Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Comprehensive Description

Description

The species (which has frequently been placed in Bathysiredon or Siredon) is a neotenic salamander resembling the Mexican axolotl (A. mexicanum). This animal is tan to brown and homogenous in coloration. Distinct features include a flat, wide head, caudal fins, and few rakers on the third gill arch’s anterior surface (the exact amount is disputed). The salamander can also be identified by perennibranchiate (lifelong), hyperfilamentous gills and diminutive, webbed toes with the fourth digit possessing three phalanges (Brandon, 1992, Smith, 1948). A sexually mature specimen measures, from snout to vent, over 122 mm; there is no body length difference between the sexes. Of preserved specimens, total size ranges from 128-282 mm (Brandon, 1970).

References

Brandon, R.A. 1970. Size range maturity, and reproduction of Ambystoma (bathysiredon) dumerilii (Dugès), a paedogenetic Mexican salamander endemic to Lake Pátzcuaro, Michoacán. Copeia 1970: 385-388.

Brandon, R.A. 1976. Spontaneous and induced metamorphosis of Ambystoma dumerilii (Dugès), a paedogenetic Mexican salamander, under laboratory conditions. Herpetologica 32: 429-438.

Brandon, R.A. 1977. Interspecific hybridization among Mexican and United States salamanders of the genus Ambystoma under laboratory conditions. Herpetologica 33: 133-152

Brandon, R.A. 1992. Ambystoma dumerilii. Catalogue of American Amphibians and Reptiles 532: 1-3.

Poly, W.J. 2003. Argulus ambystoma, a new species parasitic on the salamander Ambystoma duerilii from Mexico (Crustacea: Branchiura: Argulidae). Ohio Journal of Science 103: 52-61

Smith, H.M. Taylor, E. 1948. An Annotated Checklist and Key to the Amphibia of Mexico. Smithsonian Institution Bulletin 194: 1-118

Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known only from Lago Pátzcuaro in north-western Michoacan, Mexico, at 1,920m asl, and has not been recorded from other localities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

The amphibian is known historically and currently to inhabit only Lake Patzcuaro in the Mexican state of Michoacan (Brandon, 1970). Rumors of salamander sightings in San Juan del Rio, Queretaro, are highly unlikely due to geographic isolation. Area of occurrence is less than 100km2, the occupancy area less than 10km2 (IUCN).

Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Syntype for Ambystoma dumerilii
Catalog Number: USNM 16202
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Lake Patzcuaro, Michoacan, Mexico
  • Syntype: Dugès, A. 1870. La Naturaleza. 1: 241, plate 5a, figures 1-13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Ambystoma dumerilii
Catalog Number: USNM 16201
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Lake Patzcuaro, Michoacan, Mexico
  • Syntype: Dugès, A. 1870. La Naturaleza. 1: 241, plate 5a, figures 1-13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species does not metamorphose and lives permanently in water. It has a winter breeding season. No field studies of any other aspect of the ecology of the species have been conducted.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma dumerilii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGACTATTTTCTACAAATCATAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTGGCACTGCATTAAGCCTTCTAATCCGAGCAGAACTAAGCCAACCAGGAGCCCTACTAGGGGAT---GATCAAATCTATAATGTTATTGTAACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTGTAATAATTGGCGGATTCGGAAACTGATTAGTACCATTAATAATTGGTGCACCAGATATAGCCTTCCCCCGTATAAACAATATAAGCTTTTGGCTTCTTCCTCCTTCGTTCCTCCTTCTATTAGCATCCTCTGGAGTTGAAGCAGGAGCTGGAACGGGGTGAACTGTATACCCCCCACTTGCAGGCAACCTAGCCCATGCTGGGGCCTCAGTCGATTTAACAATTTTTTCACTTCATTTACCGGGTGTTTCATCTATCCTAGGTGCGATTAATTTTATTACAACCTCAATTAATATAAAACCCGCATCAATATCACAATATCAAACTCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTTCTTCTATTACTTTCTCTTCCGGTTTTAGCAGCAGGAATTACAATACTGCTGACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCTGGAGGAGGTGACCCTGTACTTTATCAACACCTATTTTGATTTTTTGGGCACCCAGAAGTGTATATCTTAATTTTACCAGGATTTGGAATAATTTCACATATTGTAACTTATTATTCTGCAAAAAAAGAACCATTTGGTTATATAGGAATAGTATGAGCTATAATATCTATCGGACTTCTAGGATTTATTGTATGAGCACATCATATATTTACAGTAGATTTAAATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma dumerilii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B1ab(iii,v)+2ab(iii,v)

Version
3.1

Year Assessed
2004

Assessor/s
Brad Shaffer, Oscar Flores-Villela, Gabriela Parra-Olea, David Wake

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Critically Endangered because its Extent of Occurrence is less than 100 km2 and its Area Of Occupancy is less than 10km2, all individuals are in a single sub-population, and there is continuing decline in the number of mature individuals and in the extent and quality of its habitat in and around Patzcuaro Lake.

