Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

The Snowy Owl (Bubo scandiacus) is a large, white owl with a rounded head and yellow eyes. The plumage ranges from all white (some old males) to white with many dark bars and spots (particularly in females and immatures).

This is a bird of the open Arctic tundra of both the New World and Old World. Snowy Owls nest on the ground and feed mainly on lemmings, which they hunt both day and night (other mammals and birds are also eaten, as well as some fish and carrion). In winter, there is some movement south and individuals are seen at least irregularly south to the northern United States (and even, rarely, the Gulf Coast), Iceland, the British Isles, northern continental Europe, central Russia, northern China, and Sakhalin. These wandering winter birds are generally seen in open country such as prairie, marshes, fields, pastures, and sandy beaches. In years when lemming populations crash, many Snowy Owls move south to the northern tier of states in the United States and some go much farther. These wandering birds (usually heavily barred younger birds) often perch on the ground, low stumps, or buildings.

In many Arctic regions, Snowy Owls breed mainly in years when lemmings are abundant and fail to nest at all when lemmings are scarce. Although Snowy Owls are silent off the breeding grounds, males defend their breeding territories with deep hooting in early spring. A courting male flies with deep, slow wingbeats, often with a lemming in his bill; reaching the female, he leans forward and partly raises his wings. The nest site is typically a mound or ridge in hilly country or a hummock in low-lying areas. It is always in very open tundra with high visibility. The same site may be used for several years. The nest (which is built by the female) is a simple depression in the tundra with no lining added. Clutch size is highly variable (3 to 11 eggs) and correlated with prey abundance. The eggs are whitish, but become stained in the nest. The female incubates the eggs for 31 to 33 days and the male brings food to the incubating female. Egg hatch is not synchronized, so the female cares for her first young while still incubating her last eggs. The female remains with the young and the male brings her food, which the female feeds them. The young may leave the nest after 2 to 3 weeks, but they are not able to fly until around 7 weeks and are fed by their parents until at least 9 or 10 weeks.

Although most North American Snowy Owl breeding areas are far from major human disturbance, this species has declined in parts of its breeding range in northern Europe.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Snowy owls have a circumpolar distribution. They breed in coastal Alaska, Canada, and Greenland, as well as in northern Scandinavia, Russia, southern Novaya Zemlya and northern Siberia. In winter, snowy owls can be found in Canada and the northern United States, sporadically further south into the U.S., in Iceland, the British Isles, northern Europe, central Russia, northern China and Sakhalin. While typically found in the arctic, periodic irruptions of "excess populations" occasionally move south, driven by a lack of food resources in the tundra. Snowy owl fossils have been found as far south as the Tropic of Cancer, and are believed to have originated in that region.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Encyclopedia Britannica, 1995. Encyclopedia Britannica 15th Edition, Vol. 10. Chicago: Encyclopedia Britannica, Inc..
  • Hoyo, J., A. Elliot, J. Sargatal. 1999. Handbook of the Birds of the World, Volume 5. Barcelona: Lynx Edicions.
  • National Geographic, 1999. Field Guide to the Birds of North America, Third Edition. Washington D.C.: National Geographic.
  • Parmelee, D. 1992. Snowy Owl (Nyctea scandiaca). Pp. 1-20 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 10. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. Breeding range includes arctic tundras of the world: Aleutian Islands and northern Alaska, throughout Canadian Arctic Islands to northern Greenland, northern Scandinavia, northern Russia, southern Novaya Zemlya and northern Siberia south to the limits of tundra in Eurasia and the Commander Islands. Rarely in the British Isles (Cramp 1985). Snowy owls winter within breeding range if conditions allow; also south to southern Canada and northern United States, primarily in the northern Great Plains, but with occasional irruptive movements east, south, and west of there; and to Iceland, British Isles and central Europe, central Russia, northern China and Sakhalin. Accidental in northwest India, Japan, Bermuda, the Mediterranean and Iran (Parmelee 1992). Some evidence exists for winter site fidelity (Oeming 1957, Follen and Leupke 1980).

