Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Eurasian beavers, Castor fiber, once heavily populated all of Europe and Asia. However due to overhunting for fur and castoreum, a chemical from their castor sacs, and habitat loss, populations fell nearly to extinction. By the 19th century most countries in Europe and Asia had no remaining beavers. By the 20th century an estimated 1300 beavers remained in the wild. Management efforts and reintroductions have resulted in Eurasian beaver population increases. Populations are now established in France, Germany, Poland, southern Scandinavia, and central Russia. However, populations are small and scattered throughout this area.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Eurasian beaver Castor fiber was once widespread in Europe and Asia. However, by the beginning of the 20th century, over-hunting had drastically reduced both the numbers and range of the species. In Europe, only a few isolated sites remained: parts of the Rhone (France) and Elbe (Germany), southern Norway, the Neman River and Dnepr Basin (Belarus) and Voronezh (Russia). A series of management measures and reintroductions have enabled the beaver to return to much of its former range, and there are now a number of rapidly expanding populations extending from Spain and France across central and eastern Europe to European Russia, and in Scandinavia and parts of western Finland.

Free-living populations of beavers are now established or establishing in most regions of their former European range, the main exceptions to date being Portugal, Italy, the south Balkans and Great Britain (Halley and Rosell 2002, Ceña et al. 2004). Detailed information on the status and distribution of the Eurasian beaver in each range state can be found in Halley and Rosell (2002), and information on the population that was translocated to Spain in 2003 can be found in Ceña et al. (2004). It is generally a lowland species, but occurs up to 850 m in Europe (Halley pers. comm. 2006).

In Mongolia, a small population exists along the Bulgan River in northern Dzungarian Govi Desert, in the south-western corner of Mongolia. Mongolian-German Biological Expeditions carried out conservation introductions along Hovd River in Mongol Altai Mountain Range in 1974, 1975, and 1978, and along Tes River in northern Hangai Mountain Range in 1985, 1988 and 2002. In all cases Mongolian beavers from the Bulgan River were used in order to protect the gene pool in the central Asiatic hydro-geographic basin (Stubbe and Dawaa, 1982; Stubbe et al., 2005a). A separate attempt to reintroduce beavers from Voronezh Reserve (Russian Federation) was unsuccessful (M. Stubbe pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eurasian beavers weigh from 13 to 35 kg and are 73 to 135 cm in length. Eurasian beavers have two layers of fur, the first is a soft dense undercoat that is dark grayish in color. The outer layer is longer, stiff reddish brown hairs called guard hairs. Fur color tends to be darker in northern populations. Eurasian beavers have two castoreum glands located next to the cloacal opening. These glands produce a pungent, sweet smelling chemical called castoreum and is used to mark territories. The muzzle is blunt, ears are small, and the legs are short. Both ears and nostrils are valvular and the eyes have nictitating membranes, closing when they go under water. The tail is naked and black with scales. The tail is broad, oval, and flattened horizontally. The feet are dark brown to black and each have 5 digits. The rear feet are webbed and the inside two toes have a split nail used for grooming. The tail is narrower and the skull smaller than those of North American beavers, Castor canadensis. Inside the mouth, beavers have a skin fold that allows them to gnaw on branches under water without getting water in their mouths. They have two, large incisor teeth with hard, orange-colored enamel on the anterior surface. Sexes are alike, although females may tend to be larger.

Range mass: 13 to 35 kg.

Range length: 73 to 135 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Eurasian beavers are semi-aquatic and inhabit freshwater systems, including lakes, ponds, rivers, and streams, usually in forested areas but also in marshes and swamps. Permanent access to water is necessary and preferred tree species for C. fiber are willows, aspen, birch, and alder. Beavers prefer slow-moving or still, deep water and will alter habitat if necessary to create these conditions. Water quality is not as important as water access, food availability, and depth of water.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Beavers are adapted for a semi-aquatic life, using a variety of freshwater systems, including rivers, streams, irrigation ditches, lakes, and swamps. They generally prefer freshwater habitats surrounded by woodland, but may occur in agricultural land or even suburban and urban areas (Tattersall 1999, Halley and Rosell 2002). In northern Scandinavia, beavers may be found right up to the limit of the willow zone in the mountains, where knee-high willow bushes are the only woody vegetation and it is iced over for 8 months of the year. This is not preferred habitat, but they can survive there. In many places, beavers live both on the valley floor, and on the mountain plateau above (where it is wooded), with a break in distribution where streams flow down the steep valley sides. In general beavers should be able to live in almost any freshwater habitat where there are trees or shrubs and the gradient is not precipitous. However, patterns of recolonisation demonstrate a clear preference for still or slow, laminar water flow if it is available (Nowak 1999, Halley and Rosell 2002, Halley pers. comm. 2006).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eurasian beavers are herbivores, feeding primarily on woody vegetation in the winter months. Eurasian beavers prefer willow, aspen, and birch trees with diameters less than 10 cm. These food items are stored in the water during the fall months in large quantities. These food caches need to be large enough to last the entire colony until the ice melts in the spring of the year. During summer months beavers feed heavily on aquatic vegetation, shoots, twigs, bark, leaves, buds, and roots. In agricultural areas beavers will consume crops as well. Beavers prefer herbaceous plant foods over woody vegetation when it is available. Beavers do not have cellulases, an enzyme used to break down cellulose. However beavers are coprophagous, taking up caecal microbes during reingestion which help break down cellulose that can be absorbed after reingestion.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; fruit; flowers

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore , Lignivore); coprophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eurasian beavers have the ability to impact ecosystems tremendously. Through the process of building dams they alter the flow of the water and flood many acres of former uplands. Dams build up sediments and debris which increase carbon and decrease available nitrogen and acidity. This changes the invertebrate community from running water invertebrates to still water invertebrates. This new water source attracts new species of birds, fish, and amphibians by providing a suitable water table. Eurasian beavers maintain certain woody vegetation in the sapling stages for extended periods of time through their browsing activities. Flooded timber will die off in a year and soon a once forested ecosystem becomes an open water ecosystem. Eurasian beavers can also alter, in time, the stand structure around the waters edge. They do this through their food selection, making conditions favorable for unselected food items. Eurasian beavers start with a small stream and build a dam, flooding a forested area. Once the beavers use up available resources, they move on and abandon the pond. Succession in the pond leads to the development of marsh habitat and then meadow. The decrease in nitrogen and acidity along with the increase in carbon hinders the growth of woody vegetation for some time but eventually woody vegetation begins to grow forest is regenerated.

Eurasian beavers are hosts to mites, with up to 33 different species of mites that could be living on them at anytime.

