Articles on this page are available in 1 other language: Spanish (4) (learn more)

Overview

Distribution

Range Description

This species occurs in the humid lowlands from southwestern Costa Rica to eastern Panama on the Pacific slope, and on the Atlantic versant in central Panama, to northern Colombia and the middle Magdalena Valley. Its range is expanding in Costa Rica. It ranges from sea level up to 500m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Costa Rica, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  Medium sized treefrog. Males to 45 mm; females to 62 mm. Males have a paired vocal sac.

Dorsal

Dorsal surface tuberculate and is gray, tan or reddish brown in coloration. Darker blotches and markings may be present, as well as white or green flecks.

Concealed surfaces

Posterior surface of the thigh is brownish with blue spots. Groin has similar blue spots, while the lateral surface posterior to the arm has yellow spots.

Distinguishing characteristics

Snout very short and truncated in appearance.

Eye

Iris brown with black reticulations.

Extremities

Hand and feet moderately webbed. Toes with large terminal pads.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a nocturnal tree frog that inhabits lowland moist and wet forests close to shallow rocky pools, and stream banks. It can survive in secondary forest, but it generally needs good vegetation cover. In Costa Rica, it has been observed in relatively open areas (Federico Bolaños pers. comm.). It is less frequently found in the vegetation overhanging the streams. Benthic tadpoles are found in clear pools and slow-moving water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland rainforest to 970 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Diet

Diet

Tadpoles are scrapers and chewers, mostly eating algae from the surface of rocks and submerged plant matter in stream pools (Heyer 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Adult Smilisca sila are depredated by bats (Trachops cirrhosus; Tuttle and Ryan 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A low squawk, usually followed by one or more rattling secondary notes (Ibanez 1991). Males also produce aggressive calls (Ibanez 1991).

Behavior and communication

Smilisca sila change calling behavior in response to availability of light in the environment (Tuttle and Ryan 1982, Nunes 1988). Frogs call more and produce more complex calls on moonlit nights, and are also less likely to call from concealed sites, such as under leaves (Nunes 1988). Tuttle and Ryan (1982) suggested than moonlight allows the frogs to detect and avoid bat predation. Males also prefer to call near waterfalls (Tuttle and Ryan 1982). The frequency of waterfall noise completely overlaps with that of the calls of S. sila, thus potentially further hindering detection by bats (Tuttle and Ryan 1982). Finally, frogs synchronize calling (Tuttle and Ryan 1982, Ibanez 1991), which lessens chances of bat predation because bats are less likely to respond to synchronized calls (Tuttle and Ryan 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Breeding season

Breeding occurs during the dry season (Heyer 1976). Males call from the edges of forest streams (Nunes 1988). During amplexus, females construct shallow open depressions in which to lay their eggs (Malone 2004).

Egg

Small, black eggs float on surface of water (Malone 2004).

Tadpole

Although they breed in streams, tadpoles of S. sila are adapted to life in quiet pools (Heyer 1976). Bodies are fat and tails are less muscular with high tail fins, unlike more typical stream-dwelling species (Heyer 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

Smilisca sila has a much shorter latency to response to calls of other males than many of species of frogs thus studied (Ryan 1986). Ryan (1986) suggested that use of a different neural pathway decoupling call detection and call recognition may contribute to call overlap in this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Smilisca sila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGTATTCGGCGCATGAGCTGGCATAGTCGGTACCGCCTTAAGTCTGCTCATCCGAGCAGAACTGAGCCAGCCCGGCTCCCTCTTAGGTGATGATCAAATTTATAATGTGATCGTTACAGCCCATGCTTTTGTTATAATTTTTTTTATAGTAATGCCCATCTTAATCGGGGGCTTTGGAAACTGACTAGTCCCTCTAATAATCGGGGCCCCTGACATAGCTTTTCCCCGAATAAACAATATAAGTTTTTGACTCCTGCCCCCATCCTTTCTCTTATTGCTGGCCTCAGCAGGAGTAGAGGCCGGAGCCGGAACCGGATGAACAGTTTACCCCCCACTAGCTGGCAATCTAGCTCATGCAGGACCATCTGTTGACCTTACCATCTTCTCTCTTCATCTAGCCGGAGTCTCTTCAATTCTTGGGGCCATTAATTTTATTACCACTATTCTTAATATAAAACCCCCATCAATAACACAATATCAAACCCCCCTATTTGTTTGATCAGTTCTCATTACTGCTGTTCTTCTTCTTCTGTCACTACCTGTTCTAGCAGCAGGCATCACTATACTCTTGACCGACCGTAACATTAATACCACATTTTTTGACCCCAGCGGAGGTGGTGACCCTGTTCTCTATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Smilisca sila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bolívar, W., Renjifo, J., Jungfer, K., Solís, F., Ibáñez, R., Chaves, G., Savage, J., Jaramillo, C., Fuenmayor, Q. & Bolaños, F.

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a common species in Panama and Colombia. In Costa Rica it is rare, despite its expanding range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats are likely to be deforestation for agricultural development, illegal crops, logging, and human settlement, and pollution resulting from the spraying of illegal crops.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It has been recorded from many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Panama cross-banded tree frog

The Panama cross-banded tree frog, Smilisca sila, is a species of frog in the Hylidae family found in Colombia, Costa Rica, and Panama. Its natural habitats are subtropical or tropical moist lowland forests, rivers, and freshwater marshes. It is threatened by habitat loss.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!