Estimated global extent of occurrence is 1,000,000-10,000,000 square kilometers (BirdLife International 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Snowy owls in polar regions around the world. They breed in coastal Alaska, Canada, and Greenland, as well as in northern Scandinavia, Russia, southern Novaya Zemlya and northern Siberia. In winter, snowy owls can be found in Canada and the northern United States, Iceland, the British Isles, northern Europe, central Russia, northern China and Sakhalin. Though they are usually found in the arctic, every few years, snowy owls spend the winter much farther south that the arctic. In some years, they can be seen as far south as Oklahoma, northern Alabama, and central California. This probably occurs when there is not enough food in their normal winter habitat.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Encyclopedia Britannica, 1995. Encyclopedia Britannica 15th Edition, Vol. 10. Chicago: Encyclopedia Britannica, Inc..
  • Hoyo, J., A. Elliot, J. Sargatal. 1999. Handbook of the Birds of the World, Volume 5. Barcelona: Lynx Edicions.
  • National Geographic, 1999. Field Guide to the Birds of North America, Third Edition. Washington D.C.: National Geographic.
  • Parmelee, D. 1992. Snowy Owl (Nyctea scandiaca). Pp. 1-20 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 10. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Arctic circumpolar; irregular southern post-breeding irruptions.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Snowy owls are the largest bird species in the arctic, 63 to 73 cm long with an average wingspan of 170 cm. Females are larger and heavier than the males, weighing 1550 to 1600 grams, compared to males which weigh 1450 to 1500 grams. Snowy owls are predominantly white with dusky brown spots and bars. Females tend to have more markings than males, which may become nearly completely white as they age. Young snowy owls are generally darker and more heavily marked than adults. Snowy owls have yellow eyes and their legs and feet are covered in white feathers that protect them from the cold weather.

Range mass: 1450 to 1600 g.

Range length: 63 to 73 cm.

Average wingspan: 170 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 4.2244 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Snowy owls are the largest bird species in the arctic. They are 63 to 73 cm long and have an average wingspan of 170 cm. Females are larger and heavier than the males. Females weigh 1550 to 1600 grams, and males weigh 1450 to 1500 grams. Snowy owls are white with brown spots and bars. Females are usually darker with more markings than males. Young snowy owls are darker with more marks than adults. Snowy owls have yellow eyes. Their legs and feet are covered in white feathers that protect them from the cold weather.

Range mass: 1450 to 1600 g.

Range length: 63 to 73 cm.

Average wingspan: 170 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Average basal metabolic rate: 4.2244 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 58 cm

Weight: 1963 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Cotype for Nyctea scandiaca
Catalog Number: USNM 36434
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Immature
Preparation: Skin: Whole
Collector(s): R. Mac Farlane
Year Collected: 1863
Locality: Fort Anderson, Near, Vicinity of Anderson River, Mackenzie, Northwest Territories, Canada, North America
  • Cotype: Ridgway. January 1874. History Of North American Birds (Land Birds). 3: 70.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Nyctea scandiaca
Catalog Number: USNM A12058
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): C. Drexler
Year Collected: 1858
Locality: Washington, District of Columbia, United States, North America
  • Cotype: Ridgway. January 1874. History Of North American Birds (Land Birds). 3: 70.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Nyctea scandiaca
Catalog Number: USNM A12059
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): C. Drexler
Year Collected: 1858
Locality: Washington, District of Columbia, United States, North America
  • Cotype: Ridgway. January 1874. History Of North American Birds (Land Birds). 3: 70.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Snowy owls inhabit open tundra, usually from sea level to less than 300 m elevation. They may also inhabit lowland salt grass meadows and poorly drained freshwater wet meadows, especially for hunting. When food is scarce, snowy owls travel south to warmer climates in winter. Prime winter habitat in the Great Plains is similar to their breeding habitat. In the south, they are frequently seen in villages and urban centers, as well as in marshes and on dunes.

Range elevation: 0 to 300 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland

Wetlands: marsh

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Tundra, primarily where mounds, hillocks or rocks are present; in winter and migration occurring also in open country such as prairie, marshes, fields, pastures and sand dunes (AOU 1983), as well as tidal shores.

Nests on the ground in open country, usually on a slightly raised site (Harrison 1978). Nests in a scraped out area.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Snowy owls live in open tundra, from sea level up to about 300 m elevation. They also use salt grass meadows and freshwater wet meadows, especially for hunting. When food is scarce, snowy owls travel south to warmer climates in winter. The best winter habitat is in the Great Plains, and is similar to the tundra where they breed. In the winter, they can also be seen in villages and cities, and in marshes and on dunes.

