Overview

Brief Summary

Biology

Banteng are social creatures, spending most of their time in herds of two to 40 animals (2), which are usually led by an older cow and accompanied by a single mature male (3). Other males live alone or in bachelor groups (2). While this species may be active during the day or night, the herds have adopted a nocturnal lifestyle in areas of heavy human encroachment (3). Banteng feed mainly on grasses, bamboo, leaves, fruits and young branches of woody shrubs, depending upon the season and availability (2). The single male of the herd reproduces with all the females, and competition for dominance of a herd is therefore fierce (6). Although capable of breeding all year round in captivity, wild banteng in Thailand are known to mate only during the months of May and June (2). Single offspring are born after a gestation period of 285 days. Weaning occurs at six to nine months, and sexual maturity is reached at two to three years. Banteng have been recorded to live up to 20 years in the wild and to over 26 years in captivity (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The handsome banteng largely resembles domestic cattle both in size and colour (3), but also demonstrates considerable sexual dimorphism, allowing the sexes to be readily distinguished (4). Mature males have a dark, chestnut-brown coat, more blue-black in the Javan and Bornean individuals, while females and juveniles are reddish brown, with a dark dorsal stripe (2) (4) (5). The horns of females are short, tightly curved and point inward at the tips, whereas those of males are long, upwardly arching and connected by a horn-like bald patch on the forehead. Both sexes have the characteristic white 'stockings' on their lower legs, a white rump and muzzle, and white spots above the eyes (2). A gentle hump exists above the shoulders (6), and a slight ridge runs along the back (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species historically occurred from southern China (Yunnan) throughout mainland Southeast Asia, through Peninsular Malaysia to the islands of Borneo, Java, and probably Bali (see below).

No fossil evidence is known from Bali, and Grubb (2005) stated that Banteng was introduced to the island; Corbet and Hill (1992) did not include Bali in the range of wild Banteng and various other sources simply state that it occurs as domestic animals. Nevertheless, it does not seem unreasonable to suggest that Banteng should be included among the native fauna of Bali since several Indo-Malayan animal species are known to have penetrated eastwards as far as Flores and Timor during times of lowered sea-levels in the Pleistocene (Hooijer 1975). Ashby and Santiapillai (1988) treated the small number of free-living Bantengs which in occur in west Bali as wild animals as did Watling (1991); although Watling noted that interbreeding with domestic Bali cattle is a problem and the population is unlikely to consist solely of pure-bred animals. Wind and Amir (1977) had earlier raised similar fears.

Domestic Banteng has been introduced to several of the islands of eastern Indonesia including Sulawesi, Sumbawa, and Sumba (Van der Maarel 1932; Rollinson 1984). Feral Banteng occur in Kalimantan (National Research Council 1983). Introduced Banteng (probably feral animals) occurs on the Indonesian islands of Enggano (off Sumatra) and Sangihe (off Sulawesi) (Corbet and Hill 1992; Grubb 2005). Domestic Banteng has also been introduced to New Guinea and Australia and there are now large feral herds in the Northern Territory (Kirby 1979; Bowman 1993; Bradshaw et al. 2006).

Wild Banteng currently occurs on Java and possibly Bali, in Kalimantan [Indonesian Borneo], Sabah [part of Malaysian Borneo], Myanmar, Thailand, Lao PDR, Viet Nam, and Cambodia. A few may remain in Sarawak [Malaysian Borneo] (D. Labang, cited in Caldecott 1988) but it is thought to be extinct in Brunei (Payne et al. 1985). Banteng is extinct in Bangladesh (Gittins and Akonda 1982; Md Anwarul Islam in litt. 2008), and in India (Prater 1971; IUCN 1978), if it ever occurred there: Groves (2003) stated that “there have been constant reports from Manipur, but there is as yet no confirmation”. In West Malaysia it has probably been extinct since at least the 1950s (Hislop 1961). Medway (1983) thought that Banteng may have still occurred in parts of Kedah and Kelantan after that time, but there have been no recent records. In China, Banteng has been reported to occur in one area of southeast Yunnan around Tongbiguan Nature Reserve, along the border with Myanmar; however, the source for this is unclear; and presence in China should be considered tentative at best.

In Cambodia the species is still likely to be widespread in the northern and eastern forests and as well as parts of the Cardamoms Mountain range, with the bulk of the population remaining in the eastern forests, centred on Mondulkiri Province (see Population). On Borneo, the species occurs in parts of eastern Sabah (Malaysia), including Tabin Wildlife Reserve, and in Kalimantan (Indonesia), it occurs along the border with Sarawak (Malaysia), as well as in the south central region and two isolates in the eastern parts of the province (in and around Kutai National Park and Hutan Kapur Sangkulirang Nature Reserve). Distribution is other countries is detailed under Population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Banteng inhabit various areas in Southeast Asia. Believed to have first been domesticated on Java, they are also now found in Bali, Burma, Borneo, Thailand, and Malaysia (D'Alton 1823, Nowak 1999).

Biogeographic Regions: oriental (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Southeast Asia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The South and Southeast Asian distribution includes the countries of Cambodia, Indonesia (Kalimantan; Java; Bali), Lao People's Democratic Republic, Malaysia, Myanmar, Thailand and Viet Nam (1). Until recently, it also included Bangladesh, Brunei Darussalam, India and Peninsular Malaysia (1). There is also a fairly large introduced population of banteng in Northern Australia, which are currently thought to number up to 400 animals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male and female banteng are easily distinguishable. Both sexes carry the characteristic white stockings and white rump, as well as white muzzle and white spots above the eyes. Females are brown to reddish brown with a dark dorsal stripe. Their short crescent-shaped horns point inward at the tips and their appearance is trim and distinctly cattle-like. Males are blackish brown to blue-black with the horns being more angular and turning out and then up, with the tips turning inward. Horns in males grow to 60 to 75 cm in length and are connected at the base by a horn-like patch on the forehead. Both sexes have a slight hump on their back above the shoulders.

Banteng range from 190 to 225 cm in total body length and average 160 cm in height at the shoulder. Their tail measures 65 to 70 cm and they weigh between 600 and 800 kg (D'Alton 1823, Nowak 1999).

Range mass: 600 to 800 kg.