Ecosystem Impact: creates habitat; keystone species

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lodges and burrows in the bank make beavers mostly inaccessible to predators. By far the most successful predators of Eurasian beavers are humans. Eurasian beavers were hunted and trapped nearly to extinction for their prized pelts and castoreum. Today, with conservation efforts in place, Eurasian beavers are protected by law. Poaching, entanglement in nets, and road accidents are the leading causes of death. Natural predators are wolves, brown bear, and red foxes. The leading cause of death in C. fiber today is infectious disease. Eurasian beavers use a “tail slap” when they are frightened, which is a warning to all other beavers that something is near. Beavers slap the water surface with the tail as they dive under water and out of harms way. In response, all beavers in the area will do the same. Eurasian beavers will also avoid food items that have the odors of predators on them.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eurasian beavers communicate mainly through chemical communication. Not only do they use castoreum to mark territory, but they also use their oil glands to distinguish between males and females. Eurasian beavers also use postures, tail slapping, and vocalizations. Vocalizations include whining calls, whistling, and hissing. Tail slapping is used when they are frightened or upset.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eurasian beavers can live 10 to 17 years of age but rarely live longer than 7 to 8 years in the wild. In captivity, some sources suggest that beavers can live up to 35 years and are expected to reach 24 years of age. However, these ages are unconfirmed. A confirmed record of longevity in captivity in Castor fiber was 13.7 years old.

Range lifespan

Status: wild:
10 to 17 years.

Range lifespan

Status: captivity:
13.7 (high) years.

Typical lifespan

Status: wild:
7 to 8 years.

Average lifespan

Status: captivity:
25.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: It has been suggested that beavers may live as much as 50 years (Ronald Nowak 1999), which is doubtful. Although the maximum longevity of this species cannot be correctly estimated, one specimen lived 13.7 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eurasian beavers are monogamous and only one adult pair breeds per colony. Females come into estrus between January and February, but sometimes warm winter weather can result in a breeding season as early as December. Copulation takes place in the water most of the time but, in some cases, takes place in the lodge. The male will approach a female floating in the water from the side, copulation may last anywhere from 30 seconds to 3 minutes. Most copulations occur at night. If a mature female is not impregnated the first time she will come into estrus 2 to 4 times again throughout the season. Family members cooperate to care for the young of the primary pair.

Mating System: monogamous ; cooperative breeder

Eurasian beavers breed yearly in the spring between January and February. The gestation period is 60 to 128 days and they can have up to 6 or more young, but 1 to 3 is more common. Newborn weight is 230 to 630 g. The young are usually weaned by 6 weeks old. During that time the female takes care of the young, cleaning and feeding them. After the young are weaned, sub-adults in the colony help feed them by bringing small twigs and soft bark to them until they are about 3 months old. At 1.5 to 2 years old young beavers disperse, often being forced out by the adult female.

Breeding interval: Eurasian beaver pairs breed once yearly.

Breeding season: Eurasian beavers can breed from January to Febuary.

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Range gestation period: 60 to 128 days.

Average weaning age: 6 weeks.

Range time to independence: 1.5 to 2 years.

Range age at sexual or reproductive maturity (female): 1.5 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 1.5 to 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 530 g.

Average number of offspring: 3.

Eurasian beavers live is small family groups consisting of one breeding adult female and male, young of the year, yearlings, and sub-adults. After young are weaned, sub-adults help with raising the young. The young are skittish outside the lodge and are never far from an adult. After dispersal at 1.5 to 2 years of age they become sub-adults at another colony until they are ready to breed and start their own colony.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); extended period of juvenile learning

  • Muller-Schwarze, D., L. Sun. 2003. The Beaver: Natural History of a Wetlands Engineer. Ithaca and London: Cornell University Press.
  • Long, J. 2003. Introduced Mammals of the World: Their History, Distribution, and Influence. United Kingdom: CABI Publishing.
  • Nowak, R. 1999. Walker's Mammals of the World. Sixth Edition. Baltimore: The Johns Hopkins University Press.
  • Ducroz, J., M. Stubbe, A. Saveljev, D. Heidecke, R. Samjaa, A. Ulevicius, A. Stubbe, W. Durka. 2005. Genetic variation and population structure of the eurasian beaver Castor fiber in eastern europe and Asia. Journal of Mammology, 86/6: 1059-1067.
  • Nolet, B. 2000. "Management of the Beaver (Castor fiber): Towards restoration of it's former distribution and ecological funtion in Europe" (On-line pdf). Accessed August 09, 2009 at http://books.google.com/books?id=JDHuVsOfbakC&pg=PA5&dq=Castor+fiber&lr=#v=onepage&q=&f=false.
  • Rue, L. 2002. Beavers. Stillwater, Minnesota: Voyageur Press. Accessed August 09, 2009 at http://books.google.com/books?id=VMk92ARQajEC&pg=PA9&dq=Castor+fiber+predation&lr=#v=onepage&q=&f=false.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Castor fiber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTTAACCGTTGACTATTCTCAACAAACCACAAAGACATCGGCACCCTGTACTTAATATTTGGGGCCTGGGCAGGAATAGTAGGAACCGCTTTAAGCTTGCTAATTCGCGCAGAACTAGGACAACCGGGAACCCTATTAGGAGACGACCAGATCTATAACGTCATTGTTACAGCCCACGCGTTCGTAATAATCTTCTTCATGGTAATACCAATCCTTATTGGGGGCTTTGGTAATTGATTAGTGCCTTTAATAATCGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCCTTTCTCCTTCTACTAGCCTCCTCAATAGTGGAAGCCGGAGCAGGGACTGGATGAACTGTATATCCCCCATTGGCGGGTAATCTAGCCCATGCAGGGGCATCAGTGGACCTCACCATCTTCTCACTCCACTTGGCTGGTGTGTCCTCAATCCTCGGTGCCATCAACTTTATCACAACAATCATTAACATAAAACCCCCTGCAATATCACAATACCAAACACCACTATTTGTATGATCCGTCCTAGTTACTGCAGTCCTTTTATTACTCTCCCTCCCCGTACTAGCCGCCGGAATTACAATACTCTTAACTGACCGAAACCTAAACACTACCTTCTTTGACCCCGCAGGAGGAGGGGACCCAATCCTCTATCAACACTTATTCTGATTTTTTGGACATCCCGAAGTATACATCCTAATCCTACCAGGCTTTGGCATAATCTCCCACATCGTTACTTACTATTCTGGCAAAAAAGAACCATTCGGGTATATGGGAATAGTATGGGCTATAATGTCTATTGGCTTCTTAGGCTTCATCGTATGGGCACACCACATATTCACGGTTGGAATAGACGTTGACACACGAGCCTACTTTACATCCGCTACCATAATCATCGCCATCCCTACGGGAGTAAAAGTTTTCAGCTGACTAGCCACACTCCATGGAGGCAATATTAAATGATCCCCAGCCCTGCTCTGAGCCCTAGGATTTATTTTCCTTTTCACAGTGGGTGGTCTAACAGGCATCGTCCTATCCAACTCATCCCTAGATATCGTACTACACGACACATACTACGTAGTAGCCCATTTTCACTACGTTCTATCAATAGGAGCAGTATTCGCAATTATAGGAGGATTTGTACACTGATTTCCACTATTCTCAGGCTACACACTAGACCAAACATGAGCAAAAATCCACTTTACTATTATATTCGTGGGAGTAAACTTAACCTTCTTTCCCCAACACTTCCTTGGCCTATCCGGTATACCACGACGCTATTCTGATTACCCAGATGCCTACACAGCATGAAACACAGTTTCATCAGTAGGCTCCTTTATCTCCCTAACTGCAGTAATCATTATAGTCTTCATAGTTTGAGAAGCATTCGCCTCTAAGCGGGAAGTAGGAGTAGTCGAACTTACAACAACAAACCTAGAATGACTCCACGGATGCCCGCCACCATATCACACATTTGAAGAACCTACATACGTAAAAACACACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Castor fiber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The IUCN redlist considers Eurasian beavers a species of least concern with increasing populations and sufficient protection, although Asian populations remain small and relatively unprotected. Populations throughout their former range have not returned to their previous numbers. Mongolian beavers (Castor fiber birulai) are considered endangered by the U.S. Fish and Wildlife Service.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Batbold, J., Batsaikhan, N., Shar, S., Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Palomo, L.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
The Eurasian beaver has shown good recovery across much of its range, as a result of conservation programmes. The highest numbers are found within Europe. Conservation measures are ongoing to prevent the population declining again and as long as these continue, there is no reason to continue to assess the species as threatened or Near Threatened. Now Least Concern. However, the Asian populations remain very small and under serious threat, and these populations urgently need conservation measures.