Range elevation: 0 to 300 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland

Wetlands: marsh

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Disperses from nesting areas after breeding; moves southward to areas where weather and food permit overwintering. Regular migrant in northern Great Plains of Canada. Irruptive southward migrations in western and eastern North America; some authors correlate southward movements with lemming population cycle, but Kerlinger et al. (1985) found no correlation. Arrives in northern Great Plains early November through late December or early January, departs late February and early March (some remain until late March) (Kerlinger and Lein 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Snowy Owls are carnivorous. They hunt by utilizing an elevated perch that affords them good visibility while waiting for potential prey to appear in the hunting area. Visual scanning of the hunting area is facilitated by their ability to swivel their head three quarters of the way around (270 degrees). Snowy Owls' main foods are typically lemmings and mice. However, they also take rabbits (family Leporidae), seabirds, and fish opportunistically. If extra food is captured, snowy owls may store it on a nearby perch.

Animal Foods: birds; mammals; fish

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Chinery, M. 1992. The Kingfisher Illustrated Encyclopedia of Animals. New York: Kingfisher Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet predominantly lemmings and voles; important alternate prey includes other rodents, rabbits, birds (e.g., waterfowl, Galliformes). Estimated that young consumes about 1500 lemmings between hatching and independence from parents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Snowy Owls are carnivorous. They hunt by perching above the ground and watching for prey. Snowy owls can watch a large area without moving their bodies because they are able to turn their head to see directly behind them. The main foods eaten by snowy owls are lemmings and mice. They also eat rabbits, seabirds, and fish when they can catch them.

Snowy owls store extra food on a perch. One snowy owls had a pile of 26 extra lemmings stored at one perch. Snowy owls may eat snow in order to get enough water.

Animal Foods: birds; mammals; fish

Foraging Behavior: stores or caches food

  • Chinery, M. 1992. The Kingfisher Illustrated Encyclopedia of Animals. New York: Kingfisher Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Snowy owls affect the populations of animals that they eat. For example, one owl may consume more than 1,600 lemmings in a year. Snowy owls also compete with many other species for lemmings and other prey. Rough-legged hawks, golden eagles, peregrine falcons, gyrfalcons, jaegers, glaucous gulls, short-eared owls, common ravens, gray wolves, arctic foxes, and ermine are some of the species that compete with snowy owls for prey. Some species, including greater and lesser snow geese (Anser caerulescens) nesting near snowy owl nests seem to benefit from the protection of snowy owls that drive competing predators out of the area.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humans are probably the most important predator of snowy owls. Snowy owls are killed by humans for food, trophies, and to protect game animals. Other predators include foxes, jaegers, and probably dogs, wolves and other avian predators.

Males defend the nest by standing guard nearby while the female incubates the eggs and broods the young. Both sexes attack approaching predators, dive-bombing them and engage in distraction displays to draw the predator away from the nest.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Snowy owls affect the populations of animals that they eat. For example, one owl may kill more than 1,600 lemmings in one year. Snowy owls also compete with many other species for lemmings and other prey. Buteo lagopus, Aquila chrysaetos, Falco peregrinus, Falco rusticolus, jaegers, Larus hyperboreus, Asio flammeus, Corvus corax, Canis lupus, Alopex lagopus, and Mustela erminea are some of the species that compete with snowy owls for food. Some species may benefit by nesting near snowy owl nests. For example, greater and lesser snow geese (Chen_caerulescens) that nest near snowy owls seem to be protected from other predators.

Commensal/Parasitic Species:

  • greater and lesser snow geese (Chen_caerulescens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

People are probably the most important predator of snowy owls. Foxes and jaegers are also predators. Dogs, wolves and other large birds are probably predators of snowy owls too.

Male snowy owls protect their nest by guarding it while the female incubates the eggs and broods the young. Males and females both attack predators that come near the nest by swooping at them. They also try to distract the predator to keep it away from the nest.

Known Predators:

  • humans (Homo_sapiens)
  • foxes (Canidae)
  • jaegers (Stercorarius)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Nyctea scandiaca preys on:
Asio flammeus
Plectrophenax nivalis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Generally uncommon to scarce (Holt et al. 1999). Global population estimated at 290,000 individuals (Rich et al. 2004). Estimated number of breeding pairs in Canada in the early 1990s was 10,000-30,000 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding territory usually about 10 square km or less; may be less than 1 sq km in areas of high lemming density. Females may defend territories of 150-450 ha in winter (Johnsgard 1988). Local populations may vary ten-fold depending on lemming abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Snowy owls utilize sight, sound and touch to communicate and perceive their environment. Males “hoot” more frequently than females, and seem to use this vocalization in territorial defense and establishment. Males and females also give a variety of other calls, including a “rick, rick, rick”, a “kre kre kre”, a mewing and a hiss. These vocalizations are frequently used when the adult is disturbed near the nest.

