Overview

Distribution

Range Description

Present in Sudan from Khartoum in the north to Mongalla in the south, and in Djibouti, Ethiopia and Eritrea where it is found south of the River Omo and ranges as far east as the Ethiopian Rift Valley (Dandelot and Prevost 1972). Its range formerly extended along the Nile Valley.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Vervet monkeys (Chlorocebus aethiops) are found from Senegal to Ethiopia and south to South Africa. These monkeys are found in northeast Africa from the Red Sea near Tokar, south through Abyssinia as far as 5 degrees north, and west to the eastern range of the Tantalus. (Hill,1965)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chlorocebus aethiops is usually around 400 to 600 mm in length (head and body), with tales about 300 to 500 mm. weights typically range between 3 and 5 kg. Males are larger than females. All individuals have close-fitting moderate length hairs over most of the body, and elongated side-whiskers. The whiskers are usually a lighter color (white or pale yellow) and differ in length from individual to individual. The faces of vervet monkeys are usually sooty black. A defining characteristic of this species is the greenish color of the upper parts of the face, which is caused by the banding together of individual hairs with black and yellow strands. In males, the scrotum and surrounding areas are bright blue or a greenish color. (Hill, 1965; Parker, 1983)

Range mass: 3 to 5 kg.

Range length: 400 to 600 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is present in savanna, open woodland, forest-grassland mosaic, especially close to rivers (Dorst and Dandelot 1972). It is an extremely adaptable species that can live in both rural and urban environments. Heavily dependent on acacia seeds, flowers, foliage and gum. Also feeds on figs and other fruiting trees (Butynski 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bush steppe country in tablelands of the Southern Sudan and Abyssinia. Vervets must drink water daily in the dry seasons, and therefore their habitat is limited to those near constant water supplies. (Hill, 1965)

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Chlorocebus aethiops is omnivorous but with a heavy emphasis on fruit. Their diets often Include insects, vegetable matter, and at times, small mammals and birds. (Harris, 1970)

Animal Foods: birds; mammals; insects

Plant Foods: leaves; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As frugivorous monkeys, vervets may play some role in seed dispersal. Because they sometimes prey on other animals, they may act as a check on populations of certain insects, birds, and small mammals. As a prey species, they are likely to impact predator populations.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Vervet monkeys fall prey to leopards, snakes and raptors, as do other savanah monkeys. They may also be preyed upon by baboons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: male

Status: captivity:
31.6 years.

Average lifespan

Status: wild:
31.0 years.

Average lifespan

Sex: male

Status: captivity:
23.0 years.

Average lifespan

Status: wild:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.8 years (captivity) Observations: One captive specimen in Israel lived at least 30.8 years. It could have been older, though, because its exact date of birth and death are unknown (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females typically have few mates in their lifetime, whereas some males have numerous mates. (Sellers)

Mating System: polygynous

Little is known about the reproductive habits of C. aethiops; however, like most primates, they are cyclically receptive. Visual changes in the vulva of females, such as swelling, alert the males as to when the females are in heat.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 314 g.

Average gestation period: 162 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1034 days.

Females take a strong interest in raising their young. Within the social groups, other females often share this task with the mother.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cercopithecus aethiops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTGCATGAGCTGGAATCATAGGAACAGCTCTAAGCCTTCTCATTCGAGCTGAATTAGGCCAACCCGGTAGTTTACTAGGCAGTGACCATATCTATAATGTCATTGTAACAGCCCATGCATTTATTATAATTTTCTTCATAGTTATACCCATTATAATCGGAGGGTTCGGGAACTGACTAGTACCCTTGATAATTGGTGCTCCTGACATAGCATTTCCCCGTCTAAATAATATGAGCTTCTGACTTCTTCCCCCCTCCTTCCTGCTGCTAATGGCATCAACCATAATCGAGGCTGGCGCTGGAACAGGTTGAACAGTATACCCCCCCTTAGCAGGAAACCTCTCTCACCCAGGGGCCTCCGTAGACTTAGTTATTTTCTCCCTCCACCTAGCAGGAGTTTCCTCTATCCTGGGGGCTATCAACTTCATTACCACCATTATCAACATGAAGCCCCCCGCCATATCCCAGTATCAAACCCCGTTATTTGTCTGATCTGTCCTAATCACAGCAATCCTACTACTCCTCTCCCTGCCAGTCTTAGCTGCCGGCATTACTATACTATTAACAGACCGCAACCTCAACACTACCTTCTTTGATCCTACTGGAGGGGGAGACCCTATCCTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cercopithecus aethiops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chlorocebus aethiops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTCTTTTCAACAAACCACAAAGACATCGGAACTCTATACCTACTATTCGGTGCATGAGCTGGAATCATAGGCACAGCTCTAAGTCTTCTCATTCGAGCTGAGCTAGGCCAACCAGGKAGTTTACTAGGTAGT---GACCATATCTATAATGTCATTGKAACAGCCCATGCATTCGTTATAATTTTCTTCATAGTTATACCCATTATAATTGGAGGGTTCGGGAACTGACTAGTACCCTTGATAATTGGGGCTCCTGACATAGCATTCCCCCGTCTAAATAATATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTGCTACTTATGGGATCAACCATAATCGAGGCTGGCGCCGGAACAGGTTGAACAGTGTATCCCCCCTTAGCAGGAAACTTCTCTCATCCAGGAGCCTCCGTAGACTTAGTCATCTTCTCCCTCCACCTAGCAGGGATTTCCTCTATCCTAGGAGCTATCAACTTCATCACCACCATTATCAACATGAAGCCCCCCGCCATATCCCAGTATCAAACCCCACTGTTTGTCTGATCTGTCCTAATCACAGCAATCCTACTACTCCTCTCCCTACCAGTCTTAGCTGCCGGCATTACTATACTACTAACAGACCGCAACCTCAATACTACCTTCTTTGATCCTACTGGAGGGGGAGACCCTATCCTATACCAACATCTATTTTGATTCTTTGGCCACCCTGAGGTCTACATCCTTATTCTCCCTGGATTCGGAATAATCTCCCACATTGTAACTTACTACTCCGGGAAAAAAGAGCCATTTGGGTATATAGGTATGACCTGGGCTATAATGTCAATCGGGTTCCTGGGATTTATTGTATGAGCCCACCACATATTTACAGTGGGCATAGATGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chlorocebus aethiops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Kingdon, J. & Butynski, T.M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Least Concern as this species is widespread and very abundant with no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chlorocebus aethiops is being threatened by continous deforestation and and destruction of their natural habitat. CITES Appendix 2. (Parker, 1983)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a common species. They live in bands of from 6 to 20, averaging a dozen individuals (Dorst and Dandelot 1972).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It is generally common and adaptable over its range, and there are presumed to be no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES and on Class B of the African Convention on the Conservation of Nature and Natural Resources. It is present in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Chlorocebus aethiops is separated evolutionarily from humans by more than 50 million years. Their resemblance to Homo sapiens, however, in characteristics such as the nervous system, reproduction systems, and suceptibility to certain parasites make them especially desireable for biological studies. (Harris, 1970)