History
  • 2002
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
By the beginning of the 20th century, the global population had been reduced to eight populations, totalling approximately 1,200 individuals (Halley and Rosell 2002). Protection (beginning with a hunting ban implemented in Norway in 1845), natural spread and reintroductions have resulted in a rapid recovery in numbers and range, particularly in Europe. In 1998, the global population was estimated at 430,000 (Nolet and Rosell 1998), by 2002 it had reached at least 593,000 (Halley and Rosell 2002), and in 2006 the minimum estimate was 639,000 (D. Halley pers. comm. 2006). This is almost certainly a considerable underestimate, as both population and range are in rapid expansion (Halley and Rosell 2002, 2003; D. Halley pers. comm. 2006). Considerable further expansion in range and population, especially in western Europe and the lower Danube basin, can be expected. If current trends continue, the Eurasian beaver will be a fairly common mammal in much of Europe within the next few decades.

However, populations in Asia are still considered small. In Mongolia, reintroductions have been successful and the population has reached 150, and in China the population is about 700 (Halley and Rosell 2002, EMA Workshop 2006, Smith and Xie in press).

In Mongolia in 1964, the population size was estimated to consist of 100-150 individuals (Stubbe and Chotolchu, 1968), rising to 200 individuals by 1973 (Zevegmid and Dawaa, 1973). In 1991, surveys estimated there to be approximately 300 individuals along Bulgan and Hovd rivers (Stubbe et al., 1991). The most recent population assessment was conducted in 2004, which recorded 40 lodges along Hovd River and estimated the population to consist of 130-150 individuals (Shar, 2005). Ten beaver settlements were recorded in the Tuvan section of Tes River in 2005 (A. Saveljev pers. comm.), and the Mongolian section of this river is believed to contain a similar beaver population (M. Stubbe pers. comm.).

The Chinese subspecies of the Eurasian Beaver (C. f. birulai) is one of the rarest and least known aquatic mammals in China. In the 1970s it was believed that only 100 animals remained in fewer than 20 family groups. Currently, only one substantial population is known, at the Buergan River Beaver Reserve along the Xinjiang-Mongolian border - a narrow strip 50 km long and only 500 m wide. Here the population is estimated to be only 500 animals, and only 700 may live in all of China.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The beaver's historic decline was caused by over-hunting for fur, meat and castoreum (a secretion from the scent glands), combined with loss of wetland habitats. Beaver populations were severely reduced in most countries by mediæval times, but the species clung on in marshes and other inaccessible places until the advent of efficient steel traps and accurate firearms in the 17th century; and then through to the 19th century there was a rash of final extinctions for these reasons combined with drainage of many of the large marshland areas in which the species clung on (all of the European refugia where the species survived, except in Norway, are extensive marshlands).

Today, beaver populations in Europe are expanding rapidly, and there are no major threats (e.g. threats of a magnitude likely to cause decline at the regional level). Competitive exclusion of the native European beaver C. fiber by its American cousin C. canadensis may be a threat in parts of Finland and north-west Russia, but it is not a major threat regionally. In Europe North American beavers are now confined entirely to Finland and north-west Russia, where populations are increasing only slowly (due to heavy harvesting). The former population at a reservoir near Paris has been removed, and populations introduced to Poland and Austria have apparently gone extinct in competition with C. fiber, the opposite of what has tended to happen in Finland and north-west Russia (it has been suggested that, due to differences in the life history of the two species, Eurasian beavers may have a competitive advantage at more southerly latitudes, whilst North American beavers may be more successful further north: D. Halley pers. comm. 2006). There are no serious prospects of further introductions (Halley and Rosell 2002, D. Halley pers. comm. 2006). The two species do not interbreed (Tattersall 1999). Road kill is an important source of mortality for some populations (Tattersall 1999). Rapidly expanding beaver populations may come into conflict with humans in some areas, as they do some damage to forestry and crops. Such damages should be put into perspective: they tend to be less severe than those caused by other species such as deer and voles, but are noticed because beavers are a new and unfamiliar species in areas where they have been recently introduced (Halley and Rosell 2002).

In Mongolia, illegal hunting for skins, meat and castoreum still occurs in some areas such as the Tes River. Habitat loss through selective clear-cutting of willow, upon which this species relies for food and shelter is also a threat; this is known to be occurring along the Bulgan River and is leading to isolation of small populations and inbreeding. Pollution of water systems is also a threat. A hydroelectric dam in the Chinese section of the Bulgan River prevents migrations in this area (M. Stubbe pers. comm.).

In China, firewood gathering has depleted much of the forest on which the beavers need to subsist; additionally heavy grazing pressure has further reduced vegetation needed by beavers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
A number of conservation measures have contributed to the species' recovery in Europe, including reintroductions and translocations, hunting restrictions, and habitat protection. It is listed under the Bern Convention (Appendix III) and the EU Habitats and Species Directive (Annex V for the Swedish and Finnish populations, Annex II and IV for all others). In Finland, C. canadensis populations are controlled to prevent them spreading into the west where C. fiber occurs. Halley and Rosell (2002) recommend regulated hunting as the optimal management regime in managed landscapes with healthy beaver populations. Management of beaver populations should be at the watershed scale, except where large human-made dams form significant barriers to spread. Early provision of interpretation and public viewing opportunities is also recommended, as this provides a benefit to the local economy through wildlife tourism, and helps foster positive attitudes to beavers (Halley and Rosell 2002). This has been a successful feature of several recent reintroductions. Reintroduction to Italy has been recommended in a European Union/Bern Convention Nature and Environment Series document (Nolet 1996). Considerable efforts have been made to develop a beaver reintroduction programme in Scotland, and a full public consultation showed strong support for such a scheme among the general public, including in rural areas where beavers were likely to be released (Halley and Rosell 2002).