Physical displays are frequently used to communicate. For example, males use courtship displays to attract a mate (See Mating Systems), and exaggerated posturing when threatened or when defending a territory from a neighboring male.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Snowy owls use sight, sound and touch to communicate and understand their environment. Males often “hoot” to defend their territory. They also make many other calls, including a “rick, rick, rick”, a “kre kre kre”, a mewing and a hiss. These calls are often used by an adult that is defending a nest.

Snowy owls also use physical displays to communicate. For example, males use courtship displays to attract a mate. They use certain postures to defend themselves or to defend their territory.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: During the arctic summer may hunt during the day and at night (National Geographic Society 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest known snowy owl lived at least 28 years in captivity. The oldest known wild snowy owl lived at least 9 years and 5 month.

Range lifespan

Status: wild:
28 (high) years.

Range lifespan

Status: captivity:
28 (high) years.

Average lifespan

Status: wild:
201 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known snowy owl lived at least 28 years in captivity. The oldest known wild snowy owl lived at least 9 years and 5 month.

Range lifespan

Status: wild:
28 (high) years.

Range lifespan

Status: captivity:
28 (high) years.

Average lifespan

Status: wild:
201 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28 years (captivity) Observations: Maximum lifespan in the wild is 9.4 years. One captive specimen lived at least 28 years (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Snowy owls are generally monogamous, though polygyny has been reported in a few instances when prey was excessively abundant. Breeding pairs may form on the wintering ground or after the owls reach the breeding ground in late April or early May. There is no evidence that pair bonds last beyond one breeding season.

Elaborate courtship displays are associated with breeding pair formation and early breeding activities. The male performs an “aerial display” followed by a “ground display’. The “aerial display” consists of an exaggerated undulating flight, frequently while carrying a lemming in the bill or claws, followed by a gradual climb and finally a gentle vertical descent to the ground. Once on the ground, the male performs the “ground display”. With his back toward the female, the male stands erect and then leans forward with his head lowered and tail partly fanned until he is nearly lying on the ground. Another infrequently observed display is the passing of a lemming from male to female while in flight.

Mating System: monogamous

Snowy owls usually breed between May and September. Individuals arrive on the breeding grounds beginning in late April, though breeding pairs may form earlier on the wintering grounds. The male of a pair establishes a territory, and the female selects a nest site, which is a low windswept prominence, such as a hillock, hummock or boulder. The female constructs a nest by scraping out a shallow bowl in the turf or bare ground. The nest is not lined with any insulating materials. The female then begins laying eggs at 2-day intervals. Clutch size is usually 3 to 11 white eggs, depending on prey availability, but can be as large as 16 when prey are extremely abundant. The female incubates the eggs, beginning with the first egg laid. The chicks hatch asynchronously after 32 to 34 days (average 31.6 days) of incubation. The eggs hatch approximately every other day leading to a wide range in size and age of chicks within a nest. The female broods the chicks until they abandon the nest. Both parents feed and protect the chicks, which are covered with snowy white down. The male brings food to the nest, where the female dissects it into smaller pieces to feed to the chicks. Chicks begin to leave the nest before they can fly, 14 to 26 days after hatching. The parents continue to feed them for 5 to 7 weeks until they are able to hunt for themselves.

The age of sexual maturity is not known for this species, though it is likely to me at least two years old. Adult snowy owls are able to breed annually if prey abundance allows. In years of low prey abundance, snowy owls forgo breeding. Snowy owls generally raise only one brood per breeding season. However, if a nest fails early in the breeding season, snowy owls may re-nest.

Breeding interval: Snowy owls breed once annually if sufficient prey are available.

Breeding season: Snowy owls breed between May and September.

Range eggs per season: 3 to 16.

Range time to hatching: 27 to 34 days.

Average time to hatching: 31.6 days.

Range fledging age: 14 to 26 days.

Range time to independence: 5 to 7 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 6.

