Physical Description

Type Information

Holotype for Cancer branneri Rathbun, 1926
Catalog Number: USNM 3092
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Collector(s): D. Jordan
Locality: San Francisco, California, United States, North Pacific Ocean
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 14.15 - 73
  Temperature range (°C): 9.967 - 9.967
  Nitrate (umol/L): 7.622 - 7.622
  Salinity (PPS): 31.942 - 31.942
  Oxygen (ml/l): 6.534 - 6.534
  Phosphate (umol/l): 0.963 - 0.963
  Silicate (umol/l): 14.539 - 14.539

Graphical representation

Depth range (m): 14.15 - 73
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Romaleon branneri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cancer branneri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCCTTTAGCAGGAGCTATTGCTCATNNCGGGGCCTCAGTTGACATAGGAATTTTCTCCTTACATTTAGCAGGGGTTTCTTCTATCTTAGGAGCTGTAAATTTTATAACAACTGTAATTAATATGCGATCCTTTGGGATAACCTTAGATCAAATACCTCTCTTCGTTTGAGCTGTATTTATTACTGCTATCCTATTACTCCTCTCTCTCCCTGTTCTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATCTTAATACTTCTTTCTTTGACCCCGCAGGAGNGGGTGACCCTGTTCTTTATCAACACCTTTTTTGATTTTTTGGGCACCCAGAAGTATATATTCTTATTTTGCCTGCTTTTGGAATAATTTCCCATATTGTAAGACAAGAATCTGGGAAAAAAGAGTCCTTTGGGACCCTTGGGATAATTTACGCTATATTGGCCATTGGTATTTTAGGCTTTGTGGTCTGAGCTCATCACATGTTTACAGTTGGAATGGACGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cancer branneri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!