Range length: 190 to 225 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Wharton (1968) summarized information about Banteng habitat from throughout its range and he concluded that on the Asian mainland it avoids evergreen rainforest and is usually within more open dry deciduous forests; but within the more humid areas of Java and Borneo it occupies secondary forest formations resulting from logging and fires, and enters tracts of sub-humid forest on occasion. However, on mainland Southeast Asia, human use of these preferred areas has increased, may have forced surviving Banteng to retreat to relatively closed formations where consequently they now overlap more with Gaur Bos gaurus; although good evidence for such an assertion is lacking. In Myanmar, Banteng is reported to prefer flat or undulating terrain with light deciduous (particularly indaing forest) or mixed deciduous and evergreen forest, with grassy glades which burn annually, and patches of bamboo; but it has retreated to denser hill forest in the face of advancing cultivation (Peacock 1933; Wharton 1968; Tun Yin 1967; Prater 1971). Similarly in Thailand, Cambodia, Viet Nam, and Lao PDR Banteng occur(red) in open mainly deciduous forest with glades, parklands, and dense forest patches; and ‘it is claimed by some that they prefer rocky, slightly hilly country, but they are certainly at home wherever the Kouprey [Bos sauveli] is found. Their range in Cambodia [and elsewhere in South-east Asia] suggests that Banting [sic] are more adaptable than Kouprey and perhaps less exacting in their habitat requirements’ (Wharton 1957: 46; Wharton 1968). Recently the attachment to open, more deciduous forest types was reported in Xe Pian National Protected Area, Lao PDR (Steinmetz 2004). In Borneo Banteng is ‘locally common in logged forest on flatland...[and occur] in dipterocarp, swamp and beach forests’ particularly along river courses (Payne et al. 1985). In Java Banteng occurs in semi-deciduous monsoon forest with small clearings, more open grassland-monsoon forest mosaics, and ‘parkland’ formations (Halder 1976; Hommel 1987; S. Hedges pers. comm., based on unpubl. data 1991–2002).

Banteng generally occurs from sea level up to at least 2,100 m asl (Hoogerwerf 1970; National Research Council 1983; Pudyatmoko 2004; S. Hedges pers. comm. 2008 base on unpubl. data 1991–2002).

Banteng reportedly drinks large quantities of water and prefers feeding grounds near a permanent water supply (Hoogerwerf 1970). When conditions are favourable it drinks daily, preferring standing water; but during droughts animals can survive several days without drinking (National Research Council 1983). Mineral licks are also an important feature of Banteng habitat; in coastal regions which lack mineral licks animals seem to meet their mineral requirements by occasionally drinking seawater (Halder 1976; Payne et al. 1985; Alikodra 1987; S. Hedges pers. obs.).

Although probably a grazer by preference Banteng should perhaps be considered an intermediate feeder since it can and does consume a lot of browse and fruits depending on season and local food availability. It eats grasses, sedges, herbs, bamboo, as well as the leaves, fruits, flowers, bark, and young branches of woody shrubs and trees including palms. The young shoots of alang-alang grass (Imperata cylindrical) are apparently a favoured food source (Hoogerwerf 1970). Lists of food plants are provided by Wharton (1957), Hoogerwerf (1970), Halder (1976), Sumardja and Kartawinata (1977), Djaja et al. (1982), Alikodra (1983), Prayurasiddhi and Smith (1993), and Hedges (in prep.). However, very little is known about the Banteng’s nutritional requirements, seasonal and annual variation in their dietary preferences, or the composition and quality of their diet. Hoogerwerf was of the opinion that Banteng were largely dependent on grasses and sedges and, with reference to Ujung Kulon in West Java, he stated that ‘there were no proofs that browse formed a substantial part of the diet.’ However, Schenkel and Schenkel-Hulliger (1969) reported that Banteng and deer in Ujung Kulon are forced to travel widely in the dry season and ‘feed on bamboo, young palm leaves, bush, and saplings as well.’ And the stomachs of a number of bulls which were shot in the South Tjiandur region of Java were almost completely full of non-graminaceous species. In Pananjung-Pangandaran Reserve in West Java Banteng were observed to graze on a variety of plants but appeared to prefer the grasses Ischaemum muticum, Axonopus compressus, Paspalum conjugatum, and Cynodon dactylon; and a woody forest shrub ,i>Psychotria malayana. Grazing intensity was lower in the forest than in the open fields where it was inversely proportional to the amount of Eupatorium odoratum and Imperata cylindrical although they did eat these species (Sumardja and Kartawinata 1977).

When undisturbed, Banteng displays a more or less fixed diurnal pattern of behaviour with periods (usually two to three hours long) of feeding alternating with rest periods of a similar length during which the animals ruminate. In areas which are subject to frequent human disturbance it becomes rather nocturnal and generally enters open areas only at night, although in especially attractive localities it will tolerate human presence to a certain extent (Halder 1976). In undisturbed areas Bantengs ‘do not differentiate much in their activities between day and night, but...really large assemblages on open plains occur almost exclusively by day...This round the clock activity (which is, however, interrupted countless times to rest and/or ruminate) may not be regarded as abnormal’ (Hoogerwerf 1970: 211-212).

The basic social group appears to be female–juvenile unit (as in the other large Asian Bovini) with larger groups tending to be more-or-less temporary assemblages. Maternal herds containing several adult cows, juveniles, and calves occur; these groups can often contain one or more subadult and adult males. Groups of cows without calves are also seen. For much of the year (adult) Bantengs are largely sexually segregated and all-male groups are frequently encountered at this time. Solitary animals tend to be mature bulls or sometimes old cows. The composition of small groups of cows with calves or juveniles, and the solitary state of old individuals may remain the same for months or even years. The composition of other small groups, particularly the unisex groups, usually varies from day to day. During the mating season the male groups disband and dominant males compete for access to receptive females (Hoogerwerf 1970; Halder 1976; S. Hedges unpubl. data 1991-2002).

In open areas large herds of more than 100 animals have been reported but these herds appear to be temporary associations formed when smaller groups and solitary animals arrive in an area to feed and the animals tend to reform into smaller groups when they leave the feeding areas. The composition of these groups often varies on a daily basis although there may be a stable nucleus of animals which returns to the same clearing day after day. The large herds may have an established dominance hierarchy but it seems to vary depending on the habitat. In more densely vegetated areas solitary animals or small groups, generally with fewer than eight animals, are more typical (Halder 1973, 1976; S. Hedges unpubl. data 1991–2002).

