nationalwildlife/article.cfm?articleID=308&issueID=19. 
  4. ^ a b Sowls, Lyle K. (1997). Javelinas and Other Peccaries: Their Biology, Management, and Use (2 ed.). Texas A&M University Press. pp. 61–68. ISBN 978-0-89096-717-1. http://books.google.com/?id=g3-kkgAxxnoC. 

Links

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in family Dicotylidae by Jones et al. (1992), in Tayassuidae by Grubb (in Wilson and Reeder 2005).

Appropriate generic name has been debated. Placed in genus Dicotyles by some authors, genus Pecari by Grubb (in Wilson and Reeder 1993, 2005), and genus Tayassu by Jones et al. (1992). MtDNA data support the recognition of three genera of extant peccaries: Catagonus, Pecari, and Tayassu, with this species in the genus Pecari (Theimer and Keim 1998).

In Arizona, Theimer and Keim (1994) found three mtDNA haplotypes, the frequencies of which varied significantly across geographic regions, probably related to founding events.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!