Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This is the most widespread species of burrowing mayflies in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.1 - 11.6

Graphical representation

Depth range (m): 0.1 - 11.6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species was recently reported from a few southern river sites in New Hampshire (Chandler et al., 2006). It was recently confirmed in Washington in the Snake River, Benton Co.; Lake Chelan, Chelan Co.; Tochet River, Columbia Co.; and historically in Spokane, Spokane Co. (McCafferty and Meyer, 2007). In Oregon, it occurs in Clackamas, Clatsop, Douglas, Gilliam, Klamath, Lane, Linn, Multnomah, Polk, and Umatilla Cos. (Meyer and McCafferty, 2007). In South Dakota, it occurs in Bon Homme, Brule, Clay, Corson, McCook, Meade, Moody, Turner, and Yankton Cos. (Guenther and McCafferty, 2008). In Washington, it occurs in Benton, Chelan, Columbia, and Spokane Cos. (Meyer and McCafferty, 2007). It was recently documented in the Humboldt River (just below the confluence of the North Fork), Nevada (Baumann and Kondratieff, 2000). In South Carolina, it occurs in Aiken, Anderson, Bamberg, Barnwell, Berkeley, Colleton, Dorchester, Florence, Greenville, Hampton, Lexington, McCormick, Oconee, Pickens, Saluda, Spartanburg, and York Cos. (McCafferty and Meyer, 2008). McCafferty et al. (1997) cited occurrences in Oklahoma from Mayes Co. It was recently found in Fort Sill, Lawton, Camanche Co. Oklahoma (Zuellig et al., 2006). In California, it occurs in Butte, Contra Costa, El Dorado, Fresno, Glennk Kern, Kings, Lake, Lassen, Madera, Merced, Modoc, Placer, Sacramento, San Bernardino, Shasta, Siskiyou, Stanislaus, Sutter, Trinity, Tulare, Tuolumne, Yolo, and Yuba Cos. (Meyer and McCafferty, 2008). It has been documented in South Milford, Nova Scotia (Jacobus and McCafferty, 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Univoltine life history with adult emergence peaking in August (Lobinske et al., 1996.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hexagenia limbata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 140 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATACTTTNTCTTTGGGGCCTGATCGGGTATAATTGGTACTTCATTAAGTTTATTAATTCGGGCTGAACTTGGTCAACCGGGATCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGTAATTGACTAGTACCATTAATACTCGGGGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTACTACCCCCCGCCCTTACCCTTTTATTAGCTAGTAGTATAGTTGAAAGAGGGGCTGGAACGGGATGAACTGTTTATCCCCCTCTAGCTGCAGGTATTGCCCATGCAGGTGCTTCAGTAGATTTAGCTATTTTCTCCCTACACCTAGCCGGTGTTTCTTCTATTCTAGGTGCAGTAAATTTTATTACTACTACTATTAATATACGTACAAGAGGAATAACAATAGACCGAATTCCTTTATTTGTTTGATCTGTAGTTATCACAGCAGTCCTTTTACTCCTGTCTCTCCCTGTGTTAGCTGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACTTCTTTCTTTGACCCCGCAGGAGGAGGAGATCCCATCTTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hexagenia limbata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 52
Specimens with Barcodes: 145
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This is the most widespread species of burrowing mayflies in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!