In Thailand the mating season is in May and June (Lekagul and McNeely 1977); while breeding reportedly occurs the whole year round in Myanmar (Peacock 1933). Wharton (1957) collected information from Cambodians living within Banteng habitat which suggested that the majority of births occurred in December and January which, assuming a gestation period of about 10 months, suggests that most conceptions take place in March and April. However, Hermanns (cited in Hoogerwerf 1970) was of the opinion that Banteng in mainland Asia mate from September to October. Hoogerwerf (1970) recorded mating taking place all year round in West Java but there was a peak of activity in October; and he thought that those cows which mated outside the peak period were probably exceptional. He was of the opinion that Bantengs in both East and West Java generally calved in July and August which would suggest that mating generally took place from October to December; more recent observations in East Java have also revealed evidence of year-round matings (neonates have been seen in all months) but with an apparent peak of births between June and September (S. Hedges unpubl. data 1991–2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Banteng appear to prefer more open and drier regions near dense thickets, and rely less on the presence of water than the closely related Bos gaurus (gaur). During the monsoon season, banteng herds tend to migrate to higher areas, ocuppying dense forests and bamboo jungles (Nowak 1999).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

On the Asian mainland, banteng prefer open, dry, deciduous forests (1), although individuals in Myanmar inhabit mixed deciduous and evergreen forest (4). Feeding in open clearings, banteng depend on dense thickets in which to retire for shelter and safety (2). During the monsoon seasons, banteng tend to migrate to higher areas, where they occupy dense forests and bamboo jungles (6). Within the more humid areas of Java and Borneo they occupy secondary forest that has formed after logging and fires, and they also occur in a tract of sub-humid forest (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

During the dry season, banteng herds move to dry valleys where their primary diet is grass. When the monsoon season arrives, the herds move to the forest highlands and bamboo jungles where their diet consists of herbaceous plants, such as bamboo (Nowak 1999).

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Banteng are important members of the ecosystems in which they live. They are important in nutrient cycling and influence the composition of plant communities through their grazing and browsing activities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are the major predators of banteng. They use the animals for food, clothing, and commercial trade (Nowak 1999). In historic times banteng may also have been preyed upon by tigers, though most subspecies of tiger that occur throughout the range of banteng are currently extinct or severely endangered. Dhole may prey on young, elderly, or ill individuals.

Their large size makes them invulnerable to many predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Bos javanicus is prey of:
Homo sapiens
Panthera tigris
Cuon alpinus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Wild banteng have been known to live for up to twenty years, while the oldest one in captivity was still living at twenty-six years and seven months (D'Alton 1823, Jones 1993, Nowak 1999).

Range lifespan

Status: captivity:
20 to 26 years.

Typical lifespan

Status: wild:
16 to 20 years.

Average lifespan

Status: captivity:
27.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.1 years (captivity) Observations: In captivity, these animals may live up to 27.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is generally only one adult male in each banteng herd. That male reproduces with all adult females in the herd. Males compete for dominance of a herd and are probably not able to maintain a herd unless they are in prime condition and fully adult.

Mating System: polygynous

Banteng are capable of breeding year round while in captivity. Wild banteng limit their breeding to the months of May and June. Gestation period lasts 285 days, after which they give birth to a single young. A young banteng can nurse anywhere from six to nine months and will not reach full maturity until two or three years old (D'Alton 1823, Nowak 1999).

Breeding season: Mating occurs in May and June, births typically occur in March and April.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Average gestation period: 9.5 months.

Range weaning age: 6 to 9 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average gestation period: 295 days.

Average number of offspring: 1.

Females care for and nurse their young for 6 to 9 months after their birth. Young are capable of standing and walking shortly after birth.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bos javanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2552-09|NC_012706|Bos javanicus| AACCGCTGACTATTCTCAACCAACCATAAAGATATTGGTACCCTTTATCTACTATTTGGTGCTTGGGCCGGTATAGTAGGAACAGCTCTA---AGCCTTCTAATTCGCGCTGAATTAGGCCAACCCGGAACTCTGCTCGGAGAC---GACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGATTCGGTAACTGACTTGTTCCCCTAATA---ATTGGTGCTCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCATTCCTACTACTCCTCGCATCCTCTATAGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTGTACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCTTCAGTAGATCTA---ACCATTTTCTCTTTACACTTAGCAGGAGTTTCCTCAATTTTAGGAGCCATCAACTTCATTACAACAATTATCAACATAAAGCCCCCCGCAATGTCACAATACCAAACCCCTCTGTTCGTATGATCCGTAATAATTACCGCCGTACTACTACTACTCTCGCTCCCTGTATTAGCAGCC---GGCATCACAATGCTATTAACAGACCGGAACCTAAATACAACCTTCTTCGACCCGGCAGGAGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTCTTTGGACACCCCGAAGTCTATATTTTAATCTTACCTGGGTTTGGAATAATCTCTCATATCGTGACCTACTACTCAGGAAAAAAA---GAACCATTCGGATATATGGGAATAGTTTGGGCTATAATGTCAATCGGATTTCTAGGTTTCATCGTATGAGCCCACCATATATTCACTGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bos javanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Duckworth, J.W., Hedges, S., Steinmetz, R. & Pattanavibool, A.

Reviewer/s
Burton, J. & Hedges, S. (Asian Wild Cattle Red List Authority)

Justification
Banteng is considered Endangered under Criteria A2cd+3cd+4cd. Recent declines in parts of the species' range (especially Indochina) exceed 80% in three generations (generation-length estimated at 8–10 years), whereas in others—particularly Java which is, or was, the species' stronghold—it is not as severe. An overall decline of at least 50% appears likely based on direct observations, the decline in extent of occurrence, and continuing high levels of illegal trade in Banteng parts (mainly horns). Similar reductions are projected, largely because of the unrestrained bushmeat trade in Southeast Asia and of hunting for the trade in horns, as well as habitat loss and degradation on Java. The global population is not known, but best-guesses suggest the species could be close to qualifying for EN through C1 and C2a(i).

History
  • 2000
    Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Banteng are classified as an endangered species by the IUCN (1996), and the U.S. Department of the Interior. This is due to the destruction of habitat, hunting, commercial trade, disease transmission from domestic cattle (Bos taurus), and contamination of the gene pool caused by hybridization with domestic cattle. Banteng and domestic cattle matings result in fertile offspring (Nowak 1999).

Wild populations of banteng remain only in isolated areas of Borneo and Java. Total populations are estimated at less than 5,000 to 8,000 individuals, with no populations numbering more than 500 animals. Banteng have been extirpated in India, Bangladesh, and western Malaysia. Asian mainland populations have declined by 80% in the last 20 years.

There is almost no legal trade in banteng but illegal trade in banteng horns is widespread. There are no population monitoring systems in place.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Bos javanicus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN A1cd+2cd, C1+2a) on the IUCN Red List 2004 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The world population of Banteng is unlikely to be more than 8,000 and is quite possibly fewer than 5,000 animals. No subpopulations of more than 500, and only 6–8 subpopulations of more than 50 animals, are known, with 4–5 on Java and 1–2 in Thailand (S. Hedges pers. comm. 2000; Pudyatmoko 2004). A once fairly widely distributed species, it is now largely reduced to small isolated populations, most of which are still in decline.

