Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Callinectes bellicosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Callinectes bellicosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATTTTCGGAGCATGATCAGGAATAGTAGGAACCTCATTAAGTTTAATTATTCGAGCCGAATTAGGTCAACCTGGCACTCTTATTGGAAAC---GATCAAATTTATAACGTAGTCGTTACAGCCCATGCCTTCGTCATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTTATACTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGACTTCTTCCTCCATCATTAACACTTCTTCTAATAAGAGGTATAGTTGAAAGAGGGGTAGGAACGGGATGAACCGTTTACCCTCCTTTAGCGGCCGCTATTGCCCACGCAGGGGCCTCAGTGGATCTTGGTATTTTCTCTCTCCATTTGGCGGGCGTATCTTCTATTTTAGGAGCAGTTAACTTTATAACAACTGTTATTAACATACGATCTTTCGGCATAAGAATAGACCAAATACCACTATTCGTCTGATCTGTATTCATTACAGCTATTCTTCTTCTCCTCTCTCTCCCTGTCCTAGCCGGGGCTATCACTATACTTTTAACTGATCGAAATTTAAACACTTCGTTCTTTGACCCTGCTGGGGGAGGAGACCCCGTCCTCTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Callinectes bellicosus

Callinectes bellicosus is a species of swimming crab in the genus Callinectes. They are native to warm waters and shorelines in Mexico.[2] They are prepared and eaten in the same manner as blue crabs.

References

  1. ^ "Callinectes bellicosus (Stimpson, 1859)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=98702. Retrieved February 21, 2011.
  2. ^ E. Pfeiler, L. A. Hurtado, L. L. Knowles, J. Torre-Cosío, L. Bourillón-Moreno, J. F. Márquez-Farías and G. Montemayor-López. "Population genetics of the swimming crab Callinectes bellicosus (Brachyura: Portunidae) from the eastern Pacific Ocean". Marine Biology 146 (3): 559–569. doi:10.1007/s00227-004-1463-y.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!