In Mongolia, C. f. birulai is protected as Very Rare under part 7.1 of the Law of the Mongolian Animal Kingdom (2000), and is included as Rare in both the 1987 and 1997 Mongolian Red Books (Shagdarsuren et al., 1987; MNE, 1997). This subspecies is also listed as Very Rare under the 1995 Mongolian Hunting Law (MNE, 1996). Approximately 11% of the species’ range in Mongolia occurs within protected areas.

Conservation measures in place in Mongolia:
1) Bulgan Gol Nature Reserve was established along the Bulgan River in 1965 to conserve this species.
2) Many translocations and conservation introductions have taken place over the past 50 years to enhance the Mongolian population.

The species is considered Endangered (EN A1bcd) in the Chinese Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Eurasian beavers can be destructive when they cut down trees and flood areas. They may be removed for nuisance behavior. The most numerous nuisance complaints are flooding farm lands and crop destruction from eating and flooding. Eurasian beavers also flood roadways and culverts and can cause extensive timber damage.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eurasian beavers were heavily trapped and hunted for their pelts, castoreum, and meat. Pelts were sold and even used as currency right up to their near extinction. Furs were used to make garments, felt, and, most notably, felt hats. Castoreum was used as a medicine and a base for perfumes. Beaver meat was also prized as food. In the 16th century the Pope claimed, due to the scaly tail and semi aquatic life style, that beaver could be considered a fish and be eaten during Catholic fasting days. Even today 400 tons of beaver meat are consumed during lent every year in Europe.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian beaver

The Eurasian beaver or European beaver (Castor fiber) is a species of beaver which was once widespread in Eurasia. It was hunted to near-extinction for both its fur and castoreum, and by 1900 only 1,200 beavers survived in eight relict populations in Europe and Asia. Re-introduced through much of its former range, it now occurs from Great Britain to China and Mongolia, although it is absent from Italy, Portugal and the southern Balkans.[2][4][5]

Physiology[edit]

Physical characteristics[edit]

The fur colour of Eurasian beavers varies geographically. Light, chestnut-rust is the dominant colour in Belarus. In Russia, the beavers of the Sozh River basin are predominantly blackish brown, while beavers in the Voronezh Reserve are equally distributed between brown and blackish-brown.[2]

Eurasian beavers are one of the largest living species of rodent and are the largest rodent native to Eurasia. They weigh around 11–30 kg (24–66 lb), with an average of 18 kg (40 lb). While the largest specimen confirmed on record weighed 31.7 kg (70 lb), the Smithsonian has reported that this species can exceptionally exceed 40 kg (88 lb). Typically, the head-and-body length is 80–100 cm (31–39 in) and the tail length is 25–50 cm (9.8–19.7 in).[2][6][7]

Differences from North American beaver[edit]

Although the Eurasian beaver appears superficially similar to the North American beaver, there are several important differences between the two species.

The Eurasian beaver has the following anatomical differences to North American beaver: it has a larger, less rounded head; a longer, narrower muzzle; a narrower, less oval-shaped tail; shorter shin bones, making it less capable of bipedal locomotion than the North American species. The Eurasian beaver also has longer nasal bones, with the widest point being at the end of the snout; in the case of the North American beaver, the widest point is at the middle of the snout. The Eurasian beaver has a triangular nasal opening, unlike those of the North American beavers, which are square. Furthermore, the foramen magnum is rounded in the Eurasian beaver, but triangular in the North American beaver. The anal glands of the Eurasian beaver are larger, and thin-walled, with a large internal volume, relative to that of the North American beaver. The guard hairs of the Eurasian beaver have longer hollow medullas at their tips. There is also a difference in fur colour: overall, 66% of Eurasian beavers have beige or pale brown fur, 20% have reddish brown, nearly 8% are brown, and only 4% have blackish coats; in North American beavers, 50% have pale brown fur, 25% are reddish brown, 20% are brown, and 6% are blackish.[2]

The two species are not genetically compatible. The North American beaver has 40 chromosomes, while the Eurasian beaver has 48. After more than 27 attempts, made in Russia, to hybridize the two species, the result was one stillborn kit that was bred from the pairing of a male North American beaver and a female Eurasian beaver. The aforementioned factor makes interspecific breeding unlikely in areas where the two species' ranges overlap.[2]

Subspecies of Eurasian beaver[edit]

Historically, eight subspecies of Castor fiber were described, one for each of the eight 19th–20th century refugia where the species never became extinct. The basis of the differentiation was morphological, largely based on very small differences in cranial morphology, but has been recently refuted based on genetic studies.[8] In 2005, Durka et al. showed that only two evolutionarily significant units (ESUs) exist based on mitochondrial DNA studies, a western phylogroup (C. f. gallicus, C. f. albicus and C. f. fiber) and an eastern phylogroup (C.f. ssp., C. f. tuvinicus, C. f. pohlei, C. f. birulai).[9] In addition, Ducroz et al. found that even in the more genetically diverse eastern phylogroup, the degree of genetic divergence was below thresholds considered sufficient for subspecies differentiation.[10]

Reproduction[edit]

Eurasian beavers have one litter per year, coming into estrus for only 12 to 24 hours, between late December and May but peaking in January. Unlike most other rodents, beaver pairs are monogamous, staying together for multiple breeding seasons. Gestation averages 107 days and they average three kits per litter with a range of two to six kits. Most beaver do not reproduce until they are three years of age, but about 20% of two-year-old females reproduce.[11]

Range[edit]

Areas inhabited by beavers in Europe outside of Russia in 2001. Red shows range of Eurasian beaver; purple shows range of introduced American beaver in Finland.