Snowy owl females lay and incubate the eggs for an average of 31.6 days. After hatching, the female broods the semialtricial chicks until they leave the nest at age 14 to 25 days. Both parents defend the nest by dive-bombing potential predators that approach the nest and using distraction displays to draw the predator away from the nest. The male brings food to the nest for the chicks. The female processes the food by tearing it into smaller pieces before feeding it to the chicks. After the chicks leave the nest, both parents continue to feed and protect the chicks for 5 to 7 weeks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Parmelee, D. 1992. Snowy Owl (Nyctea scandiaca). Pp. 1-20 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 10. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs laying begins early to mid-May. Clutch size (usually 5-7) increases with prey abundance; sometimes >10. Incubation lasts 27-38 days, by female (male provides food). Young are tended by both parent, leave nest at 2-4 weeks, fly well by about 7 weeks, fed by parents after fledging. High mortality of young occurs when lemming abundance is low.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Snowy owls are monogamous (one male breeds with one female). However, sometimes two females may breed with one male if a lot of food is available. Males begin trying to attract a mate in late winter. Breeding pairs may form on the wintering ground or after the owls reach the breeding ground in late April or early May. Snowy owls probably have a different mate each year.

Males perform courtship displays to attract a female mate. The male performs an “aerial display” by carrying a lemming in his bill or talons and flying a swooping flight in front of the female. After landing on the ground, the male performs a “ground display”. He turns his back to the female and leans forward with his head lowered almost lying on the ground. The male and female may perform a display together by passing of a lemming from the male to female while flying.

Mating System: monogamous

Snowy owls usually breed between May and September. Individuals arrive on the breeding grounds beginning in late April. Males and females may form breeding pairs during the winter, or when they arrive in the spring. After arriving at the breeding grounds in the spring, the male establishes a territory. The female chooses a nest site and builds the nest. The nest is just a shallow bowl scraped out of the ground. It is usually on a high spot, such as on top of a hillock, hummock or boulder.

The female then begins laying eggs. She lays one egg every other day. Females usually 3 to 11 white eggs. They lay few eggs if there is not much food available. If there is a lot of prey available, females can lay up to 16 eggs. The female incubates the eggs. She begins incubating after the first egg is laid. The chicks hatch after 32 to 34 days (average 31.6 days). One egg hatches about every day. This means that the chicks in a nest are different ages and different sizes. The female broods the chicks until they leave the nest. Both parents feed and protect the chicks, which are covered with white down. The male brings food to the nest and the female tears it up and feeds it to the chicks. The chicks leave the nest about 14 to 26 days after they hatch. They cannot fly yet when they leave the nest. The parents continue to feed the chicks for 5 to 7 weeks until they are able to hunt for themselves.

Snowy owls probably do not begin breeding before they are at least two years old. Adult snowy owls are able to breed every year if enough food is available. However, in years when there is very little food, snowy owls do not try to breed. Snowy owls usually lay one clutch of eggs each year. However, if their eggs or chicks die early in the breeding season, a breeding pair may lay another clutch of eggs.

Breeding interval: Snowy owls breed once annually if sufficient prey are available.

Breeding season: Snowy owls breed between May and September.

Range eggs per season: 3 to 16.

Range time to hatching: 27 to 34 days.

Average time to hatching: 31.6 days.

Range fledging age: 14 to 26 days.

Range time to independence: 5 to 7 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 6.