In Cambodia, Banteng probably declined by 90% or more between the late 1960s and the early 1990s. At this latter time they still remained widespread, although in generally low numbers, in the lowland forests of the north and east, and also, probably somewhat more sporadically, in the south and west including the Cardamom Mountain range (Daltry and Momberg 2000; Heng Kimchhay et al. 1998; Timmins and Ou 2001; R. J. Timmins pers. comm. 2008). From at least this time onwards the most substantial Banteng population has been centred on Mondulkiri Province where in the late 1990s at least several hundred to a perhaps over a thousand Banteng survived in a forested landscape of over 15,000 km² (Timmins and Ou 2001; Tordoff et al. 2005; R. J. Timmins pers. comm. 2008). Further declines took place from the early 1990s to the present, with quite probably more than a 50% decline in this time period, and the resultant loss of Banteng populations from significant parts of the still forested landscape (Timmins and Ou 2001; Timmins et al. 2003; Timmins 2006; Bezuijen et al. in prep.; R. J. Timmins pers. comm. 2008). As of 2007 the most significant population by far in Cambodia remained that in Mondulkiri Province, still thought to be hundreds of animals (WCS unpublished data; WWF unpublished data; R. J. Timmins pers. comm. 2008). Protection efforts in parts of this landscape have probably stabilised declines locally, although for the area as a whole the trend is still likely to be a significant decrease (WCS unpublished data; WWF unpublished data; T. Clements pers. comm. 2007; T.D. Evans pers. comm. 2007; R. J. Timmins pers. comm. 2008).

The Banteng’s other present-day stronghold is Java, where six large subpopulations (those with more than 50 animals) occurred in 1990, but these declined to only 4–5 by 2004 (Pudyatmoko 2004). Pudyatmoko (2004) estimated: Ujung Kulon National Park (300–800 individuals in 2003), Cikepuh-Cibanteng Nature Reserve (25–65 individuals in 2003), Bonjonglarang-Jayanti Region (a small stable population of unknown size in 1988, with no recent data available), Cimapag Region (occurrence recorded until 1970, with current status unknown), Leuweng Sancang Nature Reserve (10 individuals in 2000, extinct in 2003), Cikamurang Region (occurrence recorded until 1970, with current status unknown), Pangandaran Nature Reserve (25–65 individuals in 2003), Kediri Region (occurrence recorded until 1970, with current status unknown), Coast of Blitar (10 individuals in 1988, with current status unknown), Coast of Malang (6 individuals in 1988, with current status unknown), Meru Betiri National Park (200 individuals in 2000, with at least 57 individuals in 2002), Alas Purwo National Park (with at least 80 individuals in 2002), and Baluran National Park (around 206 individuals in 2002). Number in all areas are declining (Hedges and Tyson 1996; S. Hedges unpub. data. 1991–2002; Pudyatmoko 2004).

Population numbers and even trends are difficult to quantify for Borneo but there have been declines, especially in Kalimantan (S. Pudyatmoko pers. comm. 2006; G. Semiadi pers. comm. 2006), and in Sabah (Han pers. comm.). The Bornean population is thought to have been particularly negatively affected by interbreeding with domestic and/or feral oxen of types other than pure-bred ‘Bali cattle’. Banteng occurs in Kutai National Park and Hutan Kapur Sangkulirang Nature Reserve, Kalimantan (Indonesia). A small population was reported from Belantikan Hulu in Central Kalimantan in November 2007 (tracks found) and April 2008 (local reports of capture of cow and calf); the population is believed to be small (Togu Simorangkir, Chair of Yayorin pers. comm. 2008). Populations in Sabah are now confined in protected areas scattered mostly in the east coast of the state. Current reports include the Tabin Wildlife Reserve, Kulamba Wildlife Reserve, Danum Valley Conservation, Ulu Kalumpang Forest Reserve, Ulu Segama-Malua Forest Reserve, Kinabatangan Wildlife Sanctuary, and Deramakot Forest Reserve. Over 100 individuals live in Kulamba Wildlife Reserve, and the state-wide gross estimation of the population size is 300–500 individuals. However, this is only based on presence–non-detection surveys and the figure should be regarded as a crude approximation (Ahmad AH pers. comm. 2008). The biggest decline happened during the intensive and extensive timber operation and transformation of lowland forests large-scale plantations (palm oil, cocoa and other crops) late in the twentieth century (Ahmad AH pers. comm. 2008). The declines are over 50% in Sabah and Borneo as a whole (Belden Giman pers. comm.).
In Thailand, the only subpopulations with more than 50 animals are Huai Kha Khaeng Wildlife Sanctuary and perhaps Kaeng Krachan National Park; smaller numbers do or may persist in Mae Ping National Park, Phu Luang Wildlife Sanctuary, Thap Lan National Park, Khwo Ang Ru Nai Wildlife Sanctuary, Khao Soi Dao Wildlife Sanctuary, and Khao Sok National Park. Banteng range probably declined by approximately 85% in Thailand from 1980 to 2000 (S. Hedges pers. comm. 2000). The Banteng population in Huai Kha Khaeng Wildlife Sanctuary is reported to have increased over the past 10 years (per R. Steinmetz pers. comm. 2008).
Numbers in Lao PDR are now likely to be very low, with probably no area supporting more than 50 animals (Duckworth and Hedges 1998; Duckworth et al. 1999; R. J. Timmins pers. comm. 2008). Evidence of Banteng was found for a number of areas in the 1990s (Duckworth and Hedges 1998; Duckworth et al. 1999; Steinmetz 2004), but there has been very little survey effort since 1998. Confirmation of presence after the mid-1990s, when populations were in steep decline (Duckworth and Hedges 1998), is lacking. Most areas have received little if any protection: so it is quite likely that Banteng has been hunted out from several, perhaps most, conceivably all, of them (R.J. Timmins pers. comm. 2008). The most likely areas for continued presence are in the southern half of the country. A similar scenario is likely in Viet Nam, with little recent evidence of continued presence in most areas (M. Pedrono pers. comm. 2008), and perhaps only one region (the Yok Don National Park area along the Cambodian border) has a population that might exceed 50 animals; current presence is also possible elsewhere in the western border areas from Kontum Province to Dak Lak Province and in Krong Trai Nature Reserve, Rung Kho Phan Rang Nature Reserve, and Cat Tien National Park (Duckworth and Hedges 1998; Eames et al. 2004; Tordoff et al. 2005; M. Pedrono pers. comm. 2008; R. J. Timmins pers. comm. 2008). Little recent information has been traced from Myanmar: a national camera-trapping survey aimed at Tiger Panthera tigris, which will not necessarily have covered all, or even the best, areas for Banteng, recorded it in and around Alaungdaw Kathapa National Park, Mahamyaing Reserve Forest, and the central Bago (= Pegu) Yoma (Lynam 2003). Current numbers are unknown but are sure to be declining, given general trends in ungulates in better-studied parts of the country. There are no quantitative data available on remaining populations in China (Smith and Xie Yan 2008), but these are clearly small.