The Eurasian beaver is recovering from near extinction, after depredation by humans for its fur and for castoreum, a secretion of its scent gland believed to have medicinal properties.[12] The estimated population was only 1,200 by the early 20th century.[13] In many European nations, the beaver went extinct but reintroduction and protection has led to gradual recovery to approximately 639,000 individuals by 2003.[14] Milishnikov found in genetic studies that beaver likely survived east of the Urals from a nineteenth-century population as low of 300 animals, and that factors contributing to their survival include their ability to maintain sufficient genetic diversity to recover from a population as low as 3 individuals, and that beavers are monogamous and select mates that are genetically different from themselves.[15][16] 83% of Eurasian beavers live in the former Soviet Union thanks to reintroductions, however the result is that beaver in Mongolia or Siberia do not appear significantly genetically different from samples from the European part of Russia, despite the great geographical distance.[17]

Continental Eurasia[edit]

In France, the Eurasian beaver was almost wiped out, but a small population survived on the Rhône, near Lyon, from where it has been reintroduced to other parts of the country. The French population of beavers is estimated to be 10,000-12,000 individuals in 2009.[18]

In Germany, beavers had become close to extinct in the 19th century. Smaller populations survived along the Elbe and spread into Brandenburg, Mecklenburg-Vorpommern and Saxony after being protected. It is estimated that today beavers in Germany number up to 25,000 all across the country, even appearing in many urban areas. The largest beaver populations are found in eastern Germany (6,000, descendants of the Elbe beavers), and in Bavaria along the Danube and its tributaries. After a resettlement programme started in 1966, their number in Bavaria is estimated at around 14,000.[19][20]

Beavers were reintroduced in the Netherlands in 1988 after being completely exterminated in the 19th century. After its reintroduction in the Biesbosch, the Dutch population has spread considerably (supported by additional reintroductions), and can now be found in the Biesbosch and surrounding areas, along the Meuse in Limburg, and in the Gelderse Poort and Oostvaardersplassen. In 2012 the population was estimated at about 600 animals and could easily grow to 7000 in twenty years time.[21] According to the Mammal Society and the Dutch Water board, this will cause a threat to the river dikes. The main problem is that beavers excavate corridors and caves in dikes, thereby undermining the stability of the dike, just as the muskrat and the coypu do.[21] If problems become unmanageable, as local administrators in Limburg fear, the beaver will be captured again.[22]

After major flooding in Poland in May and June 2010, the Polish government and local authorities held beavers responsible for causing the flooding and demanded the culling of 150 beavers.[23]

In Romania, beavers became extinct in 1824, being reintroduced in 1998, along the Olt River, spreading to other rivers in Covasna County.[24] In 2014, it was confirmed that the animals had reached the Danube Delta.[25]

Non-government sanctioned re-introduction in Spain around 2003 has resulted in tell-tale beaver sign documented on a 60 km stretch on the lower course of the Aragon River and the area adjoining the Ebro River in Aragon, Spain.[26]

In the former Soviet Union, almost 17,000 beavers were translocated from 1927 to 2004, of which 12,000 were to Russia, and the remainder to the Ukraine, Belarus, the Baltic States and Kazakhstan.[4] They are now common in Estonia and Latvia.

In China, a few hundreds of beavers are known to live in the basin of the Ulungur River, near Mongolian border. The Bulgan Beaver Nature Reserve (Chinese: 布尔根河河狸自然保护区; 46°12′00″N 90°45′00″E / 46.20000°N 90.75000°E / 46.20000; 90.75000) has been established in 1980 to protect the creatures.[27][28]

The recently resurgent beaver population in Eurasia has resulted in increases in human-beaver encounters.[29] Indeed, in May 2013, a Belorussian fisherman died after being bitten several times by a beaver, severing an artery in his leg and causing him to bleed to death.[29]

A Eurasian beaver in Estonia

Scandinavia[edit]

In Sweden, the beaver had been hunted to extinction by around 1870.[12] Between 1922 and 1939, approximately 80 individuals were imported from Norway and introduced to 19 separate sites within the country. Beaver re-introduced to central Norway's Ingdalselva River watershed on the Agdenes peninsula, Sør-Trøndelag County in 1968-1969, were recently studied and shown to cross multiple mountain divides and to swim across 25 km of sheltered salt water in order to recolonize outlying suitable habitat.[30]

In Denmark, the beaver was reintroduced to the wild in western Jutland in 1999[31] and in Arresø, northern Zealand, in 2009[32] after it was hunted to extinction c. 1000 CE. The reintroduced beavers were caught in the river Elben in Germany. As of 2013, the Danish population of beavers was estimated to be approximately 185 individuals.[33]

Some Eurasian beaver are present in Finland, but most of the Finnish population is a released population of C. canadensis, the North American species. (These animals were imported to Finland in 1937, when it was not yet known that C. canadensis was a different species from the Eurasian beaver.)

Great Britain[edit]

Tayside mother beaver with her kit.

The beaver became extinct in Great Britain in the sixteenth century: Giraldus Cambrensis reported in 1188 (Itinerarium ii.iii) that it was to be found only in the Teifi in Wales and in one river in Scotland, though his observations are clearly secondhand. The last reference to beavers in England dates to 1526.[34] About the same time, Hector Boece wrote that they were still common in parts of Scotland, especially around Loch Ness.

As a former British species, there has been interest in reintroducing beavers to the wild across Britain. It has been suggested that beaver dams could retain water in upland areas, reducing flood volumes and creating new habitats for wildlife. Currently, beaver populations are found in a number of large enclosures in wildlife parks, as well as free-living populations around the River Tay and Knapdale areas in Scotland and River Otter in Devon, in south-west England. The Knapdale population was deliberately released, while the other populations are of unknown origin.

In 2001, the Kent Wildlife Trust with the Wildwood Trust and Natural England imported two families of Eurasian beaver from Norway to manage a wetland nature reserve. This project pioneered the use of beaver as a wildlife conservation tool in the UK. The success of this project has provided the inspiration behind other projects in Gloucestershire and Argyll. The Kent beaver colony lives in a 130-acre (0.53 km2) fenced enclosure at the wetland of Ham Fen. Subsequently, the population of beaver has been supplemented in 2005 and 2008. The beaver continue to help restore the wetland by rehydrating the soils.[35] Six Eurasian beavers were released in 2005 into a fenced lakeside area in Gloucestershire.[36] In 2007, a specially-selected group of four Bavarian beavers were released into a fenced enclosure in the Martin Mere nature reserve in Lancashire.[37] It is hoped that the beavers will form a permanent colony, and the younger pair will be transferred to another location when the adults begin breeding again.[38] The progress of the group will be followed as part of the BBC's Autumnwatch television series. On November 19, 2011, a pair of beaver sisters were released into a 2.5 acre enclosure at Blaeneinion,[39] Furnace, Mid Wales.[40] A colony of beavers is also established in a large enclosure at Bamff, Perthshire.[41]

The first sustained and significant population of wild-living beavers in the United Kingdom became established on the Tay catchment in Scotland as early as 2001 and has spread widely in the catchment, numbering from 20 to 100 individuals.[42] Because these are likely escapees from any of several nearby sites with captive beavers, or were illegally released, they were targeted for removal by Scottish Natural Heritage in late 2010.[43] Proponents of the beavers argue that there is no reason to believe that they are of "wrong" genetic stock.[42] One of the wild Tayside beavers was trapped by Scottish Natural Heritage on the River Ericht in Blairgowrie, Perthshire in early December 2010 and is being held in captivity in the Edinburgh Zoo. More recently a beaver has taken up residence on the Loch of the Lowes, possibly coming from the Tayside population.