Snowy owl females lay the eggs and incubate them for about 31.6 days. After the eggs hatch, the female broods the chicks until they leave the nest when they are 14 to 25 days old. Both parents defend the nest by dive-bombing predators or trying to distract them from the nest. The male brings food to the nest for the chicks. The female takes the food from the male and tears it up into smaller pieces to feed to the chicks. After the chicks leave the nest, both parents bring them food for 5 to 7 weeks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Parmelee, D. 1992. Snowy Owl (Nyctea scandiaca). Pp. 1-20 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 10. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubo scandiacus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTTATCAACCGATGGTTATTCTCAACCAACCACAAAGACATCGGCACCCTATACCTAATCTTCGGAGCATGAGCAGGCATAGTCGGCACCGCCCTCAGCCTACTCATCCGAGCCGAACTAGGCCAACCCGGAACCCTTCTTGGTGACGACCAGATCTACAATGTAGTTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATCGGGGCCCCAGACATAGCCTTCCCCCGCATAAACAATATAAGCTTCTGACTACTCCCACCCTCATTCCTCCTCCTACTAGCCTCCTCTACCGTAGAAGCTGGGGCAGGCACCGGATGAACCGTCTACCCCCCATTAGCTGGCAACCTAGCTCACGCCGGCGCCTCTGTAGACCTGGCCATCTTCTCCCTCCACCTAGCTGGAGTATCCTCCATCCTAGGGGCAATTAACTTTATCACTACTGCCATTAACATAAAACCCCCAGCACTATCACAATATCAAACCCCCCTATTTGTATGATCTGTCCTCATCACCGCCGTTCTCCTCCTACTATCACTCCCAGTCCTCGCCGCTGGCATCACCATGCTACTAACTGACCGCAACCTAAACACCACATTCTTCGACCCCGCCGGCGGAGGCGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTAATCCTCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bubo scandiacus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The global population of snowy owls is estimated at about 290,000 individuals, and appears to be stable. This species is classified as a species of “least concern” by the IUCN red list, and is not considered endangered or threatened in the United States. It is protected under the U.S. Migratory Bird Act and CITES Appendix II. The most common causes of mortality of snowy owls include collisions with vehicles, utility lines and airplanes, gunshot wounds, electrocution and entanglement in fishing tackle.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large holarctic distribution; populations appear to be relatively stable and not threatened.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are about 290,000 snowy owls in the world. This species is endangered or threatened in the United States, but it is protected by the U.S. government as a migratory bird. It is also protected globally under CITES Appendix II. The most common causes of death of snowy owls are crashes with vehicles, utility lines and airplanes, gunshot wounds, electrocution and entanglement in fishing line.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.300,000 individuals (Rich et al. 2004), while the population in Russia has been estimated at c.100-10,000 breeding pairs (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Global population trends have not been quantified, but populations appear stable (Holt et al. 1999). No evidence of a decline in Canada (Kirk 1995) or North America (but no definitive data exists) (Holt et al. 1999). The species is believed to have decreased in Europe, perhaps because of human hunting combined with long-term climate changes (Voous 1988, Johnsgard 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Native harvest may affect local populations but probably does not have the potential for wide-scale impact (Parmelee 1992). However, Ellis and Smith (1993) estimated that trappers in Siberia annually took 100,000 snowy owls.

Dependence upon lemming population ecology, which may be impacted by global climate change, is of concern; Kerr and Packer (1998) predicted that the collared lemming (Dicrostonyx groenlandicus), a keystone species, will lose approximately 60 percent of its habitat in Canada due to global warming. Low lemming abundance could result in high mortality of young owls due to starvation.

Natural enemies are few; arctic fox and wolf prey on adults; skuas and jaegers take eggs and chicks. Many apparently die from starvation during movement southward from the arctic, but collisions with automobiles, utility lines, airplanes, gunshot wounds, and entanglement in fishing tackle are responsible for the majority of reported fatalities (Kerlinger and Lein 1988 in Petersen and Holt 1999, Holt et al. 1999). Exposure also kills many nestlings (up to 3 or 4 chicks per clutch) (Karalus 1987).

Kirk (1995) reports no imminent obvious threats in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Impact of harvest by Siberian hunters needs to be evaluated. Migration routes and timing of movements need study. Cooperation is needed between United States, Canadian, Russian and European biologists to estimate abundance, distribution and population trends (ADFG 2005). Lemming population dynamics relative to environmental/climate change warrant study. Changes in arctic habitats and winter sea ice conditions relative to Snowy Owl distribution along the Arctic Ocean should be studied.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Snowy owls have been known to raid traplines set out by trappers. Over time they have learned to follow these traplines regularly, costing trappers game animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Snowy owls play a part in controlling populations of lemmings and other rodents. However, given their arctic distribution, this has little economic effect on humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Some snowy owls learn to raid traplines set out by trappers. If the snowy owls eat the animals that are caught in the traps, the trappers lose money and food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Snowy owls help to control populations of lemmings and other rodents. However, because few humans live in the arctic where snowy owls live, most people are not affected by them.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Snowy owl

The snowy owl (Bubo scandiacus) is a large owl of the typical owl family Strigidae.

Taxonomy[edit]

The snowy owl was one of the many bird species originally described by Linnaeus in the landmark 1758 10th edition of his Systema Naturae, where it was given the binomial name of Strix nyctea.[2] Until recently, it was regarded as the sole member of a distinct genus, as 'Nyctea scandiaca, but mtDNA cytochrome b sequence data (Olsen et al. 2002) shows that it is very closely related to the horned owls in the genus Bubo. However, some authorities debate this classification, still preferring Nyctea.[3] The snowy owl is the official bird of the Canadian province of Quebec. It is also widely sought after by birdwatchers and nature-enthusiasts alike.