A domesticated form of Banteng, often called ‘Bali cattle’, and considered to be the same species (contrasting with general taxonomic treatment for several other oxen) occurs widely in Indonesia and has been introduced to other areas of the world. However, few if any populations of this form are now likely to be pure-bred, due to interbreeding with domestic oxen derived from other Bos species (Bradshaw et al. 2006). One population of approximately 6000 animals, which appears now to be superficially indistinguishable from wild Banteng, thrives in Garig Gunak Barlu National Park, on the Cobourg Peninsula in Northern Territory, Australia. These animals derive from approximately 20 domesticated ‘Banteng’ taken from Denpasar, Bali in 1849, and they have recently been shown to be genetically identical to wild Banteng, at least to the extent of the molecular sequences analysed. This suggests that they have not been cross-bred previously to any significant extent with other domestic cattle (Bradshaw et al. 2006). Some domestic oxen lineages in mainland Southeast Asia, for instance in Cambodia, may have at least partial Banteng ancestry (e.g. Timmins and Ou 2001).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threats to Banteng are hunting and habitat loss (Duckworth and Hedges 1998; Pudyatmoko 2004; Steinmetz 2004; S. Hedges unpub. data 1991–2002). In Sabah habitat loss to permanent agriculture is a serious threat, although hunting is equally significant and the species has been rapidly exterminated from many areas there (Payne et al. 1985; Ahmad AH pers. comm. 2008). Habitat loss has also been serious in Java since 1998. Elsewhere, hunting is the most widespread and significant threat, and is exacerbated especially in mainland Southeast Asia by human repopulation of lowland forest areas and associated habitat fragmentation, that is, the very areas where most Bantengs occur (Duckworth and Hedges 1998; Timmins and Ou 2001; R.J. Timmins pers. comm. 2008). Although huge tracts of suitable habitat were lost in the twentieth century, and continue to be converted, this has probably largely occurred after Banteng have been hunted out (R.J. Timmins pers. comm. 2008). Thus, the hunting is the proximate cause of decline, but habitat loss is continually reducing the maximum population possible if hunting issues were to be controlled.

The magnitude of the threat posed to Banteng by international trade in trophy horns is difficult to quantify. Nevertheless, given the small size of the remaining Banteng population and the number of trophies found for sale in Cambodia, the Lao PDR, Thailand, and Viet Nam, during what were essentially opportunistic surveys, it is clearly a major threat on the Asian mainland (Srikosamatara et al. 1992; Baird 1993; Srikosamatara and Suteethorn 1994, 1995; Martin and Phipps 1996; Srifa La-Ong et al. 1997; Duckworth et al. 1999; Timmins and Ou 2001). The threat posed by use of traditional medicinal substances derived from wild oxen is even harder to determine in the case of Banteng and essentially remains unknown, although it is thought to be a source of significant threat to Gaur (see 2008 Red List account).

The most important population in Cambodia is scattered through a forest landscape that encompasses four provinces (Mondulkiri, Kratie, Stung Treng and Ratanakiri) and five conservation areas (Lomphat Wildlife Sanctuary, Phnom Prich Wildlife Sanctuary, Siema Biodiversity Conservation Area, Mondulkiri Protection Forest (including the Srepok Wilderness Area) and Phnom Nam Lyr Wildlife Sanctuary) (Timmins and Ou 2001; Tordoff et al. 2005; R. J. Timmins pers. comm. 2008). Hunting is still rife in much of this area, and forest fragmentation is rapidly accelerating with human population in-migration, infrastructural developments (especially roads), commercial agricultural expansion, economic land speculation and mineral extraction (R. J. Timmins pers. comm. 2008). However, although perhaps less than 20% of this area is well protected from the aforementioned threats and protected area management is only close to effective in two areas, the most significant issue concerning the area is the long-term uncertainty of continuation of effective conservation management of the Srepok Wilderness Area and Siema Biodiversity Conservation Area. Although conservation efforts for Banteng and many other species have been, in both areas, extremely encouraging for the last few years, both areas face an uncertain future with the possibility of de-gazettment of conservation status of parts of them, the possible loss of adequate external funding necessary to maintain high standards of management, the possible loss of political support necessary to uphold high protection standards and the uncertainties of maintaining a motivated and well-trained staff.

On Java some populations are potentially threatened by heavy predation from Dholes Cuon alphinus (Hedges and Tyson 1996; Pudyatmoko 2004). All populations are also threatened by poaching and some, perhaps most, are threatened by habitat loss and degradation (S. Hedges unpub. data 1991–2002). During the 1980s–1990s, when poaching and land conversion were relatively well under control in Javan national parks, the chief threat to the large population of Banteng in Baluran National Park was loss of grazing area to invasion by the introduced tree Acacia nilotica (Leguminosae) that converts open grassland to dense thorny scrub-forest. This plant was introduced (without adequate risk assessment) as part of an attempt to create a living fire-break around the park's grasslands, wild fire then being adjudged the major threat to the park’s monsoon forests. Since that introduction, repeated cutting of the acacia has led to coppicing into very dense thickets that contain little or no grass or other herbs and are difficult for the cattle to penetrate. Thus habitat loss and poaching are now serious limiting factors in Baluran National Park, and habitat loss/degradation remains a severe long-term threat to be addressed (S. Hedges pers. comm. 2008). Lantana camara (Verbenaceae) is also a problem in Banteng habitat in Baluran National Park and elsewhere on Java (S. Hedges pers. comm. 2008).

Bali cattle have long been interbred with other cattle: Banteng and Bali cattle can interbreed with both common cattle and mithan (Bos frontalis) (Fischer 1980; National Research Council 1983). Hybrids between Banteng and common cattle (Bos Taurus) of the zebu type are fully fertile; in hybrids between Banteng and Bos Taurus of the European type the males are sterile (Jellinek et al. 1980; National Research Council 1983). Domestic and feral livestock are thus a potential threat to the genetic integrity of wild Banteng populations and a number of reports suggest that wild Banteng does interbreed with domestic cattle. For example, Hoogerwerf (1970) referred to several sources from the 1930s and 1940s which mention that many groups of Banteng in Kalimantan (particularly East Kalimantan) were no longer pure-bred having interbred with stray domestic cattle. Wharton (1957) also found evidence of interbreeding with domestic cattle in Cambodia; and reports from Myanmar mention that Banteng feed alongside village cattle and occasionally interbreed with them (Tun Yin 1967; Salter 1983). In addition to the genetic threat, domestic livestock are a potential source of diseases and parasites. This can have very serious consequences for Banteng which appear to be particularly susceptible to a number of cattle diseases; for example, Banteng populations in Myanmar have been very badly affected by diseases from domestic cattle (Hundley cited in Wharton 1968).