In 2005, the Scottish Government turned down a licence application for unfenced reintroduction. However, in late 2007, a further application was made for a release project in Knapdale, Argyll.[44] This application was accepted, and the first beavers were released on 29 May 2009.[45][46] This initial release into the wild of 11 animals received a setback during the first year with the disappearance of two animals and the alleged illegal shooting of a third. This allegation was later refuted by Simon Jones of the Scottish Beaver Trial as there was no evidence to support the allegation and all three missing beavers were sighted after they had left the release loch. However, the remaining population was increased by further releases in 2010.[47] In August 2010, at least two kits, estimated to be eight weeks old and belonging to different family groups, were seen in Knapdale Forest in Argyll.[48] Based on these results, the Scottish charity Trees for Life has proposed reintroducing beavers in the Scottish Highlands.[49][50]

A group of three beavers was spotted on the River Otter in Devon in 2013, apparently successfully bearing three kits the next year.[51][52] Following concern from local landowners and anglers, as well as farmers worrying that the beavers could carry disease, the government announced that it would capture the beavers and place them in a zoo or wildlife park. A sport fishing industry lobbyist group, the Angling Trust, said "it would be irresponsible even to consider re-introducing this species into the wild without first restoring our rivers to good health."[53] These actions were protested by local residents and campaign groups, with environmental journalist George Monbiot describing the government and anglers as 'control freaks': "I'm an angler, and the Angling Trust does not represent me on this issue...most anglers, in my experience, have a powerful connection with nature. The chance of seeing remarkable wild animals while waiting quietly on the riverbank is a major part of why we do it."[54] As of October 2014, the beavers remained in the wild.[55]

A study has been undertaken on the feasibility and desirability of a reintroduction of beavers to Wales by a partnership including the Wildlife Trusts, Countryside Council for Wales, Peoples Trust for Endangered Species, Environment Agency Wales, Wild Europe, Forestry Commission Wales, with additional funding from Welsh Power Ltd. The resulting reports were published in 2012 with the launch of the Welsh Beaver Project, which is a partnership led by the Wildlife in Wales, and are downloadable from www.welshbeaverproject.org.[dated info] A 2009 report by Natural England, the Government’s conservation body, and the People's Trust for Endangered Species recommended that beaver be reintroduced to the wild in England.[56]

Ecology[edit]

Beaver are a keystone species helping support the ecosystem of which they are a part. They create wetlands, which increase biodiversity and provide habitat for many rare species such as water voles, otters and water shrews. They coppice waterside trees and shrubs so that they re-grow as dense shrubs which provide cover for birds and other animals. Beaver dams trap sediment and improve water quality; recharge groundwater tables and increase cover and forage for trout and salmon.[56] A recent study in Poland found that beavers increased the abundance and diversity of bats, apparently because they create gaps in forest cover making it easier for bats to navigate in.[57]

Effects on fish[edit]

Beaver ponds have been shown to have a beneficial effect on trout and salmon populations, in fact many authors believe that the decline of salmonid fishes is related to the decline in beaver populations. A study of small streams in Sweden found that brown trout in beaver ponds were larger than those in riffle sections, and that beaver ponds provide habitat for larger trout in small streams during periods of drought.[58] These findings are similar to several studies of beaver effects on fish in North America. Brook trout, coho and sockeye salmon were significantly larger in beaver ponds than those in un-impounded stream sections in Colorado and Alaska.[59][60] In addition, research in the Stillaguamish River basin in Washington state, found that extensive loss of beaver ponds resulted in an 89% reduction in coho salmon smolt summer production and an almost equally detrimental 86% reduction in critical winter habitat carrying capacity.[61] Migration of adult Atlantic salmon (Salmo salar) may be limited by beaver dams during periods of low stream flows, but the presence of juveniles upstream from the dams suggests that the dams are penetrated by parr.[62] Downstream migration of Atlantic salmon smolts was similarly unaffected by beaver dams, even in periods of low flows.[62] Two year old Atlantic salmon parr in beaver ponds in eastern Canada showed faster summer growth in length and mass and were in better condition than parr upstream or downstream from the pond.[63] The importance of winter habitat to salmonids afforded by beaver ponds may be especially important (and underappreciated) in streams without deep pools or where ice cover makes contact with the bottom of shallow streams.[62] A 2003 study showed that Atlantic salmon and Sea trout (S. trutta morpha trutta) spawning in the Numedalslågen River and 51 of its tributaries in southeastern Norway were unhindered by beaver.[64] In Norway, beaver dams are considered beneficial for Brown and Sea Trout populations (these are potamodromous and anadromous forms of the same species). There, beaver ponds produce increased food for young fish and provide refugia for large adults heading upstream to spawn.[65]

Effect on water quality[edit]

The misnomer ‘beaver fever’ was invented by the American press in the 1970s after an outbreak of Giardia lamblia, which causes Giardiasis, was blamed on beavers. However, the outbreak area was also frequented by humans, who are generally the primary source of contamination of waters. In addition, many animals and birds carry this parasite.[66][67][68] Giardiasis affects humans in southeastern Norway, but a recent study found no Giardia in the beavers there.[69] Recent concerns point to domestic animals as a significant vector of Giardia with young calves in dairy herds testing as high as 100% positive for Giardia.[70] New Zealand has Giardia but no beavers. In a 1995 paper recommending re-introduction of beaver to Great Britain, MacDonald stated that the only new diseases that beaver might convey to that country's birds and mammals, are rabies and tularaemia - both diseases that should be preventable by statutory quarantine procedures and prophylactic treatment for tularaemia.[65]

In addition, fecal coliform and streptococci bacteria excreted into streams by grazing cattle have been shown to be reduced by beaver ponds, where the bacteria are trapped in bottom sediments.[71]

Gallery[edit]

See also[edit]

References[edit]