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grivet

The grivet (Chlorocebus aethiops) is an Old World monkey with long white tufts of hair along the sides of the face. Some authorities consider this and all of the members of the genus Chlorocebus to be a single species, Cercopithecus aethiops.[1] As here defined, the grivet is restricted to Ethiopia, Sudan, Djibouti and Eritrea.[2] In the southern part of its range, it comes into contact with the closely related vervet monkey (C. pygerythrus) and Bale Mountains vervet (C. djamdjamensis).[4] Hybridization between them is possible, and may present a threat to the vulnerable Bale Mountains vervet.[4] Unlike that species, the grivet is common and rated as Least Concern by the IUCN.[2]

Physical description[edit source | edit]

The grivet's facial skin, hands, and feet are black. The face has a white line above the eyes. It has long white whiskers on the cheeks. The fur on the back has an olive color, while the front is white fur. The skin on the stomach has a blue tint. The fur has a bristly feel. The approximate head and body length for males is 49 cm (19 in) for males 42.6 cm (16.8 in) for females.[5] The length of the tail for males is approximately 30–50 cm (12–20 in).[6] The body mass ranges from 3.4 to 8.0 kg (7.5 to 18 lb) with females at the smaller end of the scale.[5]

Habitat and distribution[edit source | edit]

The main habitat of the grivet is savanna woodlands.[2] Its range is Sudan east of the White Nile, Eritrea, and Ethiopia east to the Rift Valley.[1] It is also found in Djibouti and Eritrea.[2] The grivet needs to live around a source of water, especially during the dry season. It is able to adapt to many environments.[2]

Behavior[edit source | edit]

The grivet is most active in the morning and in early evening. It stays on the ground most of the day to eat and at night it sleeps in trees. The grivet spends a lot of time grooming, playing, climbing, and play fighting; all of these things help to ensure its survival. Its eating habits consist of eating mostly fruits, vegetables, and sometimes small mammals, insects, and birds, making it an omnivore. It will also scavenge for human food. It must drink water daily, especially in the dry seasons. It is one of few species that has multiple-male groups that are of moderate size. In the hierarchy of males, an individual shows its dominance by putting its tail in a stiff upright position and strolling past lower-ranked males.[7] They travel in packs and usually move on all fours or quadrupedally, except when using both hands for carrying, when they manage to walk and run quite comfortably on two legs. Groups can range from five to over 70.[5]

Females will have a limited number of mates, while males will have numerous. Swelling of the female's vulva alerts males as to when the female is in heat. Giving birth to one baby at a time is common and the pregnancy usually lasts two to three months. When the baby is born the mother will clean the infant and bite off the umbilical cord. Young have pink faces and black hair. It will take around two months for them to get their adult coats. The first few months, the infant will stay very close to its mother, but after six months, the infant is weaned.[5]

Conservation[edit source | edit]

The grivet is occasionally hunted as bushmeat. They are killed for either commercial or subsistence purposes. Although not endangered, it is threatened through destruction of habitat by way of disappearing forests. It is preyed on by large snakes, leopards, humans and sometimes baboons.[8] The grivet may live for 13 years.[5]

References[edit source | edit]

  1. ^ a b c Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 158–159. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b c d e f Kingdon, J. & Butynski, T. M. (2008). Chlorocebus aethiops. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Linnaeus, Carl (1758). Systema naturæ. Regnum animale. (10 ed.). p. 28. Retrieved 19 November 2012. 
  4. ^ a b Kingdon, J. (1997). The Kingdon Guide to African Mammals. Academic Press Limited, London. ISBN 0-12-408355-2. 
  5. ^ a b c d e Cawthon Lang KA (2006-01-03). "Primate Factsheets: Vervet (Chlorocebus) Taxonomy, Morphology, & Ecology". Retrieved 2008-11-12. 
  6. ^ "Vervet Monkeys". Animal Corner. Retrieved 2012-05-02. 
  7. ^ Bernstein, P. L.; Smith, W. J.; Krensky, A.; Rosene, K. (1978). "Tail positions of Cercopithecus aethiops". Zeitschrift für Tierpsychologie 46 (3): 268–278. doi:10.1111/j.1439-0310.1978.tb01449.x.  edit
  8. ^ Rochester M (1999). "Chlorocebus aethiops". Animal Diversity Web. Retrieved 2008-11-12. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!