Introgression with domestic cattle is not presently an issue in Sabah; there have been imports of Bali cattle mostly by large cattle farms who house animals in feedlots away from wild populations. Ahmad AH (pers. comm. 2008) is unaware of any instances of deliberate introduction of Bali cattle or other domestic oxen into forest areas, or of any plantation holders that have deliberately introduced their cattle into the range of wild Banteng. Although integration of livestock into oil palm plantation has been discussed for many years, this has not yet been put into practice (Ahmad AH pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The most significant threats facing banteng are hunting and habitat degradation and loss (1). Extinction is thought imminent in Vietnam and, in Cambodia and Lao PDR, habitat fragmentation caused by agriculture and new settlements is seriously threatening the remaining mainland Asian populations (3). These wild cattle have been domesticated in numerous locations, most notably on the island of Bali, with over 1.5 million domestic banteng thought to exist (2). Interbreeding with domestic and feral cattle threatens to contaminate the gene pool by hybridization of the remaining wild banteng, and disease transmission from domestic livestock is also considered a serious danger (1) (6). The number of banteng trophies reported for sale within Cambodia and the Lao PDR, along the Thai/Cambodia, Thai/Lao, and Thai/Myanmar borders, strongly suggests that the banteng population on the mainland has been, and remains, under considerable pressure from hunters (2) (3). Despite legal prohibitions against trade in banteng, law enforcement is inadequate, and poaching and illegal trade in their meat and horns remains widespread (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is legally protected in all range states. The species is not listed on CITES, although a proposal was submitted to include it on Appendix 1 (Hedges 1996).

The most significant known Banteng populations remaining in Southeast Asia are in Java, Cambodia and perhaps Thailand and Borneo, and it is in these countries and around these populations that conservation efforts should be focused.

Banteng is mainly confined to protected areas throughout Southeast Asia (see Population), with the probable exception of Cambodia (and the situation in Myanmar is unknown), where significant number may still occur outside them (J.W. Duckworth and Than Zaw pers. comm. 2006; R.J. Timmins pers. comm. 2008). Presence in Lao protected areas is currently uncertain but there are at least 10 large forested protected areas in the south which may still support the species as well as three to four areas in the north, but any populations are certainly not large. In Viet Nam, the species probably now occurs in only a few protected areas (see Population).

In Cambodia, most of the large forested protected areas, of which there are more than 15, are likely to retain at least residual Banteng populations. Unfortunately, in most protected areas of Lao PDR, Viet Nam and Cambodia which still retain Banteng, protected status offers little if any protection to the species (R. J. Timmins pers. comm. 2008). Exceptions are Cat Tien National Park in Viet Nam (although Banteng is not confirmed still extant), and the Srepok Wilderness Area and Siema Biodiversity Conservation Area in Cambodia; in the latter two areas there are now even signs of population recovery (WCS unpublished data; WWF unpublished data). The immediate conservation needs for the large Mondulkiri-centred Cambodian population are to continue strengthening site-based conservation management, in particular of the Srepok Wilderness Area and Siema Biodiversity Conservation Area, and laying the necessary groundwork to ensure that such management can be continued indefinitely.

Java has highly fragmented natural habitats and has done for centuries, reflecting longstanding high human population densities. Many protected areas were established during the Dutch colonial period but from independence up until the 1970s they were largely under-funded and neglected. After hosting the World Parks Conference in 1982, the Indonesian government gazetted a swathe of national parks and more structured conservation planning began, funded by the World Bank and other donors. The focus was largely on the 'multi-function' national parks and much money was spent on infrastructure, some staff training and increased personnel. The 'lesser' protected areas such as "game reserves" and "nature reserves" still had few staff and resources, and that has continued to the present. There was some habitat loss from protected areas through illegal logging, agricultural encroachment and other offtake, but the national parks of Java (several of which contain ideal habitat for Banteng and, at least into the mid 1990s, large populations) remained remarkably intact for much of the period. During the 1980s and early to mid 1990s guns were tightly controlled and the military and police were feared and respected. The strong culture of caged bird keeping meant that hunting, including that within protected areas, was primarily for birds and some small game, through various forms of trapping, including snaring. Thus there was relatively little hunting of Banteng and populations were stable or even increasing. Socio-political changes from 1997 led to a reduction in the respect for the police and military and the rise of a viewpoint that protected areas were the peoples' resources and would therefore benefit from decentralised management (M. Tyson pers. comm. 2008). This policy change, which risked a ‘tragedy of the commons’, has indeed led to increased destruction and poaching in the past decade. Banteng, as a large ungulate, is particularly threatened by this rapid rise in illegal hunting (S. Hedges pers. comm. 2008) and also by expansion of agriculture on Java and other forms of encroachment (G. Semiadi pers. comm.; S. Hedges pers. comm. 2008.). The decentralisation of conservation management decisions and actions, macro-economic fluctuations and reduced authority of The Law impedes control of illegal hunting (S. Hedges pers. comm. 2008).

In Thailand there are two populations thought to contain over 50 individuals, in Huai Kha Khaeng Wildlife Sanctuary and Kaeng Krachan National Park. Both areas are under active conservation management.

A large captive population exists (in addition to the large global population of the domesticated form which is believed to have hybridized widely with other oxen species) and a large introduced feral population, derived from Bali cattle, occurs in the northern territories of Australia (Bradshaw et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The banteng is legally protected across its range and occurs in a number of protected areas (1). However, the natural resources of reserves often continue to be exploited, with about 12 banteng poached annually, for example, in Baluran National Park, Java (7). Several on-going field survey programmes exist (e.g., in Indochina) and a monitoring programme is conducted in East Java. A large captive population is maintained world-wide (1), with European zoos first importing captive banteng from collections in Indonesia as early as 1867 (4). Such populations provide a buffer against total extinction, offer potential for future reintroductions into the wild and can be managed to maintain the genetic diversity of the species. In addition, they now have a new and exciting role that utilises the very cutting edge of technology and scientific knowledge – cloning! For the first time on April 1st, 2003, a healthy clone of this endangered species was born, offering powerful evidence that cloning technology can play a role in preserving and even reconstituting threatened and endangered species (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative affects of banteng for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Banteng are used for food, leather goods, and commercial trade. There are several million domesticated banteng estimated to be used for meat production and as work animals currently (Nowak 1991). To a certain degree, they are used to promote tourism. Big game hunters pay to track and kill these large game animals near the Coburg Peninsula.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Banteng

The banteng (Bos javanicus), also known as tembadau, is a species of wild cattle found in Southeast Asia. It is also known as scrub bull in Australia.