Description[edit]

Plate 121 of the Birds of America by John James Audubon, depicting the snowy owl

This yellow-eyed, black-beaked white bird is easily recognizable. It is 52–71 cm (20–28 in) long, with a 125–150 cm (49–59 in) wingspan. Also, these owls can weigh anywhere from 1.6 to 3 kg (3.5 to 6.6 lb).[4] It is one of the largest species of owl and, in North America, is on average the heaviest owl species. The adult male is virtually pure white, but females and young birds have some dark scalloping; the young are heavily barred, and dark spotting may even predominate. Its thick plumage, heavily feathered taloned feet, and colouration render the snowy owl well-adapted for life north of the Arctic Circle.

Snowy owl calls are varied, but the alarm call is a barking, almost quacking krek-krek; the female also has a softer mewling pyee-pyee or prek-prek. The song is a deep repeated gahw. They may also clap their beak in response to threats or annoyances. While called clapping, it is believed this sound may actually be a clicking of the tongue, not the beak.

Ecology[edit]

Young owl on the tundra at Barrow Alaska. Snowy owls lose their black feathers with age, though particular females retain some.

The snowy owl is typically found in the northern circumpolar region, where it makes its summer home north of latitude 60º north. However, it is a particularly nomadic bird, and because population fluctuations in its prey species can force it to relocate, it has been known to breed at more southerly latitudes. During the last glacial, there was a Central Europe Bubo scandiacus gallicus, but no modern subspecies are recognized.

This species of owl nests on the ground, building a scrape on top of a mound or boulder. A site with good visibility is chosen, such as the top of a mound with ready access to hunting areas and a lack of snow. Gravel bars and abandoned eagle nests may be used. The female scrapes a small hollow before laying the eggs. Breeding occurs in May to June, and depending on the amount of prey available, clutch sizes range from 3 to 11 eggs, which are laid singly, approximately every other day over the course of several days. Hatching takes place approximately five weeks after laying, and the pure white young are cared for by both parents. Although the young hatch asynchronously, with the largest in the brood sometimes 10 to 15 times as heavy as the smallest, there is little sibling conflict and no evidence of siblicide. Both the male and the female defend the nest and their young from predators, sometimes by distraction displays. Males may mate with two females which may nest about a kilometre apart.[5] Some individuals stay on the breeding grounds while others migrate.

Range[edit]

Snowy owls nest in the Arctic tundra of the northernmost stretches of Alaska, Canada, and Eurasia. They winter south through Canada and northern Eurasia, with irruptions occurring further south in some years. Snowy owls are attracted to open areas like coastal dunes and prairies that appear somewhat similar to tundra. They have been reported as far south as the American states of Texas, Georgia, the American Gulf states, southernmost Russia, and northern China. In the Late Pleistocene the range expanded southward to Bulgaria (80,000-16,000 years, Kozarnika Cave, W Bulgaria).[6]

In February 1886, a snowy owl landed on the rigging of the Nova Scotia steamship Ulunda on the edge of the Grand Banks, over 600 kilometres from the nearest land. It was captured and later preserved at the Nova Scotia Museum.[7]

Between 1967 and 1975, snowy owls bred on the remote island of Fetlar in the Shetland Isles north of Scotland. Females summered as recently as 1993, but their status in the British Isles is now that of a rare winter visitor to Shetland, the Outer Hebrides and the Cairngorms.[8]

In January 2009, a snowy owl appeared in Spring Hill, Tennessee, the first reported sighting in the state since 1987.[9] Also notable is the mass southern migration in the winter of 2011/2012, when thousands of snowy owls were spotted in various locations across the United States.[10] This was then followed by an even larger mass southern migration in 2013/2014 with the first snowy owls seen in Florida for decades.[11][12]

Hunting and diet[edit]

Snowy owl carries its kill, an American Black Duck, in "the pool" in Biddeford Pool, ME. (Low Tide)

This powerful bird relies primarily on lemmings and other small rodents for food during the breeding season, but at times of low prey density, or during the ptarmigan nesting period, they may switch to favoring juvenile ptarmigan. They are opportunistic hunters and prey species may vary considerably, especially in winter. They feed on a wide variety of small mammals such as meadow voles and deer mice, but will take advantage of larger prey, frequently following traplines to find food. Some of the larger mammal prey includes hares, muskrats, marmots, squirrels, rabbits, raccoons, prairie dogs, rats, moles, smaller birds, entrapped furbearers. Birds preyed upon include ptarmigan, other ducks, geese, shorebirds, pheasants, grouse, coots, grebes, gulls, songbirds, and even other raptors, including other owl species. Most of the owls' hunting is done in the "sit and wait" style; prey may be captured on the ground or in the air, or fish may be snatched off the surface of bodies of water using their sharp talons. Each bird must capture roughly 7 to 12 mice per day to meet its food requirement and can eat more than 1,600 lemmings per year.