  1. ^ Kryštufek, B., Meinig, H., Zima, J., Henttonen, H. & Balciauskas, L. (2007). "Castor fiber". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 5 January 2013. 
  2. ^ a b c d e f g h i j k Kitchener, Andrew (2001). Beavers. p. 144. ISBN 1-873580-55-X. 
  3. ^ a b "Genetic Divergence and Similarity of Introduced Populations of European Beaver (Castor fiber L., 1758) from Kirov and Novosibirsk Oblasts of Russia". Russian Journal of Genetics (MAIK Nauka/Interperiodica distributed exclusively by Springer Science+Business Media LLC. ISSN): 1022–7954 (Print) 1608–3369 (Online), Issue. January 2001. Retrieved 2012-01-01. 
  4. ^ a b Duncan Halley, Frank Rosell, Alexander Saveljev (2012). "Population and Distribution of Eurasian Beaver (Castor fiber)". Baltic Forestry 18: 168–175. Retrieved 2012-09-03. 
  5. ^ Helgen, K. M. (2005). "Family Castoridae". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 842–843. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  6. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  7. ^ "Eurasian beaver videos, photos and facts - Castor fiber". ARKive. Retrieved 2012-08-13. 
  8. ^ Duncan J. Halley (2010). "Sourcing Eurasian beaver Castor fiber stock for reintroductions in Great Britain and Western Europe". Mammal Review: 1–14. doi:10.1111/j.1365-2907.2010.00167.x. 
  9. ^ Durka W, Babik W, DuCroz J-F, Stubbe M, Heidecke D, Samjaa R, Saveljev AP, Stubbe A, Ulevicius A, Stubbe M. (2005). "Mitochondrial phylogeography of the Eurasian beaver Castor fiber L.". Molecular Ecology: 3843–3856. doi:10.1111/j.1365-294X.2005.02704.x. 
  10. ^ J-F. DuCroz, M. Stubbe, A. P. Saveljev, D. Heidecke, R. Samjaa, A. Ulevicius, A. Stubbe, W. Durka (2005). "Genetic variation and population structure of the Eurasian beaver Castor fiber in Eastern Europe and Asia". Journal of Mammalogy: 1059–1067. doi:10.1644/1545-1542(2005)86[1059:GVAPSO]2.0.CO;2. Retrieved 2012-01-01. 
  11. ^ Dietland Müller-Schwarze, Lixing Sun (2003). The Beaver: Natural History of a Wetlands Engineer. Cornell University Press. p. 80. ISBN 978-0-8014-4098-4. Retrieved 2011-06-25. 
  12. ^ a b Sigvald Salvesen (1928-05). "The Beaver in Norway". Journal of Mammalogy: 99–104. JSTOR 1373424. 
  13. ^ Nolet, B.A. & Rosell, F. (1998). "Come back of the beaver Castor fiber: an overview of old and new conservation problems". Biological Conservation: 165–173. 
  14. ^ Halley, D. & Rosell, F. (2003). "Population and distribution of European beavers (Castor fiber)". Lutra: 91–101. Retrieved Feb 28, 2010. 
  15. ^ Sergey Komarov. "Why Beavers Survived in the 19th Century". Innovations Report. Retrieved 2010-09-08. 
  16. ^ A. N. Milishnikov (2004). "Population-Genetic Structure of Beaver (Castor fiber L., 1758) Communities and Estimation of Effective Reproductive Size Ne of an Elementary Population". Russian Journal of Genetics: 772–781. Retrieved 2010-09-08. 
  17. ^ Jean-Francois Ducroza, Michael Stubbeb, Alexander P. Saveljevc, Dietrich Heideckeb, Rivčan Samjaad, Alius Ulevičiuse, Annegret Stubbeb, and Walter Durka (2005). "Genetic Variation and Population Structure of the Eurasian Beaver Castor Fiber in Eastern Europe and Asia". Journal of Mammalogy 86 (6): 1059–1067. doi:10.1644/1545-1542(2005)86[1059:GVAPSO]2.0.CO;2. ISSN 1545-1542. Retrieved 2010-09-08. 
  18. ^ "Oncfs - Le Castor d'Europe". 
  19. ^ http://www.zeit.de/2012/26/WOS-Biberkrach
  20. ^ http://www.spiegel.de/wissenschaft/natur/artenvielfalt-biber-in-deutschland-wieder-auf-dem-vormarsch-a-890433.html
  21. ^ a b http://www.volkskrant.nl/vk/nl/2664/Nieuws/article/detail/3347229/2012/11/13/Het-gaat-te-goed-met-de-bevers.dhtml
  22. ^ http://www.volkskrant.nl/vk/nl/2686/Binnenland/article/detail/3368729/2012/12/26/Steeds-meer-overlast-door-bevers.dhtml
  23. ^ Polish authority wants to cull 150 beavers after flooding.
  24. ^ "Dispăruți de la 1824: Castorii repopulează apele din Covasna". Evenimentul Zilei. Retrieved February 3, 2008. 
  25. ^ "Castorul a revenit în Delta Dunării, după 200 de ani de la dispariție". România Liberă. Retrieved June 5, 2014. 
  26. ^ Juan Carlos Cena, et al. "Castor Europeo en Navarra y la Rioja". Galemys 2: 91–98. Retrieved 2012-09-03. 
  27. ^ Hongjun Chua and Zhigang Jianga, Distribution and conservation of the Sino-Mongolian beaver Castor fiber birulai in China. Oryx / Volume 43 / Issue 02 / April 2009, pp 197-202
  28. ^ 布尔根河狸自然保护区 (Bulgan Beaver Nature Reserve)
  29. ^ a b "Beaver Kills Man in Belarus". The Guardian. Associated Press. 2013-05-29. Retrieved 2013-05-31. 
  30. ^ Duncan J. Halley, Ivonne Teurlings, Hannah Welsh and Claire Taylor (2013). "Distribution and patterns of spread of recolonising Eurasian beavers (Castor fiber Linnaeus 1758) in fragmented habitat, Agdenes peninsula, Norway". Fauna norvegica 32: 1–12. doi:10.5324/fn.v32i0.1438. Retrieved 2013-02-25. 
  31. ^ "Bæverne i Klosterheden - Bævere i Danmark - Skov- og Naturstyrelsen". Skovognatur.dk. 2008-12-19. Retrieved 2010-03-15. 
  32. ^ "Udsætning af bævere i Arresø og søens opland - Skov- og Naturstyrelsen". Skovognatur.dk. 2010-01-04. Retrieved 2010-03-15. 
  33. ^ "Dansk bæverbestand er tidoblet". Naturstyrelsen. 2013-04-17. Retrieved 2014-02-03. 
  34. ^ Martin, Horace T. (1892). Castorologia: Or The History and Traditions of the Canadian Beaver. W. Drysdale. p. 26. ISBN 0-665-07939-7. 
  35. ^ "Born to be Wild! Beavers breed at Kent reserve". Retrieved Feb 28, 2010. 
  36. ^ "Beavers in 'wild' after centuries". BBC News. 2005-10-28. 
  37. ^ "Beavers are back after 500 years". BBC News. July 2007. 
  38. ^ "Meet the Beavers". Wildfowl & Wetlands Trust. Retrieved November 8, 2007. [dead link]
  39. ^ "Beavers". Blaeneinion. 2011-11-19. Retrieved 2012-08-13. 
  40. ^ Rachael Garside (2012-02-10). "Blogs - Wales - Beavers return to Ceredigion". BBC. Retrieved 2012-08-13. 