Banteng have been domesticated in several places in Southeast Asia, and there are around 1.5 million domestic banteng, which are called Bali cattle. These animals are used as working animals and for their meat.[3] Bali cattle have also been introduced to Northern Australia, where they have established stable feral populations.[4]

Contents

Distribution and subspecies

The following subspecies are recognised:[2]

  • Java banteng (B. j. javanicus): Found in Java, the males are black and females are buff.
  • Borneo banteng (B. j. lowi): From Borneo, they are smaller than Java banteng and the horns are steeper; bulls are chocolate-brown.
  • Burma banteng (B. j. birmanicus): In Myanmar, Thailand, Cambodia, Laos and Vietnam, these males and females are usually buff, but in Cambodia, 20 % of the bulls are blackish, and on the Malayan Peninsula in Thailand, most of the bulls are black. This subspecies is recognised by the IUCN[2] but not by Mammal Species of the World, 3rd edition.[1]

Characteristics

Domesticated banteng as Bali Bull with white socks and white rump

The banteng is similar in size to domestic cattle, being 1.55 to 1.65 m (61 to 65 in) tall at the shoulder, and weighing 600 to 800 kg (1,300 to 1,800 lb).[5] It exhibits sexual dimorphism, allowing the sexes to be readily distinguished by colour and size. In mature males, the short-haired coat is blue-black or dark chestnut in colour, while in females and young it is chestnut with a dark dorsal stripe. Both males and females have white stockings on their lower legs, a white rump, a white muzzle, and white spots above the eyes. The build is similar to that of domestic cattle, but with a comparatively slender neck and small head, and a ridge on the back above the shoulders. The horns of females are short and tightly curved, pointing inward at the tips, while those of males arc upwards, growing 60 to 75 cm (24 to 30 in) long, and being connected by a horn-like bald patch on the forehead.

Behaviour

Bantengs (cows) in Alas Purwo National Park, Java

Banteng live in sparse forest where they feed on grasses, bamboo, fruit, leaves and young branches. The banteng is generally active both night and day, but in places where humans are common they adopt a nocturnal schedule. Banteng tend to gather in herds of two to thirty members.

Cloning

A Bali man feeds his bantengs (cows)

The banteng is the second endangered species to be successfully cloned, and the first to survive for more than a week (the first was a gaur that died two days after being born).[6][7] Scientists at Advanced Cell Technology in Worcester, MA, U.S. extracted DNA from banteng cells kept in the San Diego Zoo's "Frozen Zoo" facility, and transferred it into eggs from domestic cattle, a process called somatic cell nuclear transfer. Thirty embryos were created and sent to Trans Ova Genetics, which implanted the fertilized eggs in domestic cattle. Two were carried to term and delivered by Caesarian section.[8] The first was born on April 1, 2003, and the second two days later. The second was euthanized,[9] but the first survived and, as of September 2006, remains in good health at the San Diego Zoo.

Hybridization program

Hybridization (crossbreeding) program which began in June 2011 made 5 cows are already pregnant. Genetically, Balinese cows are indeed the offspring of Javanese bulls, but today Balinese cows became smaller in size and weight due to inbreeding. To help improve the quality and productivity of new breeds, the Javanese bulls (Bos javanicus) who was transported from the Baluran National Park in Banyuwangi, has been incarcerated under a specialists's care 'in order to maintain his wild nature' to breed 10 Balinese cows (Bos javanicus f. domestica).[10]

Banteng in Australia

The domesticated form of the banteng was first introduced to Australia in 1849 with the establishment of a British military outpost called Port Essington on the Cobourg Peninsula. Twenty animals were taken to the western Arnhem Land, in present-day Northern Territory, as a source of meat. A year after the outpost’s establishment, poor conditions including as crop failure and tropical disease led to its abandonment. On the departure of British troops, the banteng were released from their grazing pastures and allowed to form a feral population.[11] By the 1960s, researchers realized that a population of about 1,500 individuals had developed in the tropical forests of the Cobourg Peninsula.[12]

Since their introduction in 1849, the population has not strayed far from its initial point of domesticated life; all currently live within the Garig Gunak Barlu National Park.[13] As of 2007, the initial population had grown from only 20 in 1849 to 8,000-10,000[14] and is used exclusively for sport hunting and by Aboriginal subsistence hunters.[15]

As of February 2005, the banteng population of the Cobourg Peninsula is 10,000 head, making the population in the Northern Territory the largest in the world. Before the study[which?] by Charles Darwin University, it was believed that only 5,000 pure-strain banteng survived worldwide. In their native range, the largest herd numbers less than 500.

Physiology and reproduction in Australia

The banteng of the Cobourg Peninsula have developed slightly different life processes than their domesticated counterparts. Growth over lifetime is sexually dimorphic; males grow faster and are larger than females.[16] Furthermore, females reach maximum body mass in three to four years, while males take five to six. Males achieve sexual maturity at three to four years, and females at two to four years. Fecundity declines in older females. Breeding is seasonal: maximum mating occurs during October and November, and most births take place in the winter months of June to August. Calf mortality is high in the first six months of life, and declines quickly thereafter with increasing body size. When compared with domestic populations, it was found that increased food in captive conditions led to higher fecundity, earlier maturation, and lower juvenile mortality.[16]

Environmental impact in Australia

Despite being a non-native species, the feral Australian banteng has adapted to interact positively with native bird populations. Studies have shown that mutual relationships have developed involving the removal of ectoparasites residing on the bovid body by the Torresian crow (Corvus orru).[17] This is especially notable because it is the first known relationship where a native bird shares a mutual symbiotic relationship with a non-native wild mammal, and it only needed 150 years to develop.