Snowy owls, like many other birds, swallow their small prey whole. Strong stomach juices digest the flesh, while the indigestible bones, teeth, fur, and feathers are compacted into oval pellets that the bird regurgitates 18 to 24 hours after feeding. Regurgitation often takes place at regular perches, where dozens of pellets may be found. Biologists frequently examine these pellets to determine the quantity and types of prey the birds have eaten. When large prey are eaten in small pieces, pellets will not be produced.[13]

Natural threats[edit]

Though snowy owls have few predators, the adults are very watchful and are equipped to defend against any kind of threat towards them or their offspring. During the nesting season, the owls regularly defend their nests against arctic foxes, corvids and swift-flying jaegers; as well as dogs, gray wolves and avian predators. Males defend the nest by standing guard nearby while the female incubates the eggs and broods the young. Both sexes attack approaching predators, dive-bombing them and engaging in distraction displays to draw the predator away from a nest.

They also compete directly for lemmings and other prey with several predators, including rough-legged hawks, golden eagles, peregrine falcons, gyrfalcons, jaegers, glaucous gulls, short-eared owls, great horned owls, Eurasian eagle owls, common ravens, wolves, arctic foxes, and ermine. They are normally dominant over other raptors although may (sometimes fatally) lose in conflicts to large raptors such as other Bubo owls, golden eagles and the smaller but much faster peregrine falcons. Some species nesting near snowy owl nests, such as the snow goose, seem to benefit from the incidental protection of snowy owls that drive competing predators out of the area.[14]

References[edit]

  1. ^ BirdLife International (2012). "Bubo scandiaca". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, Carl (1758). Systema Naturae per Regna Tria Naturae, Secundum Classes, Ordines, Genera, Species, cum Characteribus, Differentiis, Synonymis, Locis. Tomus I. Editio decima, reformata (in Latin). Holmiae: (Laurentii Salvii). p. 93. 
  3. ^ Potapov, Eugene and Sale, Richard (2013). The Snowy Owl. T&APoyser. ISBN 978-0713688177. 
  4. ^ Snowy Owl, Snowy Owl Profile, Facts, Information, Photos, Pictures, Sounds, Habitats, Reports, News – National Geographic
  5. ^ Watson, Adam (1957). "The behaviour, breeding and food-ecology of the Snowy Owl Nycea scandiaca". Ibis 99 (3): 419–462. doi:10.1111/j.1474-919X.1957.tb01959.x. 
  6. ^ Boev, Z. 1998. First fossil record of the Snowy Owl Nyctea scandiaca (Linnaeus, 1758) (Aves: Strigidae) from Bulgaria. - Historia naturalis bulgarica, 9: 79-86.
  7. ^ Conlin, Dan (2 October 2013) "An Owl Oddity", Maritime Museum of the Atlantic
  8. ^ "Hope of first owl chicks in years", BBC News. 13 May 2008.
  9. ^ "Snowy Owl appears in Middle Tenn." The Tennessean. 21 January 2009.[dead link]
  10. ^ Zuckerman, Laura (28 January 2012) Snowy owls soar south from Arctic in rare mass migration. Reuters
  11. ^ Leung, Marlene Leung. "Snowy owl invasion: Birds spotted as far south as Florida". CTV News. Retrieved 12 January 2014. 
  12. ^ Schwartz, John. "SInflux of Snowy Owls Thrills and Baffles Birders". New York Times. Retrieved 31 January 2014. 
  13. ^ Snowy Owl — Bubo scandiacus, formerly Nyctea scandiaca. owlpages.com
  14. ^ ADW: Nyctea scandiaca: Information. Animaldiversity.ummz.umich.edu. Retrieved on 19 October 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Former treatment of this species in the monotypic genus Nyctea was based on distinct plummage and weak osteological differences (Ford 1967). Genetic studies, however, indicate that it is closely related to Bubo (Sibley and Ahlquist 1990) and in fact is nested within the genus (Wink and Heidrich 1999). The specific name is an adjective and changes to agree with the gender of the generic name.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!