History
  • 1996
    Not Evaluated
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is believed to be in very serious decline, and might be close to extinction. Recent declines in the catch by local fishermen seem to indicate a severe population crash (information from 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Metamorphosis in nature has not been observed although roughly a third of both wild-caught and first generation laboratory animals undergo the process according to research conducted at Carbondale, Illinois (Brandon, 1976). Hybrids between dumerilii and possible relatives such as mexicanum and tigrinum are also prone to metamorphose (Brandon, 1977). Spontaneous transformations generally occur during breeding seasons, suggesting a hormonal association. Adult animals do not experience periodic ecdysis (molting), but continuously shed the stratum corneum (exterior skin). The transformed skin does not include Leydig and mucous cells like normal adult amphibian skin. An incomplete metamorphosis over a period up to three years indicates that the change is unnatural for the species; no spontaneously transformed animal lived over five months and no induced transformed animal lived over 48 days from the beginning of morph (Brandon, 1976).

Based solely on the historical vs. present numbers reported by local fishermen, wild populations have diminished dramatically (IUCN).

Ova mature during the rainy seasons and spawning occurs with increasing atmospheric temperatures; breeding observed during winter (IUCN) and spring (Brandon, 1970).

Salamanders feed by suction and sport distinguishably few "tooth-like rakers" as described above (IUCN) - laboratory animals thrive on beef liver (Brandon, 1970).

Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The filling and pollution of the only lake that the species inhabits is the major threat to its survival. The lake is an important area for local fisheries. Predatory fish have been introduced into the lake, which might be a major problem for the species, although it has been able to co-exist with such species for a long time. The animals are harvested both for human consumption and for medicinal purposes (they are supposed to be a cure for respiratory problems).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

It was feared in the 1930’s that the introduction of largemouth bass would decimate amphibian colonies, however, no salamander decline was recorded to have been directly attributed to the foreign fish (Brandon, 1970). Argulus ambystoma, a new species of parasitic crustaceans (fish lice) found on fish, a crayfish, and the dumerilii of Lake Patzcuaro, resides on the skin surface and retreats to the gills of hosts upon exposure to light; its threat to A. dumerilii is unknown (Poly, 2003).

Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It does not occur in any protected area, and conservation of its remaining habitat is urgent. This species has been bred in captivity, and so captive animals could be a source of new individuals to repopulate natural habitats. Studies are needed to evaluate the sustainability of the current harvest, as well as the impacts of introduced predatory fishes. This latter information is particularly important since A. dumerilii is unique among aquatic ambystomatids in its apparent long-term coexistence with introduced largemouth bass (Micropterus salmoides) for the last 60 years. This species is protected under the category Pr (Special protection) by the Government of Mexico. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

Known locally as Achoque, the species is harvested by the indigenous Tarascan people for consumption and for its believed medicinal properties as a respiratory remedy (IUCN).

Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lake Patzcuaro salamander

The Lake Patzcuaro Salamander, locally known as Achoque, Ambystoma dumerilii, is a neotenic salamander species.

This salamander is found in Lago de Pátzcuaro, a high altitude lake in the Mexican state of Michoacán. This is located in the Mesa Central region of the country, home to many isolated Ambystoma species. There have been claims that a subspecies is found further inland to the north-east in San Juan del Río, Querétaro, but this is doubtful due to the animals wholly aquatic nature. Dumerilii retain their larval characters throughout their entire life. This results in adults that have long, heavily filamented external gills, gill slits lined with tooth-like gill rakers, and caudal fins. Patzcuaro salamanders are usually yellowish in color, with a lighter shade on their underbellies. They have large heads and reduced limbs. They feed by suction, and eat many types of invertebrates.

Recently, this salamander has been used in research as a counterpoint to the more common captive-bred Axolotl. Patzcuaro salamanders have been hybridized with axolotls, and used in mitochondrial studies for comparison.

Due to habitat destruction, pollution and the introduction of predatory fish the population has decreased severely in the past decades. It is listed as Critically endangered in the IUCN redlist and in Appendix II CITES.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!