  41. ^ "Vines, Gail, "The beaver: destructive pest or climate saviour?", 22 August 2007, ''New Scientist'' '''2618''': 42-45. Article on beaver reintroduction". Newscientist.com. Retrieved 2010-03-15. 
  42. ^ a b Duncan J. Halley (2011-1). "Sourcing Eurasian beaver Castor fiber stock for reintroductions in Great Britain and Western Europe". Mammal Review 41: 40–53. doi:10.1111/j.1365-2907.2010.00167.x. 
  43. ^ "Feral beavers in Tayside 'will be trapped'". BBC News. 2010-11-26. Retrieved 2011-01-05. 
  44. ^ Watson, Jeremy (2007-09-30). "Beavers dip a toe in the water for Scots return". The Scotsman (Edinburgh). Retrieved 2007-12-11. 
  45. ^ "UK | Scotland | Glasgow, Lanarkshire and West | Beavers to return after 400 years". BBC News. 2008-05-25. Retrieved 2010-03-15. 
  46. ^ "UK | Scotland | Glasgow, Lanarkshire and West | Beavers return after 400-year gap". BBC News. 2009-05-29. Retrieved 2010-03-15. 
  47. ^ "New breeding beaver pair released in Scotland". BBC News. 10 May 2010. Retrieved 10 May 2010. 
  48. ^ "'First' newborn beavers spotted in the Argyll Forest". BBC News. 13 August 2010. Retrieved 15 August 2010. 
  49. ^ "Forest restoration project begins". BBC News. 3 November 2009. Retrieved 1 December 2009. 
  50. ^ "Viva la beaver: Britain's population is beginning to thrive again". The Independent (London). 10 July 2008. Retrieved 1 December 2009. 
  51. ^ "Beaver spotted in Devon's River Otter by dog walker". BBC News. Retrieved 2 October 2014. 
  52. ^ Aldred, Jessica. "Wild beaver kits born in Devon". Guardian. Retrieved 2 October 2014. 
  53. ^ Lloyd, Mark. "Angling Trust welcomes action to remove beavers from Devon River". Angling Trust. Retrieved 1 October 2014. 
  54. ^ Monbiot, George. "Stop the control freaks who want to capture England's wild beavers". Guardian. Retrieved 1 October 2014. 
  55. ^ |url=http://www.theguardian.com/environment/2014/jun/30/first-england-beavers-in-centuries-captured
  56. ^ a b J. Gurnell, et al. REINTRODUCING BEAVERS TO ENGLAND Digest of a report The feasibility and acceptability of reintroducing the European beaver to England (Report). http://naturalengland.etraderstores.com/NaturalEnglandShop/NECR002. Retrieved Feb 28, 2010.
  57. ^ Ella Davies (2011-01-17). "European beavers construct ideal habitats for bats". BBC News (BBC). Retrieved 2011-01-17. 
  58. ^ Hägglund, Å. & Sjöberg, G. (1999). "Effects of beaver dams on the fish fauna of forest streams". Forest Ecology and Management: 259–266. doi:10.1016/S0378-1127(98)00404-6. 
  59. ^ Rutherford, W.H. (1955). "Wildlife and environmental relationships of beavers in Colorado forests". Journal of Forestry: 803–806. Retrieved Feb 28, 2010. 
  60. ^ Murphy, M.L., Heifetz, J., Thedinga, J.F., Johnson, S.W. & Koski, K.V. (1989). "Habitat utilisation by juvenile Pacific salmon (Onchorynchus) in the glacial Taku River, southeast Alaska". Canadian Journal of Fisheries and Aquatic Science: 1677–1685. 
  61. ^ M. M. Pollock, G. R. Pess, T. J. Beechie (2004). "The Importance of Beaver Ponds to Coho Salmon Production in the Stillaguamish River Basin, Washington, USA". North American Journal of Fisheries Management: 749–760. Retrieved Feb 28, 2010. 
  62. ^ a b c Collen P, Gibson RJ (2001). "The general ecology of beavers (Castor spp.), as related to their influence on stream ecosystems and riparian habitats, and the subsequent effects on fish – a review". Reviews in Fish Biology and Fisheries: 439–461. Retrieved Mar 2, 2010. 
  63. ^ D. B. Sigourney, B. H. Letcher, R. A. Cunjak (2006). "Influence of Beaver Activity on Summer Growth and Condition of Age-2 Atlantic Salmon Parr". Transactions of the American Fisheries Society 135 (4): 1068–1075. doi:10.1577/T05-159.1. Retrieved Mar 1, 2010. 
  64. ^ Howard Park, Ostein Cock Ronning (July 2007). "Low Potential for Restraint of Anadramous Salmonid Reproduction by Beaver Castor Fiber in the Numedalslågen River Catchment, Norway". River Research and Applications 23 (7): 752–762. doi:10.1002/rra.1008. 
  65. ^ a b D. W. MacDonald, F.H. Tattersall, E. D. Brown, D. Balharry (1995). "Reintroducing the European Beaver to Britain: nostalgic meddling or restoring biodiversity?". Mammal Review: 161–200. doi:10.1111/j.1365-2907.1995.tb00443.x. 
  66. ^ Martin Gaywood, Dave Batty, Colin Galbraith (2008). "Reintroducing the European Beaver in Britain". British Wildlife. Retrieved 2011-03-05. 
  67. ^ Erlandsen, S. L., and W. J. Bemrick (1988). Waterborne giardiasis: sources of Giardia cysts and evidence pertaining to their implication in human infection in P. M. Wallis and B. R. Hammond (ed.), Advances in Giardia research. Calgary, Alberta, Canada: University of Calgary Press. pp. 227–236. 
  68. ^ Erlandsen SL, Sherlock LA, Bemrick WJ, Ghobrial H, Jakubowski W (January 1990). "Prevalence of Giardia spp. in Beaver and Muskrat Populations in Northeastern States and Minnesota: Detection of Intestinal Trophozoites at Necropsy Provides Greater Sensitivity than Detection of Cysts in Fecal Samples". Applied and Environmental Microbiology: 31–36. Retrieved 2011-03-05. 
  69. ^ F. Rosell, O. Rosef, H. Parker (2001). "Investigations of Waterborne Pathogens in Eurasian Beaver (Castor fiber) from Telemark County, Southeast Norway". Acta Veterinaria Scandinavica 42 (4): 479–482. PMC 2203226. PMID 11957376. 
  70. ^ R. C. A. Thompson (November 2000). "Giardiasis as a re-emerging infectious disease and its zoonotic potential". International Journal of Parasitology 30 (12-13): 1259–1267. doi:10.1016/S0020-7519(00)00127-2. PMID 11113253. 
  71. ^ Quentin D. Skinner, John E. Speck, Michael Smith, John C. Adams (March 1984). "Stream Water Quality as Influenced by Beaver within Grazing Systems in Wyoming". Journal of Range Management 37 (2): 142–146. JSTOR 3898902. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!