Within the Garig Gunak Barlu National Park, where practically all Australian banteng reside, there has been limited damage due to overgrazing. They are found primarily within the monsoon forests, but cause little damage, especially when compared with feral pigs.[18] Within the forest, population density was found to be around 70 per square kilometer, close to that on their initial introduction 140 years ago, perhaps because of the possibility that their habitat is a uniquely suitable mosaic of grassland and monsoon forest.[18] Another likely reason for their limited dispersal is the presence of fences along the southern end of the peninsula, installed to manage movement of other feral species like the water buffalo.[19] Interaction with the habitat is also unclear regarding monsoonal forest succession into grasslands.[20] Within the Garig Gunak Barlu National Park researchers noticed that monsoonal seedlings were encroaching into previously well established grasslands. It is thought that grazing by banteng limits potential fuel for grassland fires to take back monsoonal forest and spread monsoonal seeds, but this was still unclear after the study.[20]

Conservation value in Australia

Bos javanicus.ogg
Video of the Bos javanicus at Disney's Animal Kingdom

Since Australian banteng are considered an invasive non-native species, some environmental scientists believe that complete removal of the population would allow previously occupied habitat to revert to its pre-1849 state and allow native species to return. However, this is not universally agreed, both because of the socio-economic niche the banteng has occupied, and because of its role in helping to recover endangered wild populations in Asia.

Small populations in northern Australia are heavily relied on as a source of income for sport hunting, as well as by aboriginal peoples. Studies revealed that as much as AU$200,000 can be made annually from hunting, without damaging population stability.[13]

The current population of banteng in Australia has become the center of debate due to its endangered status in its native Asia. Wild banteng are extremely rare in Asia due to loss of suitable habitat. Domesticated banteng are regularly used in Southeast Asia as grazers in agricultural settings, but these domestic bantengs have varying degrees of introgression from other domesticated Bos species. Australian bantengs are derived from the domesticated form and not from the rare wild form, but genetic studies[which?] have revealed that Australian bantengs are identical to the Asian Bos javanicus and therefore not crossed with other species. This is what places the Australian population in a different conservation category than its domesticated conspecific in Southeast Asia.

Since a small founder event occurred with only approximately 20 previously domesticated individuals, a genetic bottleneck has inevitably occurred, causing all current individuals in Australia to lack genetic diversity as a result of inbreeding. This was proven using microsatellites, 12 in all, to determine that their inbreeding coefficient was high, F=0.58.[13] These findings were much higher than the endangered artiodactyl populations in Southeast Asia. Despite the limited genetic pool of this population, conservationists hope that at-risk populations can be preserved. Some have proposed that a deliberate introduction of the endangered populations to the stable but non-native Australian variety would enable viable conservation, even though it is not known how it would affect Northern Territory grazing ranges.[15]

See also

Stamp with bantengs from the GDR

References

  1. ^ a b Grubb, Peter (16 November 2005). "Bos javanicus". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 691. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200683. 
  2. ^ a b c Timmins, R.J., Duckworth, J.W., Hedges, S., Steinmetz, R. & Pattanavibool, A. (2008). Bos javanicus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 March 2009. Database entry includes a brief justification of why this species is of endangered.
  3. ^ Friend, J B, Cattle of the World, Blandford Press, Dorset, 1978
  4. ^ Endangered cattle (Banteng) find pastures new, 5th August 2005, New Scientist
  5. ^ Ultimate ungulate page on banteng
  6. ^ Fairfax Digital, Banteng clone leads charge for endangered animals, April 9, 2003. Visited October 12, 2009.
  7. ^ World Environment News, Scientists clone endangered Asian banteng, April 9, 2003. Visited October 12, 2009.
  8. ^ Advanced Cell Technology, Collaborative Effort Yields Endangered Species Clone, April 8, 2003. Visited October 12, 2009.
  9. ^ Nature Biotechnology (subscription required)
  10. ^ "Bali cows to meet Java bulls in East Java". April 2, 2012. http://www.thejakartapost.com/news/2012/04/02/bali-cows-meet-java-bulls-east-java.html. 
  11. ^ Letts, G. A., and A. W. E. L. Bassingthwaite Vos. (1979). "Feral animals in the Northern Territory - Report of the Board of Inquiry". Northern Territory Government, Darwin. Taken from Brook B., Bowman D.M.J., Bradshaw C., Campbell B., Whitehead P. (2006)
  12. ^ Letts, G. A. (1964). "Feral animals in the Northern Territory". Australian Veterinary Journal Volume 40, issue 3, pp.84–88. Taken From Brook B., Bowman D.M.J., Bradshaw C., Campbell B., Whitehead P. (2006)
  13. ^ a b c Bradshaw CJ, Isagi Y, Kaneko S, Brook BW, Bowman DM, Frankham R (July 2007). "Low genetic diversity in the bottlenecked population of endangered non-native banteng in northern Australia". Mol. Ecol. 16 (14): 2998–3008. doi:10.1111/j.1365-294X.2007.03365.x. PMID 17614913. 
  14. ^ Bradshaw CJA, Brook BW (2007). "Ecological-economic models of sustainable harvest for an endangered but exotic megaherbivore in northern Australia". Natural Resource Modeling 20 (1): 129–156. doi:10.1111/j.1939-7445.2007.tb00203.x. 
  15. ^ a b Bradshaw CJ, Isagi Y, Kaneko S, Bowman DM, Brook BW (August 2006). "Conservation value of non-native banteng in northern Australia". Conserv. Biol. 20 (4): 1306–11. doi:10.1111/j.1523-1739.2006.00428.x. PMID 16922247. 
  16. ^ a b Choquenot D (1993). "Growth, body condition and demography of wild banteng (Bos javanicus) on cobourg peninsula, Northern Australia". Journal of Zoology 231 (4): 533–542. doi:10.1111/j.1469-7998.1993.tb01936.x. 
  17. ^ J. A. Bradshaw, Corey (2006). ""Rapid development of cleaning behaviour by Torresian crows Corvus orru on non-native banteng Bos javanicus in northern Australia"". Journal of Avian Biology 37 (4): 409. doi:10.1111/j.2006.0908-8857.03595.x. 
  18. ^ a b Bowman DMJS, Panton WJ (1991). ""Sign and habitat impact of Banteng (Bos javanicus) and pig (Sus scrofa) Cobourg Peninsula, Northern Australia"". Australian Journal of Ecology 16 (1): 15–17. doi:10.1111/j.1442-9993.1991.tb01477.x. 
  19. ^ Brook BW, Bowman DM, Bradshaw CJ, Campbell BM, Whitehead PJ (September 2006). "Managing an endangered Asian bovid in an Australian National Park: the role and limitations of ecological-economic models in decision-making". Environ Manage 38 (3): 463–9. doi:10.1007/s00267-005-0157-7. PMID 16736298. 
  20. ^ a b Bowman, DMJS; Panton, WJ; McDonough, L (1990). "Dynamics of Forest Clumps on Chenier Plains, Cobourg Peninsula, Northern Territory". Australian Journal of Botany 38 (6): 593. doi:10.1071/BT9900593. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!